Spermophilus_tridecemlineatus Locus RPS12
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus RPS12
Spermophilus_tridecemlineatus
RPS12
GeneScaffold_1528
SNORD101, SNORD100, SNORA33
1381..1455, 2328..2403, 2719..2849
4053
TTCAAAATGAAACATAATTCTTAGGGGGAAAAAAAAAAATCACAAGTTTGGAGTTTTTC
GAATTGCACACCGAATTCGCCGACTCCTGTTTTCCAAACGCTACGCTTTTCATTCCTATA
GCACCCGAAGCCGAGCCCGTGACAAAGTTGGCATGAAGACACGGCGGGAGAGCCCTGCCT
TGCATGCACTAGGAAACCGGCACAAGACTCCATTGAAACCCACCACACTGAAACCGGAAC
TGACCGCCGCGTCACGTGTTCCGCTCAACTAACACACAGCCTGCCAAGTGGGTTTGCTAA
GTGCTAGAAGTAGCCAAAACGTGTTGGCTCCCGTTTTAAGGAAACAAAGATGAAGAGAGC
CCACAGAATGACTTAGAAACCAAGGGGCAAAACGTGAAACCGGCAGGAAATTACAACGTG
GCGTGGAAAGGATTAAAACTGATGTTCTTAGGGACCCAGGGCGCATTGGCACCCAGGATC
CGATTAAACCACGCGACAGAAAGATTTGGTTCCTCAGGCACTCCGTAGGATGAGCTCTCT
GGTCTTCGCAGGCCACGCCTGCCGCGGAAAAGGACAGTGAGAAGCTGCCCGGGTGTTGCC
GGTTGTGCGCGCTAAACACTGGCCAAGGCAGAGGCAGGGAACTCACAGTGTTCTTGTTTC
TCAACAGTCTTAAACCGGAAACAGAAAATCTAAAAGTCTGGCACCGCGAGAGCCACCTTT
TTTTTTTGTGGGCGGGAACGCACATGCGCAGGGGTACCTAGCAAAACCCTTAAATACCGT
CTTGCGGTCACGCGCGGTCTCTTTCTCTGCCGCCGCCGAGTCGCGCGGAGGCGGTGGCTC
GGGGTGAGTTACGTCTAGGGTCGGCGAATGCGGTGGTTTTAGTGGGACTGGTGACTTCTG
TCACGGATGGGGGATTAGTGTCCGATTTAAACACAGTCGTCTGATCAGTGTTTTTGCTTT
TCAGTTTGTTCAAGATTCAGCTTCATCCGTAATCCACCGCCATGGCCGAGGAAGGGTGAG
CCCGGGGGCTTGGTTTGGGGTGAGGGTGCTAAATAGGCCCGGAGCCATACGCGCCGGACA
GGGTCAGCTGAGGCGCCATAAGCGTACCTGTCGAACATCGCCCGTCTCCGTCGGGTCCAA
GGAGTTAAATGTTGGCGAATTTTGGCTGACGTTTCTGATTTGTCGCATTCAGCATTGCTG
CTGGAGGTGTAATGACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCC
CACTAATTTGTGGAATTGCTGTTTGAATGAGGGCAAGCCGTTGATTTCTTAAAACTACAG
TGTTTGAAATGATGACTTAAATGTCGGATACCCCTTCACTCCTTTCATGAGGTGAAAACA
TTACAGTCTGACAAACCTGTAGGTTGTGGCTGTATTCTCGTTTTTGAGGATTCTGAGCCT
GATTCTAGCAAATGAAAGCATTATGCTAAATGAATGAAACATGAAGCTGATATTTGTTGC
AGAAGCATCTGGACTTTGAGGAATTGTAAGTATAATAAGGAATTTAATCAGAAATCTAGA
ATACTTGTAAATTTGTTTGGCTGTCTTATTAGTTTTTGGGCTTGAAGCATCTTGCTTGAG
TTGAAATTGAACGTGTTAAGGACTTCTGTGTCAGTTCAGTTCACTACAAGTTGACCCTTT
GAATCCTAGGCGGTCCTGGTAGCAGTCTTACATTATATATATATATATATATAGTTTGAC
AGTGTTAAATGTTATTTTTTCTAAAATAAAATCCCTTATGCAGTAGTTTGTCTTTACATA
GTAGGTTTTGTATAAGAAAGTTGTTGTGGTTGTGTTGGCCAGATTTTATTTAAATTCCCC
CCTCTAAAGTTTTCTCAGCAGAGTTTTGTGCAGATATGTGTTTTGTTGTTTTTTTAAAAA
TGTTTTGTCAGTGTAGCAAAACAGAGACAACCCTTAGTGCAAGAGCATTGAATTTCATTT
TAGTTGCATTTTTTCATTTCAGGCGCCAGGCCCATCTCTGTGTACTTGCATCCAACTGTA
ATGAGCCTATGTATGTCAAATTGGTGGAGGCCCTTTGTGCTGAGCACCAAATCAATCTAA
TTAAGGTAAGTTAATTTGCACTAGCTTTGTATAATTGGGCTGGTTTAAATCATGCTATTT
GTATCCAGTCACATGTTGCTTTCAGCAAGTATACATTTTATGGGACTGACATTGTTGTGT
TAAAGACGAAACATTATGCCTGCAAAGATGCTAATTGTTGATCTTGGTGCTGTACATGAT
GACAACTGGCTCCCTCTACTGAATTGCCATGAGGAAAATGCCATGTCACCCTTCTGACTA
CAGCTACCTTTGGGGTTTAATTTACTCCTAGTGGCATTAATATCTGCTAATAATGAAGTT
TCATTTGTCTAATTACTGCAATAGGTCGATGACAACAAGAAACTAGGAGAATGGGTAGGC
CTCTGTAAAATTGACCGAGAGGGCAAGCCCCGTAAAGTGGTTGGTTGCAGTTGTGTAGTT
GTTAAGGTAAGTCAGTATCTGGGATGAAGGCTTTTCTGTGTGTATCCTTGTGTTGAGATA
AATCAGGAAATGTAAGAGGAAAAAAATGTGTTTTTTAATAATTTTTATGGGTATTTGAAA
AGAAAAATGAGACATTTTAAAGCCAGCTAGTGAATCTGCTTACCTGCAAATGTTTCTGCA
GAAATTTTAGAAAAAGCTGGCAATAATAATGCCATCTTACGAGCCTTAAAGACACTGAAG
TCCTTAAGGTCCCTGAAAATGGCTACAATAAATAGTTATGAGAAACATTTCCAAACAAAC
TTCAGTTGTTAAAGCTTCATTAAGGCTTTCGTATGTAATTAGTGTTAAGAACTTGGGTGA
GACTTCCAAAAGTTAATAAGAAATTGTACGTGTTTTTTTTCTTCTTTAAAGGATTATGGC
AAAGAATCTCAGGCCAAGGATGTCATCGAAGAGTACTTCAAATGCAAGAAATGAGCAAAT
AAATTTTTCGTTCACATTCCTCACCTCTGGCTTTTTATTTGGGGCAGTTAAATAAGGTCC
TTTTAGTGAAGGGACATTAACTAGCAAATTCTGGAAGCATGTTCTACAACGATTCTATGA
TTTCTAGCTAAAAAAACAATTATTGATGCGGTGTTGGCATTTAAACTTGAGTAGCCTAAG
AAGCAAAAATAGGCCTAACAGAAGGGTTAACAAATGGATTTAGGCTATGGGATGCTACAA
ATGCATGATATCCTAGTTAACTTTGATCTAAGATTTGGTCACTGAAGCAGGAGATGTTTC
AACATAACCCAGTCTCAAAAATTGACCAGTATATTCAAGCTTATGTTAGATTTCTGATTA
AGAGCATGTGGCTTAAGGCCTTAAATGAGCCAAATATGGTATTGAATGCTTGTTGCACTG
AGCTTAACCAGTTAAACTGGAGCTTACTGAGCTCTATGAACATGGTATTCATGGTGGTTG
TTTCCTCAACTGTTAGACTAGCGGTTTCAGATTAATACATAAATAAACCCATCCAAGCAT
GTTTAGGTGCTGACTTTTCCTGAAAATGTACACTCTATCCTTGGCAGTCTGGATCGTTGG
AGGGTGGGATGCATTTTTTTGTGGGAGATTTAGATTTGGCTTTTAGGAATGCTTTAAATT
AGACTATTGTGCATCCCATTGGTGCACAAGGCCTTGGGTTCAATCCCTACCACCACAAAA
AATATCTTGAAATGTATTGTTCGGTCCACTGCCCATTTTTGAAAGCTTTGGGTCCAATTA
AACTGCCTTGAGACCTCACCTAGTTTTGGAATTTTTGGTGTATTTTTTATTTTGAAGTGT
CACCTAGTCTTGTTTCACAGAACAGTGCTGAAATGATCTAATCTTATGTCAGTAGAACCT
ACAGGTTGGTTGCACCTGTCTTATTTTGATGCTTTCATGTCCAACAATGTAGCTGCAACA
TCCACCCCCCTTTTGATTTTAATGCCCAGGGGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1014, 1192..1213, 1218..1312, 2062..2164, 2484..2585, 2991..3053
1001..1014, 1192..1213, 1218..1312, 2062..2164, 2484..2585, 2991..3050
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved