Spermophilus_tridecemlineatus Locus SF3B3
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SF3B3
Spermophilus_tridecemlineatus
SF3B3
GeneScaffold_3637
SNORD111
3616..3691
47094
CAATTAAGGGGGAAGATGAACTCATGTTGCTGAACTAGTAAATTGGTTGGGTCTATTTG
GAAAGGCAGTTTGGTAGTATCTATCAAAATTTCTTATGTATGAACCTTTCAATCTATGAC
TTTTAGGAATTAATCTTAGGGATGTACTCATGCGTAAATGAAACATGAAATATTTTCTGT
GTGGCAGTGATTGTAATAGTTAAGAGGTTGAAACAAGCTCAATGTTAATTAGTGGAGTAT
TGGCTAAATGAATTATAATATAACCATTAAATGGAATACTTGCCACTATCAGATAAAAAT
GAGAAAGCCCTTTATTGCTATCTCAAAGTAGTTAAATAATAAGAAATCAGTTGTACTATA
GTGTGAGTATATAAAATATAATTCCCAACCTTATGTTAAACAAGAGAAGATAGAACAGTA
TAAATATATCTGTATATATGGAAGGATATAATATAATTTGATAAAATTGATTCCCCCAGG
GAGAACTGGATGACTAGGGAATGGATTAGGGAGTTTTTTGCTGTGCTTTTTGAATTTAAC
CATTTGAATGTAAGCCTATTAGAATACAATGAAACATAGACCTACATAAACATTGACAAA
AAAGTAAACAAAGTTGCATTGATGGAATATATCCCAGCTTCCTCCCTTTCACCACTTGGC
TTTATGATCTTAGGCAGTTGATTTAATTTCTGAGCCCCAGTGTCCTTATCTATAAAATTA
GTATAAAACTGCATACTTTTTAGGATTCTTGTGAGATTGCAAGTGAAGTATATAGTGGTG
CCTGGTATGTAGAAGGCACTCTTAATTATCAGTGTTGTTTTTCAATAGGCCTTATTCTAC
CCGTTCTGCTACCTTCAATCAGAAATTCCTGTACAAAAATATCTGTTAAAATAATAATTT
CCCAGCTACTTTTTTGTTTTTATGTGTCCTTAGCTTGCTTTGACTTGACTGTTGGTATTA
CCAAGTCCTAGAGTACTGAGTGGCTTAGTTTTGTTGCCATCATGTTCCTGTACAATTTGA
CCTTGCAGCGAGCCACTGGCATCAGCTTTGCCATTCATGGCAATTTCTCTGGTAAGTTCT
CCAGCCAGTTACTATTTTTGTGAATTGAAATGAGTCATTACATATTTTGCTTATATTTTG
TGGAGGAAATGTTTTCCATTTATAAGAAGGTAATTGTTGGTAAATGTGAACAATCCAAAT
GTGGCTTGTAATCCATGAGATTTCTATTAAATTGAAGTGTATTATTTGTTATTTAATTCC
AAACGGATTTCTTAGCTCTGTGTATGATGATTTTTCCAGAAGTACACATTTCTTGTGCTA
TTTACTTGGTGCCAGTTTAATTGTATTTTGCTGTAAGACATAACAAGATGTGTAAGTCTT
GATCCTTGATCCTAAATTTGATATCAGATTGGATAAAAAGAATGTCTAACTGGGCGCAGT
GGCACATGCCTATAATCTCAGGGTCTTGGGAGGTGGAGGCAGGAGGGTTGCAAGTTCAAA
GCCAGCCTCAGCAGTTTAGGACTCACTCATCCCGTCTCTAATAAAAACATAAAAAAAGGA
CTGGGGACGTGGCTCCATGTTTAAGTGCCCCTGATTCAATCCTGGTCCCCCCCCCAAAAA
AAAAAAATGTCTAAAGGTGTTACCAGAGAGAATAGTTCATTCAAAAGGTGTTTTTATTCT
TACTTTTTAAGGGAAGGTTGTACCTTATCTTGGTATATTAAAATTTGTGTGTAAGAGAAG
GGGAAGTGCAATTTAGATAGAAATTGCTGCGTGTGTAGAAACAACATTTACTGATGTTTT
GTTTTTGGTACTGGGGATTGAACCCATGGGTGCTTTACCATGGAGCCACATCCCCATCCT
TTTTTTACTTTTTTGAGACAGGGTCTGGCTATAAGTTGCTAAGGGCCTTTGCTGTGTTTT
TGAGGCTGGCCTAAACTTAAACAATCCTCCTGTCCTTAGCTTCCCAAGTTGCTGGGATTG
TAGACATGTGCCACTGTACCCAGCTCATTTGCTGATGTTACTCACAACCTAAATTGTGTC
ACACATAGTAAGCTGAACTCTTGGGGGATAATTTTGGAGAGATAAATTTAAAAACAGATT
GTGTGGGAAAAAAAGTCTTTTTTTTTTTTTTCTTTTTTACCAGGAAATGAACCCAGGGGC
ACTTAGCCACTGAGCTGCATCCCTAGCCTTTTATTTTGAGGCAGGTTCTTTTGCTGAGGC
TGGTCTTGAACATCCCTGCCTCAGCCTCCCAATTGTAGGGATTATAGTTGTGTGCCACCA
CTCCTGGCCAATTGTGTGAAATTTTGAATATCAGATTTAAAAAAAGAAATATCAGATAGT
GGAGTTACAGAAAATAAGCTACTAATGTGTATAAAAATAAAACCTTGCCATTGTAGATTT
GAACTTTTCTTTTTTTATACTGGGCACTTGAACCACTGAGCTATTGAACCACTGAGCTAC
AATCCTAGCGCCCCCCCCCCTTTTGAGATGGGGGGCGGGGGGGGGGGGCTTACTAAATTG
CCTAAGGCCTCACAGATTGCTGAGGCTGGCTTTGAACTTAGAATCCTGCCTCAGTCTCCC
GAGTGGCTGGGATCACGGATGTGTATGCTACTATACCCAGCTTACATTTGAACATTTGTA
AGTTAATTCATAAGTAATGCAGGAGGTTCATGAGTGTGTAGACAATTTTTTGAGATTCAA
GTTCTTAAAGTAACTTGTGGCTGGACTTGGTGGTACACACCACTGTAATCCCAGTTTGAC
TTGGGAGGCTGAGGCAAAAGGATCACAAGTTTGAGGCCAATCTCAGCAGCTTAGCAAGAC
TTTGTCTCAGAATAAGAAAATAGAAAGTATAGCTCAGTAGTAACGCACTTTTGGGATCAA
TCCCCAGTACCAAACAAAAAATAAAACAAAAACAGTGGGCCCCCCAACTTGTTTAATTTA
TCTTCAGTGGCATTTCAATTTAGCTGTTATTATTGGGCTATCTCTGGTTGTTTATGATCT
TTAATTTTTGGTGATTTAGGAACCAAACAACAGGAAATTGTTGTTTCTCGTGGGAAGATC
TTGGAGCTACTTCGCCCAGACCCTAACACTGGAAAAGTACATACCCTCCTCACTGTGGAA
GTATTTGGTGTTATCCGGTCACTCATGGCCTTTAGGTTGACAGGTGGCACCAAGGACTAC
ATTGTAGTTGGCAGTGACTCAGGTCGGATTGTTATCTTGGAATACCAGCCATCTAAGAAT
ATGTTTGAGAAAATTCACCAAGAAACTTTTGGCAAAAGTGGATGTCGCCGAATTGTTCCT
GGCCAGTTTTTAGCTGTGGATCCCAAAGGGCGAGCTGTTATGATTAGTGAGTGACTTGCT
TTATTTACTCAAAAGAGTGCATCTTTGATTCTTATAAATGCTCAGTTTAGGATAATGATG
CTGTGATCTTGGCAGTGTGCCAGTCAGTTGTTTAACCTGGGTGAAGTTGGGCATTTTATT
TGAATTCAGTTACATTTCCTTTTTTAAAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCTCATCAGCTGAAGTGATGATCACATCATGTCTCTTCTCTGATAAATTT
TTGAAGGAAATTCTGTGTATCTGATCAGGCCTCTAGAGGGCAACCCTCTCTGAGCAGTCA
CAAAATCATGAGGTCTAATTTTAAAAAAATGGTTTTGTTATTATTTAGTTTTCCAGTATC
CTTAAATATAGGGCATATTTTTGAAGAGTTATTCAGATATTAAGATTCCCTTAGGAAGGG
ATGCAGAATCTTGAGTTACTATACTTGTTGACTTAATGCTGGCTGTTAAAAAGTAATCAT
GATGTGAATTGAGCTGTTGTGTGACTCATTATGTGGAAATCTGGTATGTTTTGTCTCCTT
GAACTGTAGGTGCCATTGAGAAACAGAAGTTGGTATATATCTTGAACAGAGATGCTGCAG
CCCGACTTACCATTTCATCTCCCTTGGAGGCTCACAAAGCAAACACTTTAGTATATCATG
TGGTTGGAGTAGATGTAGGATTTGAAAATCCAATGTTTGCTTGTCTGGAAATGGATTATG
AGGTAATGAGGACTGTGTTTTTCTCTTTGTCTTCTTTGAATTTCTTCCAGTCTCCTCATT
GTCTTCCTACAATTGTTTTCTTTATTCACATTGTAAATCTGTCTTGCTAGCAGATATCCA
TATTCCAAATACCTTACTGAAATTCTCTGGAATGTTTCAGAGCTTAACCAGTTGACTGTA
TACATGGTAGCCTTTTCTCTGATTTAAACAATCTCCCTATGGGCTAAAGTATTTGTTGGG
GAAAACTGGATGAAAAAATATCCCTGTTTGGGATATTTTTTCCAAAGGAAGATGGTGAAA
GGCAGAGCATATCCATCTTTGCCTTGAATAGAAGGTAGAACGTAGAGACCCAGAATTTGG
AGATATGGGTCCTTGTTCTAGCTCTATCATTATATAGTAGTGTGAACTTTGTAACCTTGG
CCCTCTGTTTTCTTATGTAAAATGAGGCGGTCTAATGTCTTTTCCCAGTCTACCGTACAA
ATTCTTTGGTTTTATGATTCTAATTGATTGGTTTTATGCTACTGAACTTCTCTGTAGGAA
GCAGACAATGATCCAACAGGGGAAGCAGCAGCAAATACTCAGCAGACACTTACTTTCTAT
GAACTAGACCTTGGTTTAAATCATGTGGTCCGAAAGTACAGTGAACCTTTGGAGGAACAT
GGCAACTTCCTTATAACAGGTACTTTTCTTGCAGAGCTACTCTGTCCCTTTTATTTGATC
CATTTGATGCCCAAACTTAGTGAGGTTTGAAAAGTAATTTATTTGTAGTAAACTTGAGTA
CCTTTTCTATGTTTCGTTGAGGGTAGAAATTAGTACAGTGATAAAAAGAAAAAGTATTGT
GGGAGAGAAGTATCTAGCTCCTTAGTAGCTTTCATAATCTAATGGGAGTGGGGAGGAAAG
GACATAGCTTGAAATATTGATTACTACTAGTTGCTGTGATAATTTGATTGTAGTCAGTTT
TTCCTTTTCACCTAAACGTATTTTGAAAGGACATATAAAATGAACAAACTCAACAAGGCA
AAGCTCTGTGTCTGAATTTGAAAACTAAAATGCATAGGAAGATTTTGAAAACTAAAATCA
GTTACAAAACTGATCCAAAAAAAGAAAAGACTAACATCCATTAATAAAATTAGAGCTATT
GTCAGGAATATTTCCTTCAAAAAATTTCAGGGAACTCTTAGTATCTTGTAGAAAGTTATA
TAAATTCCTACTTTTATCACTTGCTGTAACATATTACCACATCTTTCACTTATGAGAACT
TTGTTGTTGTTTTTTTTTTTTGGTGCTGGGGGTTGAACCCAGAAACCCAGTACCTCCAGC
ATGCCAGGCAAACACTCTACCACTGAGCTATACCCCAAGCTCCATTCAACAAGTTTTTAT
TGAGCTTAATCAGTCAGTATGTGCCAAGTCAGATTACTGGGTCCTGGGACTGTAGTGGTG
AAAATTGGATGTGGTATTTCCCTTCCTACAGGATTGAGACTAGTGGTAAATACAACATCA
ACAACAACAAAAAATTGCCAGATTTTTGTGCCTATTGTCATGATAACGTAGAGGAGTGGG
TCCCTGACCTAGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGTGTATATTTCTGGTGCCTGTGTCTAGTATGACGTTGACGT
GTAATTATGTGGTTTAATCTCGTTTTAAGACCTGATTAACATAAATTTGTACCAGTAATA
TTGGTGCTTTTCCCAAATATGATATCATAAATTTGGACCAATAGTGTTGACTCAAGAGTC
CCATCTCTATCTTGGGGCCCCTTAACTAATTATCTTGAGTTACCTCAGCTATTGCTGCCA
CCACCTTTAGATGAGATAGCATACATTGAGGGACACCAGCAGGATCTAGAAACCCAACAT
CAAGGTGAGGTACAGACAATCTGCATGGGTACTACAAGAATACAGAGTAGAAACTGTAAT
ATCTCAGATCCACACTGCAAGAGAGGAAGACACAGACAACTTGAAAAAACAAGGGAGGAA
AGTGCCCCAAACAAACCAGGTTACTGTAATAACAGAACAAAGCATATTCACACCAATTCC
TGTCTTCATACATGTGCTTTGGATGATAGTGTCCCTCACATTCCATCATCATTCCTAACC
CTATGCCCCTCTATTCCCCTCCAGCCCCTCTGCCTACCTAGGGTGCGTTTATTCCTTCCA
TGCTCCCTCTTCCTACCCTACTATGAATTAGCCTCCTTTTATCAAAGAAAACATTCAGCA
TTTGGTTTTTTGGGATTGGCTAACTTCACTTAGCATTATCTTCTCTAATTCCATCCATTT
ACCTGCTAATGCCATGATTTTATTCTCTTTTATTGCTGAGTAATATTCCATTGTGTATAT
ATACCACATTTTTTTTATATCCATTCTTCTACTGAAGGGCATCTAGGTTGGTTCCACAGT
TTAGCTATTGTGAATTGTGCTGCTATAAACATTGATGTGTAGTTAAGTCCTTTGGGTATA
GACCAAGGAGAGGGATAGCTGGGTCAAATGGTGGTTCCATTCCCAGTTTTCCAAGAAATC
TTCATACTGCTTTCCATATTGGCTGCACCAATTTGCAGTCCCACCAGCAGTCTATGAGTG
TACCTTTTCCCCCACATCCTCACCAACACTTACTATTGTTTAGCTTCATAATAGTGGCCA
TTTTGACTGGAGTGAGATGAAATGTTAGAGTGGTTTTGATTTGCATTTCTCTAACTGCTA
GTGATGATGAACATTTTTTCATATATTTGTTGATTGATTGTGTATCCTCTTCTGAGGAGT
GTCTGTTCAGGTCCTTGGTCCATTTATTGATTTGGTTATTTGTTTTTTTGGTGCTTAGCT
ATTTGAATTCTTTATATACCCTAGAGATTAGTGCTGTATCTGATGTGTGAGGGGTAAAAA
TTTGCTCCCAAGATGTAGGCTCTCTATTCACTCACAGATTGTTTCTTTTGCTAAGAAACT
TTTTAGTTTGAGTCCATTTCATTTATTGATTGTTGATTTTAATTCTTGGACCACAGGAGT
CTTACTAAGGAGGTTGGGGCCTAATCTCACATGGTGGAAATTAGGGAATACTTTTTCTTC
TATAAGGGATACACATAGGAAAAGAAGAACTCAAATTGGCTTATTTTCTTAAAGTTTGTT
CCTTATTCTATTTTTTTAAAATGATTATATTCAGGTTAATATTTTTGCTAGGGTTATTAT
ATAGATGGTGATGTTTATGTCTCACTGTGTCACATTATGCCTGTATAATATTGGATTGTC
TCATTGTTCATGCCAAATTGATCGATTAATTAAGGTGGTATCCACCCACTCTCTTCCTAA
CGGTACCTTTTTTTTCCTGTAATTAGTATGGAATCTGGTGGTGGTCTTTTGAGAGCTTTT
CCCTGTGGGGAAAACCCAGGGTGCTCTACCACTGAGCTACATNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTGGGCTGCCATTTAAAAAAATT
ATTATGAAAAGTCAAGTTTGAGAGTTGTATACGTGGTACTTGCTCTTTTTCACTTCTTGC
TCATGGAAACCTGCAATTAAAAAAAAATTTTTTTCCCCACATTTTTTTATTGGTGCATTA
CAATTGTACTTAATGATGGGATTTGCTGCTATATATTCACACATGCACACAATATAAAAA
TATAATCTGACCAATATCACTTCCTAGTACTTCTACCCTCCATCCCTACTTCTCAGCCCC
TGGTCCCTTTCCTCTACTGATCTCCCTTTGATTACCATGAGATCTGCCCCCACCTTTCTT
TTTTATTTTCCTCTCTGGCACATATGAGAGCTTAATCTTCTATTTCACTTATTTCACTTC
ACACAAAGGTCTCCAGTTCCATCCATTTTCCTGCAGATGACATGATTTTATTTTTCTTTA
TGGCTGAATAAAACTCCATTGTGTATATATACATTTTCTTTAACCATTCATCCACTGATG
GATACCTAGGCTGGTTCCATAGTTTGGCTACTGTGAATTGTGCTACTATAAACATGGGTC
AAGGTTTTACTTTTTTGTGCAAGAAATATTTATTGTAGAAGTGAGGATGAGTATACAAAC
ATTGCTTTTAATCCTTTAATCCACAGATAACATTTTTCTATATCCTCTGTTTGTGTTCAA
TTTAGATATTTTTGCATAATGTCACCACGTATTATGTACCATTTTATAACTTTTTCCCTG
TCCCCTGGTGGTACTGAGGATTGAACCAGGGCCTTGCAAATGCAGGCAAGCTTTCTACCA
CTGGACTAACTACATCCTCAGGCAATTTTATTTTGAGATAGATTCTTGCTGAGTTGCCCA
AGCTGGCCTCAAACTTGAAATCCTCCTGACTCATGAGTAGCTTGGATTATAAGTGTGCAC
ATCATGTCTAGCTAATCATTTTTTAATTGTTCAAATTCACTGATATTAATTTTATTTTAC
AATGCTGTGCAACCTTTATTTTCTTTCCAAAATTTCCTTATCACCCAAGACAGAAATTCT
GTGCCTGTTAACCAATAAGTTCATGTTCCCCTTCCTCCAACCCCTGGTAACTTTTTTTTT
TTTTTTTTAGTTGTAGATGGACACAATACCTTTATTTTATTTATTTATTTTTTTATACGG
TGATGAGGATTGAACCCTCATGCTAGGCAAGCGCTCTACCACTGAGCCACAACCACAGCC
CTCTTATTGGGTTTTGTAGGTATTTAATAAGAGTACATTCTGCCAAACACTTAAGTATTG
ATGGGGGGGGCGGGGGCGGATACTAGGGGATAAACTCAGAGCCATTTTATGGACTGGAGC
TACATCCTCCACTCCTATAGTATGAGTATGGAGCAGGGTTGCTTAGAGCCTCGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTTTATTTTGAGACAGGATTTTGCTTAAGTACTTTGGGCCTGCTAGTGTTG
AGCTGCCTAGAACTGCAATCCTCCTGCATCAGCTTCACAAACTCTGGGATCACAGATGTG
TGCCCACTGTATCCAGCAACTTAGTGACAGCCTGTCTCAAAAATTATTTTTTTAAAAAAG
GGCTGGTTCTTAAAGGTCACACAATCTCCAGCGATCTAGGGCACAACAGGATTGAACTCA
GGTTCACTTAACCACTAAGCCACATCCCCAGCCCTTTTTCGTATTTTTACAAATTTTTAA
TCATATCTTTGAGGAAAAAAGTGAAGAGGCTCAGGATGGAGATTGTCTCCCACTTCTGAC
CTCAGGTGTAGCACCTAGGAATCTTACCGTGTTGTTGTGCCCTAGATTGCTAGTTTGTGT
GACCTTTAGGAACCAACCCTTTTTTTAAAATTTTTATTTTGAGACAGGGTGTCACTAAGT
TGCTTAGGGCCTCAATAAATTGTTGAAACTGTTCTTGAAATTGGGATCTTTACAACTTAA
TCTCTTCAGCCACCGGGATTATAGGTGTGTACCACCATACCACCATACCTGGCCCACTGT
TGGAGTTGTGAAAAGTAATATATATGCCTTTTTTTAAGAAAAGGCTTTATAAATAAATAG
CAATATGATGCATTTTAAATAGGTGAGCTAGGACCTGGGGGTGTAGTGCCTAGGATACAT
GAGTCCCTGGGTTTGATTCCCAGTACAGCAAAAAGAAAAAAATACATACTTTTAAGTTAT
TTATTTTTTCAGAGAACAAAATGACGGTTGTATATGTACTCAGAACCTACATGATCATCT
ATTACAATAAACTCTCCTGCTGTTCAAAGTTCAGGAATTTTCATTTGAATGTCCAGTTTG
GCAAAACTATAATACAAATGGTTCACCTGTTTTTACATATTAATCAAGAATCAATTGTAC
TGGAAAGCAGCCAGATGTCTCGGGTATTAATATGAGAACACATGACTTCCCTCTGTGGTG
GCTGAATACTAGCAGCTATTGGGTGTAGAATTATCTAATAGCTGGTCAGCTACATCAGAG
GAATACCTGTAGGTACTATGACTGATTATATTAGTCTGATACCAGGTCTGGAAAATACAA
TTTTGTTGTAGTGATGGGGATAACATTTCTGAGTATTAACTTTAATAAATGTAGCTTCTA
TTGGTGACAATGTTGCAACTTGATTACATTACAGTTTGTTATCTATATTTTTAATTGGAA
GAAAACCATTTCAGAATGGAGATTATACTATATTTCACTAACTGCCAAGTCCCCTCTCTC
CCCCCCCCTTTTTTTTAATATTTATTTTTTAGTTTTCGGCGGACACAACATCTTTGTATG
TGTTGCTGAGGATTGAACCCGGGCCGCACGCATGCCAGGCGAGCGCGCTACTGCTTGAGC
CACATCCCCAGCCTCTCCCCTTTTAAAAATATTTTTGTCTAGTTGTAGATGGCCACAATA
CCTTTGTATTTATTTTTATGTAGTGCTGAGTAGCAAACCCAGTGCCTCACACATGCTAGG
CAAGCACTCTACCACTGAGCTGCAACCCCAGCCCCTGCCAAGTCCCCTTTTAAACCTGTG
AATTGATGTAACCCTTTTTTAGTTTTGGAAAAATTTGCTGCTTAAAAATAGTTTACTTTT
TGGAACATGGGGGCTTTTTTTCTCTTTATATTCCGGGGTCAGTAGAAGTTTGTCCCTCTA
AGAATGACAATTGTGTTTGAAAACTTAGCATAAGTAGACATTTTTTCCCTTGTTCTCTGC
AGATTGCTGATCTGGCCAATGAAGATACTCCACAGTTGTATGTGGCCTGTGGTAGAGGAC
CTCGGTCATCTCTAAGAGTCTTAAGGCATGGACTTGAGGTAAGATGGCAATTTCTAGATT
TTCAGCAGTGTTTGAAGGAAAGCATGGGCAAAGCAGTTTATGGGATTACTTTGATGAAGT
CATAAATACATATGATATTTGAATGGGGGGAAAATGTTTTTCCATATTTTCCTAAAGTTT
AGAGTGTCTATATTACCTAGTTCTTAGACTTGGTAGTAGAGACTAGAAAACCTGCATAGA
ATTTTTTTCTTCTTGTTTTTATTAAAAGGTTTTGTTTTGTTTTGTGCTTTTTCTTTTGTC
TTTGTTGGTACTAGGGATTCAACCCAGGGGCACTGAACCATATCCCCAGCCCTTGTTTAT
TTTGAAACAGGGTCTTGCTAAGTTGCTTAGGTGGGCTTTGAACTCCTCATTCTCCTGCCT
CAGCCTCCCGAGTTGCTGGGATCATAGTAGTGCGCCACCACTCCCAGCTTTATTTTTTAG
TAAATCTTTTTCAGTGTACATATTCAAACTATATAAAAGGTTTTAAAGTCCTGCCCCTCC
AAGTCTTCTCAAACTGGAACTCCATGGAGCCCATTACTATTAGCAACTTCTTGTGGTGGC
TTCCAAGTATTTTCTCTGCATCTGCAATTATGGTTACATCTTTTTTGTTTTTGAAGTGAA
CGGGTTTATGTGCTACACAGTATTTCTGACTTGACTTTTTTTCACGTAGAAGTCTGCTTA
TAGCTGTACATACCTAATTTTAATATAGTTTCTCTTTAAAAGAACTTCAGAGACACTGGA
ATCATTCAGCAACAGGTTTTGTTTGTATTTTTCGGAGGGGTGTCAGGGATTGAACCCAGT
GGCACTTAATCATTGAATCACATCCTCAAGCCCATTTTTTTAAAAAATATTTTTTTAGTT
CTAGTTGGACACAGTATCTTTATTTTAATCTTTATGTGGTGCTGAAGATTGAACCTGATG
CCTCACATGTGCTAGGCTAGCGCTCTACTACTGAGCCACAACCTCAATCCCGCAAGCCCA
TTTTATCTTTTATTTTGAGACAGGATTTTGCTTAGTTACTTTGGGCCTTGCTAAGTTGTT
GAGGCTGCCTAGAACTTGCAATCCTCCTGCCTCAGCTTCCCAAACCTCTGGGATCACAGA
TGTGTGCCACTGTATCCAGCAACTTAGTGACAGCCTGTCTCAAAAATTATTTTTTTAAAA
AAGGGCTGGTTCTTAAAGGTCACACAATCTCCAGCGATCTAGGGCACAACAGGATTGAAC
TCAGGTTCACTTAACCACTAAGCCACATCCCCAGCCCTTTTTCGTATTTTTACAAATTTT
TAATCATATCTTTGAGGAAAAAAGTGAAGAGGCTCAGGATGGAGATTGTCTCCCACTTCT
GACCTCAGGTGTAGCACCTAGGAATCTTACCGTGTTGTTGTGCCCTAGATTGCTAGTTTG
TGTGACCTTTAGGAACCAACCCTTTTTTTAAAATTTTTTATTTTTGAGACAGGGTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCAATACAA
CTGAGATAACTTTGGTTTGACTTCTGGCTCTTTCACTTAATGGCTGTAATTAAGCTTTTG
TATCTTCTGTAAAGGGGATTAATAATTGTACTTACTTTAGAGGATTGTTGTGAATTAAAT
GAGATGATGCATGCAAAGCACTTAGTTTAAGACAGTATCCTATAGAAAATGTTAGCTATT
AGCAATGTTATTTCAGGTTTTTGTTTGTTTGTTTGTTTGGTAGTGGGTAGTTGAACCCAG
GGCCTCATACATGCTAGAAGCTAGGAAAGCTCTATCACCAATCTAGCCACCCCCCTAACC
CCACCCCACTTCCAACCCACCTTTTTTTGTTATTTTATTTTGTGACAGAGTCTCATCCAG
TTGCTTAAGTTGGCCTTGAACTTGAGATCCTCCTGTCCCAGCTAGCTGAATAGTTGGGAT
TACAGGCATGCTAAATTTGAAAATCTTTTTTGACTGCCAAAATGTTCATCAGTCCACCAT
TTTCAATGACCTTGACCCAATTTAGAGCCATATCTCTTGATTACCTACTCACTGTTCACT
GAATCCTCGTGAGCCATTGATGAAAACTAGCACTTTCCACAAAAAACAGCACATATGCAT
TAACAGGAAGTTTTGTGTATTGTTTAAGAAATTAAGGACTCAATTAAAATTTGTTTTTTA
ATTTCTTGCCTCCCACACTTTGACTTTATATGCAGATCTTTGTTACATATAAAAATATTT
TTAAATTGTTGAACATTGCTTTGTTCCTATGTCTTTGTTATGTCTTATTCTGTGAATAGA
TTAGGGACTCAATTGAGTAAGGTGACCTATCAGTTTTACATTTGGTATTCATTATAGCAT
GCTTAACATTTTTTTTTATTGGCTATTTTTAGTTATACATGATAGTAGAATCAATTTTGA
CATACTTCTAAAAGCATGGAATATATCTTATTGTAATTTAGTCCCCAATATCTTTCCTTC
CTCTTCCCTTCCTCACTCCCCGCTCCCTTCAATCTATTTCTGCCATTTACCACAGTTATT
TATTTTTTTAAAAATTACTTTCTTGGGGTTGTAGGTGTAGCTCAGTTTTAGAGTGCTTGC
CTCGCATGTGTGAGGAACCTCAACACCACATAAAAATAAATGAATAAACATATTATGTCT
GTCTACAACCACAATAATTAAAAAATTGTAGTCGTACATGATGGTGAGCATTCACTCGTC
ATATTCCTATGTGTACATACATGTGTGTACATACATGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
TGACTATTTTGGTACTAGGGGATTGAATTCAGGGACACTCAGCTACTGGGCCACATCCCC
AGCCCTATTTTGTGTTTTATTTAGAGACAGGGTCTCACTGAGTTGCTTAGTGCCTCATCA
TTGCTGAGGCTGGCTTTGAACCCAGGTCCTCCAGTCTCAGCCTCCTGAGCCGCTGGGATT
ACAGGCATGCGCCTCCACACCCTGCTGAGTATGTGGATCTTGCTAGTTTCTTTTAGGATA
AGTTCTGTAGTTTTATCCTATGGTCATTTAAGATCCTACCATATGTTTAGAGTAATTAAC
ATGGAATTCCTGCCTCAAAGGACTTTCTGTCTACAAATGACAATGAGGGAGCTGGGATAG
CTCAGTGGTAGAGTATTTGTCTAGCATCTGCAATACCCTAGGTTCAATATCCAGCACTAC
AAAAAATAAAACATGAAAGAAAACAAGTAAGCAAAACCATTGTATGCTTTGATTTATGAT
AGGCACACCGGTGTTGCCAGAAAAGGGGTTAGAGGAGAGGGAATGGTCGTGTGTTTGAGA
TTATGAAAAGTTTGTGAAGAGAAAATATTTGCTAAGTTAGTGAAAAGTAGTATATTGTAT
GATGGAACTTGAAATTCCTCTTCTATTAAATATCAAAGCCCTGGGAAAGACTATTTTCTG
CTAAATTTTGCTCTTTAGATACTATAATTTGGACAGTCACCCACAGAAATAGGTCAGGTT
CTCTTTCTTCATTTTCTTTCCAGATATCCCAACTTACTATTGAGCATTCCTCTGTCCACA
CATGCTGCAGTCTTCAGGCAAATACTAACCTTGGCTGGTACTTGGTGATGCATACTACCA
ATACCAAGCCTTTTTTTCTCTTCCACAGGTGGCTGGTGAAGGTGCTGATCACCACAGGTG
TGTACCTACTGCTAGGGTCTACTCTGGGGCCTTATAGTTTAACTAGGGAGAGGGACCTGC
ATAAAATATTGAGGCTGCCCTAATGATGTCTCTCAGTGTAACTTTGCAGTTGGGTGTTGA
TGTGCATTATAATGATGTACACCCATTTGCTTGTGTATCAGCTGGTTTGAGGCAGGAATC
AATTTCTCCACTTTCCCCTACAGATTTTGGAAAACTTAACTAATTTGTCATTTGATAAAC
TGACTAAGACTGTAGCTAGCAAATTGTAGCTTCACACTCTGTCTTGGAGTTGACCATTTC
AGATGTACACTGAAAAATTAGGGATCTGGAGAGTATATTCAAGGTCTGTGCTAAGACAAG
ATAAATACCAAGTACTTTGAGTATAGTGAAATTGAAATCATCTGGATGGCTCCTCTCTTT
ATCCTGAGAGTGAACTGCTTGTCAACCCTTAAATCCTTAAGGCAAGGGAGTAGAATGAAG
CATTTCCTTCTGTAGGATGTTTCAGCAGTATTAAGACAGAAGTCCTACTGAACTGAGACC
TAAAGACATGTTTTCATATCCTAGGACATTCTTCACTGAGATATGAAATAACATTCTTCA
TGAAATTTGAAACCCCTAGAAAAAGGCAACGTGGATATTTATAGTTCCTAAGTCATTTAA
CTTATAATTAAAAGGTTGGCTTTGTACTGAATACCAACTTTTAATCTGTAATCTCCCTAG
GACATAAAAGAGTATCTGCTATGCTGCAGGTCTTTCTAAGCTGGAGATTGGAAAGGGTAG
AAGTAACAGTGTACTTGGTATTCACAGGATAATAGATATTTTTAGGAAATTTGTGATGAA
AAGCATCTTTTAGACTCCATTCATTGCTTTTCTATCTGAACTGTCAAGCCAAAGTATGAC
CCTGTTTAAATTGACTGAGCATCTTCTTATGTCTGAGCAATCTGGTACTTTGGTTAGAGG
TAAAAGTACAAACCCGGGCATGCCTTCTCCTTCTTACCTCCCATTCTTTTGCATATGAGT
CAAAAGTTTATGATCTAGCTTCTGGAATCCTATTTTTTCCCCTTTGTTCAAGCAAAAGAC
TGCAAATTATTGCCTGTTAGAATTGGCTTTAATTTCTTCTGACATAGCTTTTAAGATATT
ATGTTTTAGTAATTACATGACAGAAATTTTCAGTCAAAACTAAGAGCTGTATTAAAATTT
CCAAGCTTAGAGTCATGTGAGATTGGTTGGTTTTGTTGAAACCATTAGACCTCTACTTCA
GGACACCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCATTGAGGCATTTATATGATCTCT
CTATGGTGCTCAGTTATCTTTTGGGATCATTTTGTGCTTTGTGTCTATGCTGACCATACA
CAGAAATGCCTTGGAAGAATTCTTAAAACTTTTATGTGTCATTATTTGACTTTTTAATTC
TGAGGAGTTCTTAGCTGACCAACTCCTTTCTTTCTTTTTCCAGATGAGTTTGATGCCTAC
ATCATTGTGTCTTTCGTGAATGCCACCCTTGTACTGTCTATTGGAGAGACTGTAGAAGAA
GTGACTGACTCTGGGTTCCTGGGTACCACCCCAACCTTGTCCTGCTCCTTGTTAGGAGAT
GATGCCTTGGTACAGGTGAGAATTCTCAGAGCTTACTTGCTTAGCTTGTTTTCTCATTTC
TTTGCCTTTGTTGTGCTATATAGGCAGCTGCATTCAGGTCTCTCTCCACCAAAAGCCTTA
GGGAGGGGCTTGCTATTTTATAAAAATATAGAACTACACCAAGAATTGGATTTTTCAGAT
TTTTACCAACTTAACTATTCACTTAGAGAATTTTGAAACATAATATTCCTCTTTGCCATT
TCTATAGTTGCTTCAGAGCTCCATCTCTATAAAGTTTTCATTTATTTTTTTTCACACGAA
TCCAGGGGTACTCTGCCACTGAACTACATCCCTAATCATCTCCCCACTACTTTTTTTTTT
CTTTATTTTTACTTTTTCTTTTTTTTGAGACGGTCTCACTGATTTGCTGAGACTGCCTTG
AATTTGCGGTCTTCTTATCTCAGGCTCCCAAGTTAGTGAGATTACAGGCATGCCCCACTT
TTCCCAGCTGTTAAAGATTTTAATACTTATTTTGTTGATGAGTTTTGAACTTCTTCAAAG
TGGACATTGCAAAACATAAACTTTAAAAAGTTATCCTTCTCTGGACTTACTAACTCCAGT
TGGTGCCTCAAATGCAGTGGCTCTAGATCTACCAGGGATGACAGATCTGACAGGTCTAGG
GATCATTCTGAGTGATGAGTCAAATCACTAAGGTCAGGTTTCCTTCCTTTCCTGACTCCA
GGTTTATCCAGATGGTATTCGGCACATTCGAGCAGATAAGAGAGTCAATGAATGGAAGAC
CCCTGGAAAGAAAACAATTGTGAAGTGTGCAGTGAACCAGCGACAAGTGGTGATTGCCCT
GACAGGAGGAGAGCTGGTCTATTTTGAGATGGATCCCGTATGTTATTTTACAATTCATGT
GGGACTTAGTATATGGTCCAGAGGTAAAGTGGAGAATTGTCATCCAGGCATCTAGAGTGC
ATTCACAAGAAAGACAATGAGGGAATGTAATTGTCCACAAACCAATCTCACCCTTTCCAA
AGGAGAAAAAAGGAGGAAATTGATGTTTAATTCCATTGAAGTTGGAAGATTACCTCCTAG
GAGTAAAACACTTGATCCCTCTGCATTTTACACCTACTTTTCCAACAAATATTTGGCAGA
GCTTTGTTTTCTACCATCTTAATCCATTAGGGAAATTTTCTTTTCTGTATGGAAATCTGT
TTGGCAATACTAAACTATCTTGCTCTTAAGGAGTTTCTAGTGTGGTTGAGATTTCTTTGT
TGTTTTGTGTTAGAAATTGAGATTTCTTTTTATTTATTTATTTAGTTAGTTAGTGGTGCT
GGGGATTGAACCCAGGGCCTTGTGCGTGGCAAGCACTCTGTCAACTGAGCTATATCCCCA
CCCTGAGATTTTTTTGTTTTTAATCATCATATTTGAATTCCCTTTCTCCCAAAGTATTTT
CATGAACAGCTTAAACATTTTTATATATTTCTGTTTCCTGAGGACTGTGGTGGCACATTA
AATTTGTTGTTAAAGTTCTCGTTTCTTTTCTTACTCAGACACATTAATTTTGCTTGCTGT
TAGCTTGTTAAATATTGTCTTGGGTTCTTAGGTTGAGAAATTGTTGGTCACTGAATATAT
AAGGGGAGTGGGAAGAGCCAGAAAGAAACCTAACACCTGTCTTCCTTCCCTGGATGAGGA
TTTTGGTGTGAATTGGAGCATCTAGACCCATCTCTGTAGTTTCTGAACACACTATGTTTT
CCCTTATGTAGTCAGGACAGCTGAATGAGTACACTGAGCGGAAGGAGATGTCAGCAGATG
TGGTGTGCATGAGTCTGGCTAATGTGCCCCCTGGAGAGCAGCGTTCCCGCTTCCTGGCTG
TGGGACTGGTGGACAATACTGTCAGAATCATCTCCCTGGACCCCTCAGTGAGTGACACCC
TCAATTTCAAGGATCTTCTGGTTGGAATCTGAACACCTGGGTCCTAAAACCTATATTTGC
TGCTATTCTTTTTTTGGGGGGGTGGGGGTGTATGTGGTGCTGGGGATTGAACCCAGGGCC
TCATGCATGCTAGGCAAGCTCTATACCACTGAACTATACCCCTAGCCCTGTACCTGCTGC
TTCTCTTGATTATCATAGCAACACACTTTAGGAGTCTTGTGCTGTGGTTGAGAATGTTGA
TCTGAAACTACTGTTTCTTTTAGCTAATCCTTGAATCTCTTTTGTACTAAAAACCCCAAA
ACCCCAAGACTATATATGGGAAGGAATTTTACTTACTTCCAGGTCTTAGATAAGTTTCAG
AGAGATACCCATTACTTATTTGCTCTTACATTATCTGTTTTGATAAAAGAAGAAAAACAA
TATTTTTCAGAGCTTATTCTGAGGTTTAGTTAAAATTAACAATGCACTATCCTCTCATTC
CTGGAGTTTCCTCTGCCCACAAGATGGTTCTTCCTTCAATGCTAGCATTAGATTTTTCTG
AATGTTTTTTTCCAAATTGGTCATTTCCTGTTTTTAATGATTTTTCTGTCCTCCCTACCC
CCAACCCCAGGACTGTTTGCAACCTCTGAGCATGCAAGCTCTCCCAGCTCAGCCTGAGTC
CTTGTGTATTGTGGAAATGGGTGGGACCGAGAAGCAGGACGAACTGGGTGAGAGGGGCTC
TATTGGCTTCCTCTACCTAAACATTGGACTGCAGGTAAGAGATCCAGAGGTTGACGTTGT
TGTCAGGACTTATGTAGGTTTTACACACTCCTTTGTCCAATAAAGGCATTTTTTATGCCC
AGAATTTCAGATGCCAGCTTATGAGAAGTGAACAGTGTTGATCTGGGCTCTACTTTTCTT
AGCACTTTGATTAGAACATATCGGCCCTGGAAAAAAGTATTTTTGCATTTGATAAAAACA
CCTTACTTTCCCTGTTCTGGGTCAGAACTGACTAATGTGCTCTCTGGAGAGCAGCGGTCT
CGCTTCCTGGCTGTGGGACTGGTGGACAATACTGTCAGAATCATCTCCCTGGACCCCTCA
GTGAGTGACACCCTCAATTTCAAGAATCTTCTGGTTGGAATCTGAATACCTGGGCCCTAA
AATCTACATTTGCTGCTTCTCTCTTTTTTTTTTTTTTTTTGTGTGTGTGTGTGGTGCTAG
GGATTGAACCCAGGCCTCATGCATGCTAGGCAAGCTCTGTACCACTGAACTATACCCCCA
GCCCTGTACTTACTGCTTCTCTTGATTATCATAGCAGCATACTTCAGGGGGGGATCTTTG
AGTCACATACAGTCCCCACAATATTCAGCTTTTTGAAATCAATACCTTAGAGTTCCTAAT
TGACTTCTCTCTCGATAAAGGATCCCTACATGTTCCTTGTTGTCAAAGGATCTAAGCTCT
TCATGTCATATTAAAAGTAGGAACCTAAGGATACGAGAGTGTTGGGGCTCTTGATTGTGT
ACTTTTTATTTTCCTTAACTATTATTTACATGAACACATTAATTTAACCTAGATATTTTT
GCCTTTTTTTTTTTTTTTTTAATACCAGAGATTGAACTCGGGCACTGAGCCACATCCTCA
ACCCTATTTTGTATTTTATTTAGAGACAGGATTTCTCTGAGTTGCTTAGCACCTTGCTTT
TACTAAGGCTGGCCTCAAGCTTGCAGTCCTCCTGCCTTGGCCTCCCGAGCCGCTTGTATT
ACAGGTTTACTACACTACTGCACAGAGCATATTTTTGCTTTTTTTTTTTTTTTTTAAATA
TTTATTTTTTAGTGGTAGTTGGACATAATACCTTTATTTTATTTATTTATATATGGTGCT
AAGGTTTGAACCCCTAGGTCCTTGCATGTGTTAGGTGAGTACTCTATGCTGAGCCCCAGC
CCGTATTTTTGCTTTTTCAATTTACTTAAAAAAAAAAAAAATTTAAGCTATTGTTGGACA
CAGTACCTTTATTTTATTTGTGGTGCTGAGGATCAAACCCAGTATCTCACACATGCTAGG
CGAGCACTGTATTGATGAGCCACAATCCCAGCCCCTTAAATTTACTTTTTTTTTTTTTTT
TTTTAGAAGTTTTCAAGCATAAACAGAACTTAGACTAGTGTAATATGCCTCCTTTCCCTC
TTTTTCCTGGAGTATTTTAAAGCAAATCCAAGATGAGTCATTTTTCATTTTCAAATACTT
GATGAAAGTACCTTTAACAGATGTTTTCTTAAAGCACTAATATTCTCACACCCAGCAAAA
ATCTTGTATTCCTTACCGTCATGTGATACTTTGTCTGTGTTATAGTTTTTGCCATAAAAG
AGTGGCCATATAATTGGATCTACTCAAGATTTCAATAGAACAGTTCATAATTTGCATTTC
CTTTCTGTCTTTTTTTTTTTTTTTCAGTACCTGGGATTACATCAAGGGGCACTTTGCCAC
TGAACCACAACCCTAGCACCCCGACCTTTTAAATTTTTTTGTTTTGAGAGGGTCACACTA
AGTTGTTAGGGCTGTGCTAAATTGCTGAGGCTAGCTTTGAACTCATGATCCTCCTACCTC
AGCCTCCCAAGTTTCTGGGATTACAGACAGGCCACCACACCCAGCTGTTTCCTGTCTCCT
TTAATTGTGCTCACAATAACTGTCCCACTCCCATTCTTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTTTGTTTTTAAGAGACCAGATAATTTTCTGTAGAATTTACTT
TTTTTTTTTTTTAACTTTATTTATTTTATGTGTGCTAAGAATCAAACCCAGCGCAAGCCA
CAACCCCAATCCCTGATCTAAGTCTTTTGAAATCTGGTATTTGATACTTTTTTTTTTTTA
ATTGGGGATTTAATTTAGAGGTAATGGCAATTAACCAGTAAGCCACATATCCAGTCCTTT
TTAGTTTGTTTTTTGTTTGTTTTTATTTTTGTTTTTGTGGTGCTAGGGATTGAACCCATG
GCCTTGTGCATGGGAGGCAAGCACTCTGGTATTTGATACTTAAAACTTAACAGCGTATAT
CAGTTCTGAGTGGCCACACTTTTGATGTTTAATGGCTGTAGGACTGGCTAGTACAGATCA
CAATATTTGTTTAATTCAGATTTAATTTGAGGTGATAAGAATAGTTCAGCGATGGTGCTA
TTTATTTCCTATTGCATCACATTAGATACAGGAATGTCTAGTTGTCCCAATTCTATTGAT
GTTGAAATGTTTGTATTATGTTTTAAAGCTTCCCTTTAGCTTTTAAACTTAATAGTTATT
GATACATATTGCCTAGATTGATTATTTCATTGGGGGTTTGGAAAATGATTTTCTAATTTC
TTTCTTTATTTAATTGGATGGAATTCTTCTCTAAAGACAAAATGAGATTCATTTGCTTAT
CCTAAATGTAGTGTATGCAGGAAAAGATCAGTACTTAATTTTTTCTCTTTGTTCATTTGT
ATCCAGAGTTAAGGAGTTAGGGCCATAACAGTCTGTCTCCAGAGGGGACTGATGAAGTGG
GTATTCTGGTTTTTCCTTTTTAAAGTAACATGATTTTGTGGGGTTTTGTATATTTGTTCT
TCAAACTATGCTATCGTTTTGTTGTTAAATTGTCTAATTTTAGACAACTGGAAGTTCCCC
TTTGAAGTTTTTTCCTTTGTTCTTTTAACATGACCCCACTGTTTTGCCTTCTTGCACAAT
AAGATGTCCCACATGCATCTGGAACATTCTTGCCCCAGTCTTGAATCATTTCTTTTAGGA
ACCTTGTTCATTTTAGAGAAAATGGTGTATAAAAACCATACTCCGTGGGCCTGGGATTTT
TAAACTCTGGATCTATTTTAAAATTATAAAAGAGATTTTAACATTCATGATTTTAAAAAA
AGAGTACAGGGTATATAGTGAAGAATAAGTATATTTTCATTTAGTAGATGTTTAACTATT
TGAATTAGTGATTTATTGAAAGAATGAATGAATGATGCTTAGGTTTTTTTTTTTTTTTTT
TTTTTAAACCACTAAGCCATTTTCCTTTTGTCTGCTCTGAAAGTAGCTAAGAGGGAGATT
TCCTCGTCATATCTGATAAGCTTACATTGTAAGTAGGCTCACCCACTCCTCTTCTTTTGA
TTAGAATGGTGTGCTGCTGAGAACTGTCCTAGACCCTGTCACTGGGGACCTGTCTGATAC
TCGCACTAGGTACCTGGGTTCCCGTCCTGTGAAACTCTTCCGAGTCCGGATGCAAGGCCA
GGAGGCAGTAAGTAATAAAGTGGGGCAGGCAGCGTATACAGATGTTATTAGTGACACCAG
CTGAAAAAAATCCCTCTTTCACTAATTCACCAGTATATAATTGATATGATATCAGTTCTA
TCTTGATTAGATGTAAAAATTGATGTAAAAATTCTTGGGTCCCTTAACCTAGAACTTCCT
AACAGGGATTCCATGGCACTGTGGCATAATCTGGTTTTAGGGAAATTGGAATATTGATCC
CTTTTGCCCTTGGGCTGGGGATAGTTGGAAACCTCCCACCCAGGTCACCATTAGCCATGA
ATTGTCTAATTTACCCCAGGCTCATAGTATCATGATTTACTACCTAATGTTAAAGAGATT
GGAAAATGTATCCTTTGTAGTTAAGAGTAGTAGTTTGCTGAAGCTCTGCCAGTTCTTAAA
TGTTATTTTATTCTTACAGCTGGGGCTGGGGATGTAGCTCAGTGGAAGAGTGCTTGCCTT
GCATGGGTGAGGCTCTGGGTTCAATCCCAACACTGTTAAGAATTAAACTATAATAGTATT
CCTATTCCTATGAAAACAGGCTCAGTGAGATGTAGTAATAATTAGCTTAGGTCATGCAGC
TGGTAGCCCATGGATTTATCATATTTATCATTACTACTTCCTTTTTAAAAAATTTCCTTT
TAGGTCTCAATATTCTGTGGGCTGAAATTTAGGTTAAGATATTTGGTCAGCTTACCATGT
GTGAATTTTTCCCAAGCTCAAAGTGAAAGTGTTTTTCTCTCCTCAGGTATTGGCCATGTC
AAGTCGGTCTTGGTTAAGCTATTCTTACCAGTCTCGCTTTCATCTCACTCCCCTGTCTTA
TGAGACCCTGGAATTTGCATCTGGTTTTGCCTCTGAACAGTGTCCTGAGGGCATTGTGGC
CATCTCCACCAATACCCTGAGGTGAGTGCGTTCCAGGTTTGGAGGCCAGCAGAAAGCATT
TTTGTTGTTGTTGTTGTTGTTGTTTTAAATTGCAGAGTGGACCCAATACTTTTATTTATT
TATTTATTTTTATGTGGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAGGTTTATTTTGGCTCACAG
TTTTATAAGTTCTAGTCTGTAATTGGTTGGCCCCATTGATTTGGGCTTGTGGTGAGGTAG
CATATTGTTGTGGAATCATGTGGCAGAGCAAAACTGCTTACATTGTAAGCCTGGAAGGAA
AAAAGAGCAAGGAAGAGTCCAGGTCTCATAATCCCCTTCTGGTTCACAACCTAGTGACCT
AAAGATCTACCAGGTTCTACCTCCTAAAGATTCTACCACTTCCCAAAAGCACCACCCTAG
AACCAGGGGGACATTCAACATCCAAACCAAAGCAAATTGTGAGTTCTTTATATATATTTT
AGATATAAGACTCCTATCAAATACATGATTTGAGTGTTTTTTCCTATTCTCTGGAGTTTT
CTTTCATTTTCTTGATGGTGTCCTTTGTAACACTGAAGGCTAATTATTTTTAAAATAATT
GTTTAAAAGTGTATCTGAAAACTACCCAAAGTATTGGTTATCACCAATAGCTCATGCCTC
CTCTTAGACAAATGCTAGGTAACTTTGTATTTTCCAAGAAGCAATATAGCATGAGAACAT
CTGTGGTCTTAGTTTTGTATGTGTCTTTTTGAGGACAGGTTTCCTTTCTGCTTAGAGTCT
GTGCTCTATAGTTGTGAGTTAGATCACAGGAAAATGAGAACAATGGGATCAAAAATTGTG
ATTTTTTGTTTTGTTTTCTTTATGGCATACTTAATTTTTTTCTTGATAGAATGATAATTT
TTGATATTTATATGGTTCATTTTATAATTAGATATTTGTGAAATACTTGAATTTGTTTCT
CCACAAATAAAGGAACTACTCAGAGAACTTGGGTGTACACAGAGTAGAAATACTATCAAT
ATTAATGTGAATAAGCAAATGTTTTTATTTTGTTTTATGCTCTGTGCTTCTGGGTTGGCT
GTCTTAGCACTTTGGGAGAGTTTTCTGCTATCTTTCATTGTTGAATTTTAGGACTATGGT
CAGACCGAATGTGGTCTGTTGTTATTGTTTTTTGATGTTTTCTGTAGTTCTTAGGGACTT
TATCTAGATTGGCTTATATTTTTTCTCTCTGTTGGTTTTTTGTTTGTTTTGTTTTACCTG
AAAAGTTTTAATTTTCTCATTTCTGTTCTTTTGGAATTCAGATTAGATGTTTGAAATCTT
CTCATTCTGTCCTTCTTTGTCTTTCAGGCCCCATCCCCTTTCATATTCTATCTCTGATTC
TGCTGCATTCTGGATAATTCTTCAATTATATGACCAGATCCTGCTTGATACTGGCTCTTC
CTCAGAGTTTTGGAGGATTTATTTGGGGGTGGGTGTCTGTGTATGTATGTGTGTATTTCT
GTTTACATGTAAAACATAATCTCTTGTTTTTATTAGGCTGGCCTTGAACTTTGTCTGTCT
CAGCCTCCTGAACCTCTGGGTTTACAGGCATGCGTGTGTCACCACATCTAGCCAAAAATA
AAAAGTCTTTTGGCTTTTGATTTTTAGTTACCGTTTGATTTCTGGTGTACTGGTGACTGA
TCGAGATGTGAATTCCCTAGAGGCAAGTCTTATAATATGTTCACCGCATCATCTAGTGGG
ACTTTAGCTTATAGTTATGGCACGCAGGATAGTCCCGGTGTATATGTGAGGGAGAGGGTA
TATAATCAAATGGGTAATTGAGTTTAGAAAGAATGCCAGTTATAGAGTACCCATTCTCAT
TTCTATGAAAACCTTTTACAAAGGGATATAACCTTTAAACACTGCTTACCTTCTGAGATT
AGCAGTTCTATACATCGTTGATAACCCTAGTATATAGATAGCAGTACCATTATTTTTAGC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAGGCAGTGTTCTATCACTGAGCTCCATCGCCAGC
CCCTCCAATTTTATATTGAGACTGAATCTTAACTTAGTTACCCAGGCTGGCCTTTAACAT
GTGATCCTTCTGCCTCAGCCTCAGCTGGAATTACTGGCATGTGCCACTGTCCCCAGCTTC
ATCATTTGAAAAATGGATGTCTTCTTTCCAGGCATGTGGTTAGTTAGTCCTCTCTCAGAC
AACTGAATTACTGGTTCTTGTGTGTTGTCTTCATACCGGAGTTTTAAGCATATCCTAATG
AATATGTGTATGTGTTCTTTTTTTCTCTTGCTTTCGTCGAGAGCTTACTACATCCACTAT
TCACACCATGTTTTTCTCATTTTATAGTACATCTTGGAAATCAATGTAAATATTATATGA
CTTCCATATTGTTTTATTGCTAGAGTGTTATATCATTCTTAGAAGTAGAGTTACTGGATC
AAAGGTTTTGTTCACTTGACATTTATTTTTTTTTTTTAATTTTTTTTTAAAGAGAGAGAG
AATTTTAACATTTATTTTTCAGTTTTTGGCGGACACAACCTATTTGTATGTGGTGCTGAG
GATCGAACCCGGGCCGCACGCATGCCAGGCGAGCGCGCTACCGCTTGAGCCATATCCCCA
GGCCTCACTTGACATTTTAGAAAACTACTCCCTGTGCCATATCGTCTAAGATCTTCTGAG
ATCCTTGTCTTTCTAATTCTTAAACCTTTCTCAGGTTTGAGGGCTCAGGCAATTTGTAGT
TTAACTCTGTACCTCTTTTCATCTACTAGAAATTTTATTTGGCATTTCATATCTACTATA
ATCTTCTATTTTATCCTTTGTAGGTTTTTATGTTTTAATGCAGAAAATATTTAAACTGTG
ACTAAAAGTACATCATTAGAAATCTAGTTACTATTTTTTAAGAGTGCCTACTTTCTCCTT
GTTTTTACACATAGTTTGGCTTGGATTTGCGTTTCTATGTCCTGTTGGACAGAAGTTTGT
ATTCCCTTACTTGCTATCTCTTGGATTGTCCATGAGTTTTTTAAAGCTATGACTGATTTT
CATTCAGAATAGTACCATCTATTTTTAAAAACATGATCCAGAGGGCTGGGGTTATAGCTC
AGTGATAGAGCGCTTGCCTAGCACATGTGAAGCACTGGGTTCGAACCTCAGCACCACACA
AAAATAAATAAATAGGAGCTGGGGTTGTGGCTCAACGGTAGAGCACTCGTATAGCATGTG
TGAGGCCCTGGGTTCAATCCTCAGCACCACATAAAAATAAATATAATAAAGGTATTGCGT
CCAAATACAATTAAAAAATAAATATTTTAAATAAATAAAATAAAGGTATGTGTCCATCTA
CAATTAAAAATTTTCAAAAAAAAAAAAACATGATCAGCCTAATACCATGTCAGGTAATTA
CAGTGCTTTACAATAAATTTAGAATTTTAGTGCTCCTTATTTCTGGATTTGTCAGTAAAA
GAGAGATTCTGCCTTTCACTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCT
TCTCACCTCTGAACACACTGACTCTTTTCTTTTTGGCATTTAGGAGAGATGGTGGAAGCA
GCAGGAGAGGATGAACGGGAGCTAGCTGCAGAAATGGCAGCAGCATTCCTCAATGAAAAC
CTCCCTGAATCCATTTTTGGAGCTCCCAAGGCTGGCAATGGGCAATGGGCTTCTGTGATC
CGGGTGATGAATCCTATTCAGGGAAACACCCTGGATCTTGTCCAGCTGGAACAGAATGAG
GCAGCTTTTAGGTAAGGAGCTTAGGAAAGTTCAGGATTTGTTAGGCAGGTACCAGAATTC
TTTGGGTTTTGACTAATACCTGACTCTTGCTTCTTTCTCTTTTTATAGTGTGGCTGTGTG
TAGGTTCTCCAACACTGGTGAAGATTGGTATGTGCTGGTGGGTGTGGCTAAGGATCTGAT
ACTCAACCCTCGATCTGTGGCAGGAGGCTTTGTCTATACTTACAAGCTTGTGAACAATGG
GGAAAAACTGGAGTTTTTGCACAAGGTACGAATCAGCCAGTGATATCCTGACTCTTAGGT
TCTCCATTTTTGCTGAACTTATGAGTCATATCTTTTGGGGATCAGCTCATTGATTCTAAT
CCATCTCTTGGCAGCACAGAGATAATGCTGAGGTCATGCTTTAGTGATGCACCAGTGCCT
AGCTCCAAGAAGAAGCCTAGGTGATAACCCCCCCCAGTGGGAAGATAGATGCACACTGAA
TCACCTCCTTGTTTACTGTCTCACTCAGCAAACAGCAGTTCGTGACCAAAATTTTGCAGT
TTTAAACAATTAAAATTCTGGGAAGTTACCATTTAATAGAAACAGAGTTTCTGTTTGGGA
GGATAAAAAAACTGGAGATGATGTGGTGATAGTTGCATACACAGTATAAATATAGTTAAT
GCCTCTGAACTGTATAGACATGTCTAAAATATAAGTGATAAATTACTCCCTCAGTCCTAC
CATGAGGAGTGTCTTCTTGGAGTTAATCACTTCACAGACCATTCTTTGTTAAACTTACTG
TCTCTCTTATAACTGTCACTTTTCACTAGCATTCCTTTTCTATCCCTCCATAACCCTCAG
TCACTTCTCAGATGTTGAAACTTAACTGTTAAATTTCATGGTGACAGTTAAACCTAGCAT
AGGCTAAGGACAGCACTCATTAGGCACCAGACTTCACATTTGTGGCATTGAGCCACTTGC
TAGGTGAAATGCATTGTATAGGATCTGTTTACCCAAAGATGCTGTTTCATGGAGACTCCT
GCATACATGGTTTATTTCTCTTATGAGCAAAGATACATAGAGTCACTTGCTGTCTATCTT
CCTGACAGGTGCCCATAGAAGCAGGCAGTTCTGGGTTGAAGGGGTGAAACTAGCTTGTGG
CTGTGTGTTCTGACAGGTGTATGATCTGTTTTTTTCTCAAAAGACTCCAGTGGAAGAAGT
CCCTGCTGCCATTGCTCCTTTTCAAGGGAGGGTGTTGATTGGTGTGGGGAAGCTTTTGCG
AGTCTATGACCTGGGGAAAAAGAAGTTACTCCGAAAATGTGAGAATAAGGTAAATATTCT
GGTGTGGAGGCTAGGACCTAGCTATGAGGCAAGAGGGAGCATTGTTGTGGTAATGGACAC
AGATTCTTGAAGTCATGTGACTTTATTAGAACCATATTATATTCCCCCTATTCCACCCTC
AGAATTAGACTTCTTAAGTCTTGAGAGGGGCAGAAGTAGATGATCTCATTCAAACCAAGA
ACCAGCTTTTTATTCTTATTTCTTATAAGGAATTTAGACATGTATTTTCACTATTATTGG
GCTGGGGTTGTGGCTCAGTGGTAGAGCGCCTGCCTAGCATATGTGTAAGGCACTAAGTTT
GATCTTCAGTACCACATAAAAAATAAATAAAACAAAGGTATTGTGTCCATCTACAACCAA
AAAAAAAAAAAAAAGACTCGTTCTTTTCCCTACCTTCTAGGCATTTATCGCTGACTGCTA
TTCTTTTGATGTGTGCTTTTCCGCATACCCTATGTATGTGTATGTTCTAGTCAGAGAAAG
CTGGATTTTTCTGTAGGTTCTTTTTTTTTTTTTTTTTTTTTAATTATTTTTGGGGCTGGA
GTTGTGGCTCAGCAATAGAGTGCTTGCCTCATACGTGTGAGGCACTGCGTTCGATTCCCA
GCACCGCATATAAACAAGCAAATAAAATAAAGGTCCATCAACAACTAAAAAAATATTTTA
AAAAATATTTATTTTTTAATTATAGGTGGACACAATATATTTATTTTTATGTGTGCTGAG
GATTGAACCCAGTGCCTCTCACATAGCTAGGCAAGCATTTTATCTCTGAGCCACAACCCC
AGCCTCAATTTTCTGTAGGTTCGAATCCCAGAATTCATTTCTGATCTTGTTTTTTTTTCC
CCCCAGCATATTGCCAATTATATATCTGGAATCCAGACTATTGGACATAGAGTAATTGTG
TCAGATGTCCAAGAAAGTTTCATCTGGGTTCGCTACAAGCGTAATGAGAACCAGCTCATC
ATTTTTGCTGATGACACCTACCCCCGGTGGGTCACTACAGCTAGCCTCCTAGACTATGAC
ACTGTGGCTGGAGCAGACAAGTTTGGTAACATTTGTGTGGTGAGTTGTTATTTACTTTGG
TTACTGTGATGTGTAGGAAAGAGTTTGGTTTGTGGTGTTGGTAAAGCCAAAGAGCCAGGA
TTATGATCTCTAATACGGGAAGTAAACATGGGTATAAGATTCAGTCCTGCTAAGGCAAAT
TCTAAAAAACAAAAATCTTTCTGATCTTCTTACCAGTCTTTTGACATCCACTCCAAACCC
CATGGTCACCTCCTTCCTTTCCATAGAATGTAATTTAATATCGATAGGTTTTGTTTGAAC
TAATGGATAATATTTGTTTTTACCTTTTGGTAGAATCTTAGCTTGCCCAGGCCTGACTTC
TTTTGTCTGTAATCTGTGGTCTAGTTTTGTTCTTTTTGTGCTGAACCTTGCTTAAAGCTT
GGTTCTCTTGGATTTCTTACACCTCAGACACAGCTCCCCAGAGCAGGTATAGGATATTTG
GGCTCCGGCATCTGTCTAGATAGTTTTCCTAGGTAGTTTCTTGCTTAAAAGGACCCAGGC
AAGCATATTGCTTTTTGATCCAGGGGAGCAGGTTCAGGTCCCATCCCTATGATTTGTGTC
ACTTCCTTATAGGTGAGGCTCCCACCTAACACCAATGATGAAGTGGATGAGGATCCCACA
GGAAACAAAGCCCTGTGGGACCGGGGCTTGCTCAATGGGGCCTCACAAAAGGTAAGATTG
TACAAAGGGCCCAAGTGAAAGATAAGATCACTACCTTCCCTCTTGCCCACACTGAAGAAA
GAGTCTTGATTGGATTATCCACAATGCACCTGACTGCTGAATGTTCTCTTGCATGTTCTT
TATGAGTTTAAAATAGGAATTTTTCTGAGACATTCTGTCAATCAGTAAAAATCTATTTGG
AGAACAGTGAGGTTCTTGAAAAATGTGGACATAAGGTTCATTCCCAGTATTAGCCACCTC
TTCTCTGGGTCTTGAACTTTGCTCATCTTCTATAGGCATATACTTTGATAGAGAATCTCT
GGACTTTTTAAAGACAGATCTGTTTTAGAGAACAACCTAATGATAGCTGTTGTTTATAAT
TTTTATGTGGTTTTCTTTTTTTTTTTTTTTTAGTTGTAGTTGGACACAATACTTTTATTT
CACTTATTTATATTTTTTTGTGGTGTTGAGAATCGAACCCAGGGTCTTACACATGCAAAG
TGAGTGCTCTACTGCTAAGCCACAACCCTAGCCCCTTCTTTTTTTTTAATTGTAAACTTG
ATAATTTAACCAAAAGGTTTGTACACGATGATTGTTTACGAGAAATTATCTAACCTCAGT
ATGTTTTGAGGCACCAAGGTTTAAAATAATGAAGGAATGTAAAAAAGTGTTTTTAGATTT
CAGTAATTTTTGGATTAAATTAATTAATTAACTAGTTTTGGTACTGGCGACTAAACCAGG
GGTGCTTAGCCACTGAACTATATTTTTAAACTTTCTTCTTTTTTTTAAATTTTGAGACAG
GGTCTCACTAAGTTACTTGGGGCCTCACTAAGTTGCTCAGGTTGGTCTTGAACTTTGATC
CTCCTGCTTTAGCCTCCAGGTCGCTGATATTACAGGCAGGTGCCATTGCATTTGGCAATT
TTTCAATTTTAAAAGATAATGAAATGTGCTAGGTAGAGTGGCGTAATTGGAATCTCAGCT
AACTCTGGGAGAATAAGGCAGGAAGATTTCAAGTTTAAGGCCAACTAAGGATTGCAGGTT
TAAACAACTTAGCAAGAGTCTGTTTCAGAATTTTAAAATGGAAAGGGCTGGGGATTTTAG
TAGTAGGGCATCCCTGGGTGTAATCTCTAGTTCTGACCCAGAAAAAGGTGGTTAAATGTT
CCTGGAGGCACTGCTTGCCCACAGGAAGCCAGAACAGGCTCCAGAGAGCACATATAATTA
CTAGTTTGTTTTTGACTTACAGGCAGAGGTGATCATGAACTACCATGTTGGGGAGACAGT
GCTGTCATTACAGAAGACTACGTTGATCCCTGGAGGTTCAGAATCACTTGTCTATACCAC
CTTGTCAGGTGGAATTGGCATCCTTGTCCCATTCACATCCCATGAGGTGAGATTCCCCCA
CATGGTTTTGGCCTCGGACTTGGCCTTTCTAGTGTTGAATCTTCCTAAGAGGGAAAGTCC
ATTTATGTATCCTTATTTGTAATTAGGAGTGACTAGAAATTGTATAAGGTTACAGTTACA
AGTGCCTGGGAGAATAGGAATCCTGAATTTTTACCCCCTGAGCAAAATTATTTAATTTAT
ATAATACTAATTCTGATTTGGGTATAGGTTATTCTCAGGCTAAAGCCCCAGAAATGGACT
TCTACAGACTAGAAATGATGGAATGTTGTCCTTTGGGGGACTCATTGTCTTATGGAATTG
GCTAAGTTTGGTTTATGTCATTCTAGCCAGGAATCTGACTTCACAGGCCACTGTTAGCAA
ATGACAGTGTCTCTTGTATTACAAATACAATGAGGTCTGTTTTGGACTTTAGCTCTCTTG
TTATAACAGAAAAACCTGTGACCATCAGAAGAGTGGTGAGATGTTTACTGTCTGTTCAGA
TGGTAAAAATCAGTGGCTCATTTGTTCATTGTGCTTGTGGAAACTATTAGACTAGCAGTT
GAAATCATTTTTTTTTCTCAGTGACAGATTCTTTGTTTCTTCCACCAGGACCATGACTTC
TTCCAACACGTAGAAATGCACCTGAGGTCTGAGCATCCCCCGCTTTGTGGGCGGGACCAC
CTTAGCTTTCGTTCCTATTATTTCCCTGTTAAGGTAGGTTTCTCAACCTATTCACCTGGT
CTTTTCTCTGGGCTTCTGCTTCTTAAAAGAGTAGTCCTGAGTGGAGCAGTGAGTGAGTGG
ATTGATAGAGGAGGCAATGATGGAGATTCATGGTTAGTGATAAATTCTGAGCCCTCTTCT
CACAGGGCAGGCCATAGCCAGAGAAGAAGCTGTACTGGGTTTTGTCAGTCTGAACTCCAG
CTACTCAGGTATCTGGGGGAGAAGAAAAAGCTCTCTCTGCAGCTGCTGCTTTAGCATATG
CCTTTTTCTTTGAGTATCAAACCTTTTTCTTTCTCTTAATCTTGCATGTCTCAGAATGTG
ATTGATGGAGACCTCTGTGAGCAGTTCAACTCCATGGAGCCCAATAAGCAAAAGAATGTC
TCTGAAGAACTGGACCGAACCCCACCTGAGGTGTCCAAGAAGCTTGAGGATATCCGGACC
CGTTATGCCTTCTGAGCCCTTGCTGTACCTGTGGGCTTGCCAGAGACACTGTTTTTGACC
CTTACTACCATCATTACCACCTGTCTTCTGCTATATGGCAGGAGAAAGGTGACTGGATAT
TTAAGGCTGTAATATTAAAGCCAATAGCTCTCTCCCCTCAACTCTTCCCTTGGAATGACT
GGTTCCCCCTAAAATTGGCACAGATTCACTCACTTCTCCCTGCCCAGCACATGATACATT
GTCCCAACCCGATGCTCTATTCCTGAAACCATCTCTGCATTGATATTTGGCTCTCTTCTA
CTTTTGTACACACCCTTAATTTTTAACTTGTTTTCCTGTAAATACAGTTTTGTACAATGT
TATTTGTGGGAGGGAGGAAGATAAGTTAAGATGGGGCCAGGTTGGATACAATATGACTCC
TAAATTCTGTCACTTGGAACCTGCCCAGAAATGCAAACCTAGTTTTTAAGGTGGCTGGCA
TCTGTGTTTCTTTTTCTATGAATGAGAATTTAGGTGGGAGGTTTGAGTGTGAATTGGAGC
AAAAACTGAGTCCACTCCTTCCTTTCAGGTTTCTATCTGGATTTCTGATAACCTGTGGCC
TCCTGTCACAGGCTCCCCTGTGATTTCTTTTAGTTTTCTGATTCTTTGCTATGCAGGTGG
ATGTCTACCCACTGTTCCCATTGATACTGAGGAGTGGTGGTGATGTCTTTTCCCAGTCTA
ACTCTCTGTACTCTTGAGTCTAGATGATGATTAGCATGCTCCGATCTGGGCAGTCTCATT
AAACAAGGCTTCCTTCACTTCTTGAGAAAGTCCTTGACTACTATGAAGGGTCAACGAAAA
TAGATGATCCCAATACTAGCCTTCCCTTGGGACCTGTGCATTGCACCCTAAAGCACATGG
GGTGGGATGGGATGGGGTGGGCTGTCTACAGTGCACATCTTTGGTAGATTTCAGAGGGCC
TTGGGAATAAAAGGAAGGATCACTGAGAGCCCATCAGCCAGAAGTGGCCCCGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 3019..3345, 3969..4141, 4677..4818, 10038..10150, 10251..10388, 10489..10592, 10693..10858, 16382..16477, 22280..22352, 27163..27314, 28021..28176, 29051..29206, 29830..29973, 33424..33546, 34306..34460, 39733..39907, 40303..40306, 40309..40510, 40608..40764, 41683..41808, 42666..42878, 43452..43550, 44782..44925, 45528..45632, 45954..46094
1001..1070, 3019..3345, 3969..4141, 4677..4818, 10038..10150, 10251..10388, 10489..10592, 10693..10858, 16382..16477, 22280..22352, 27163..27314, 28021..28176, 29051..29206, 29830..29973, 33424..33546, 34306..34460, 39733..39907, 40303..40306, 40309..40510, 40608..40764, 41683..41808, 42666..42878, 43452..43550, 44782..44925, 45528..45632, 45954..46091
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved