Spermophilus_tridecemlineatus Locus ENSSTOG00000001074
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ENSSTOG00000001074
Spermophilus_tridecemlineatus
ENSSTOG00000001074
GeneScaffold_3776
SNORA36
6620..6752
12938
TTTCCTCTTCTGACTTTTCCGTTCTCTTGTAAGGAGCTTGCCATTGGTTTTAGGGCTCA
GCCAGGTAATGCAGGACGAGTTCATGATCCTTAACTTTATTATTTATGCACTGACCTTTT
TGCAAATACTGTTGCATTCACAGGGTCTGAAGGTTAGGTTGTGGACATAGCTTTTGGGGG
ACCACTGTTCACCCCACTACAATGGGAAGCCTTAAAAGATTTTAAGCAGAGAAGGGATAG
GATCTAAAAGTAGAAACAGATGCACCTGTAGGAGGCCACTGGAAAAATCTAGACGAGTCA
TAGACAGCAGTAATGGTGGAGAAAAGCCACCAGAAATGGTGATATCTCAGCTATGCAGGG
CAAAATAAAATTTTTTACTATAAGAAATTCTCATCCTTTTATTTTTCTTTCATGTAGCTG
CTGGAAAATGTGCAGGTCCACACATGGCTCTCACTCTATTTCTATTGGTCAGCATCGCCC
TAACTGGAAGTAAATTCCAAGCCAGCCAAAGGCTTTCATCCTTCTTGTGGCTCCGCATTT
TATTTTTTTCACGTAAATGTTCTGACACCAACCTGGAACGGGTAGGCGTGAGAAGGCCGC
GGGTTTCGACCTTACAGAGCCTGAGCATGGGAAGTCAAAGGCTGAGGCCACTAGGCAGCT
ACTGCCAGGGCCACGCCCACACGGTCCTGGCCTTGGAGGCGCGCGGCGCTTGCGCCTCCA
GCTGGAACCATGAGAGGCTGGGTGAGCCCTCAAGCACATGCGCAGTCGTGCCCGGCAATG
GGCAGAGGCAGCCAATGACATTTAGCTGATGGCCCCGCAACGCGTCCCAGGCCCCACCCC
CAGTGAAGTCCCTCCCCTTCCCGCCCTGCGGCGCGGCACGCACGGGCGGTGCGCGGGTGG
GCGGGTCCTGGTGGCGCGGCCTGACGGACCCTAGCGGCGGGAGTCTGCGGGTATTTTTTT
TCGGGGGTGGCGAGCCTGGAACGCACGCGGTGCTGTACAACATGGCGGACGAGGAAGGTA
AGGGCTGCGGGCGCCTTGGTAGTGAGACCTGGGGCGACCTTTTGAAGTCTTGAGGAGCCA
GGGGTGGGGAGATAGCATCAGGCCCCGCGCCTGCTGCCTGCTCTCGCTGGTGGGTCTGCC
GCGTATCCGCCGGGCCTTAGGCCGACCTTGCCTCTTGGCCCTGACTCCACGGAGGAGTGT
CGAGCAGAAGCTCTCGCGGAAACTGTACTCCACGGGTTTCAGGCTTCCCATCTCTGAGAG
TACACCTAGAACCCGGGTCGCCATTAGTGTCATGGGATGGAGGGAGCGAGGGTACTAAGA
GGGTGTGGGGAAAAGGCCGGGTGGTCCCGGAATGGGGTTAACTCCGAGCTCAAAACGTCT
TAGAGAACACAAGCCGCATGGACAGTTGAGTGGCCGCCTGTGGAACTTTCTGGCCCATGG
GTGAGCGCTTCTGTTGGGTATTTGAGCCCTGCCTCAGCCACGTGGTGAATTGGAAGGGAA
GTCAGCACGTGCAAACGGCTTGCAGTCATTACCAGGCAGTCGACCCATGTGTTTGGCCAT
TACCCATTTGAGTTTTCTGCACCAGTGCTAGATTAAAATCCTTTTTCTACGTGTCTTAAC
TTTCAGTTTTGTTTCATTTGTTCCGAGGAAAAATTACCAAATCTCGTGTTTGTTTTAGTA
GTTATTTTACCAAAGAAACATAAGAAGAAAAAGGAGCGGAAGTCTTTACAAGAAGAAGAT
GTAGCTGTAAGTAGGGATGTGTTTTTACTTTGCTTTGGCTAAAAAGACTAGTTAACATAT
TAAACTAAAGAAGTGTTAAATATTCTCAACGAATGGGCTAGCATTCACTAGTCATTGTGT
AGAGCCAAAACACTGAAAAGCCAAAGGCAGACAACCTAAGTTTACAAAATGCTGTTGGCA
ACAGCAGCTGTTCTTCCTGGATTTCTCTTTCTTGTCCCATCAGCAGACCCCCATTTCCTT
TTATTTTAAATGTATTGCAACCATCTTAATGGCACTTCACCTAAAGAGCTTCTGGTTCAT
TTCTTCCCTGTGGAGGTTCTGAGGAAAAGACACACAATGCCTTATTTGTCATTTAAAAGG
TATACACCACTGTGGTAGTAATGGAATTGTTCAAAATACATGGAAAGATCTAATAGGTCA
TGTATCTGTCCTCTTAAAGGAAATACAACATGCTGAAGAATTTCTTATCAAACCAGAATC
CAAAGTGGCTCAGTTGGATACATCTCAGTGGCCCTTGTTGCTAAAGGTATGTGCTATGTG
TGTAAGGTTGATGTCTGACTTTGATACTATTTCTAATTGTTAAACAGTTAATTAAGAATA
TTTACAACTAGGGGCTGGGGTTATAGCTCAGTGGTACAGCACTTGCCTTGCATGCCTGAG
GCACTATGTTCAATCCTCAGCACCACATAAAAATAAATAAAATACTGTGTCCATCTACAA
CTAAAAAATATTTTAAAATAAATAAAATAAAAAAGCATATTTACTACTAAATCTTTCACT
TTAACAAATGCCACCATAATAAGTCACAGTCTAAAACAGTGAAATTTCAGGTATCTGAGA
TAAAGGGCCAGGTTATTTTAAAATTTCCAGTGCATCCAACATTGTTGTTCAGTAAAAATG
TCACCACAATGTTAAGTTACTATCAAAATTTATAAACAAGTTCGTTTCTTAACTTACTCC
ATCTTGTACACCTGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTG
GGCTGAGGGTTTAGGTGTTCTATTGAAACACATTTAGGCACAGTTTCCTAACATGTAGTA
TTCACTATTTCTTTGAGGTTTAAATTGGGTACTTGAGAAATAGAGTTAAATTACACTGTT
TTCATAATTTTCACAATTAAAATGTTACACACCTCGGATTGGGGCTGTAGCTCAGTGATA
GAGCAGTTGCCTCATAGATGTGAGGCACTAGGTTCAATCCTTAGCACCACATAAAAATAA
ATACATAAAGAGATATTGTGTCCATTTATAACTAAAATTTTTTTAAAAAATGGATAACAG
CTATGAGTCTTCGAGAAAAAAGTTAGTGAGATAACCCTTGACAGTTTTAATAAAAATCAT
TGTGTATGGGATGATGAAAGAATGGTATTTATATAATTTAATCAATTTGAGTTTCTGCTT
GGCCAGATAATCACTGTCATTTAAGCAATATCTCTTTTCTGTTGTTGGCCTGGAAATACG
CTAATAAACAGGGTATGTAAGGTCCCAAACTCCAGGAATGGGAGATAGGTAGTTGAAACA
TTATTGCTGTTGTTGTAAGTACAATGGAGAAACTAAACTGATGATGAAAGATAGACTTCA
GGTAGTGAATTCTTACAACTGGTGATCAAGTTTCAGGAGATTACAAAGGAGCAGAGATGT
GGGGCATATGGTGCAAGAATAAGCTGGCCATGTTCAGAAGCATTGCCAGTCATCTTCAGT
TTGGCTCTTTTGTTGCTGAGAAAATCAAAGCTATTCCATGTTTTATTCAAATCCTGCACA
ATGAAGCCCAGTATGTGTTCTGTAGTACCCCAGTAAGTCTTTTTCTAGAGCAATGACTTG
AATCTACAAGTAAGTGCTCAAATTTGTCTTGTTCCAATATTGGGAATTTTCCCAGTATTT
AAGGAGTTTTAACAGTCTGTCACAGCAACTAATGGTAATGTAGGCACAAGAATCTAGATT
TATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACTCTGCATTTGCTCCCTTGTGC
ATTTTGGCTCTTGGAAATTTCTTAATTAGGAGAAGAGAAATTCCTGAAGCAGAGATATTC
TTTTGGTTTTCATATGCCCTTCTGTCCTTTGCCAGACCCAGGTTGGTCTCTTGGAGTTTG
AGATACTGGTCATGTGCACATTGAGTCAACAAATTCTAACACTGAGGCAGAATTCTGTCC
AGCTCTGGACTTGTCATTCCAGGTTCCTCTCCTGCTGCCTAAAGTACCATTTTTCTCATT
CTCACCTGAGAAAATTCTATTTACCTTAGCAAGGTATTTTCCAGTTGGGCTCTGTACTGG
GTGTCCAGCTGTCCTTGTCAGCCCCACTGACCTCCAAGTGAGAAAAAATGACTTCATTTC
GTGTTCCCATCAGCACCATGAAATCTGTCTTTTAATAAAAGTTTTATGTAAACATGATGT
GAAATATCTGCTTTTTCTGCTATGCAAAATGGCAGTGATTAGGCATGTTAGAAGTATAAA
AAAACTTAGTGGCCACACCTGACTACTCTTTTGTCATTTTTCAGGCAAAGAGTATGTGGG
AATTGTCCGGCTGCACAATGCTATTGAAGGGGGGACTCAGCTTTCTAGGGTAAGTCTGCC
ACTGTAGGGAGGGCACCTTAGACTGCTTGGGTTTCTGAGCCCCTAACTATGTGGAAACAG
GTTAGCTTTCCTAGCTTATCATCTCTTATGCCCTTTTCAGTGGGCTTCCTTAGCTAGCCT
GAGGAGGGGAATACTGGAGGTGGGGACAAACCCTTACCTGAGTAGTTAAAGAAAGGGCAT
TTTAGAGCTGTGATTGTGGCTCAGTGGTAGAGTGCTTGCCTGGTATGTGTGAGGCACTGG
GTTCCACCGTGAGCACCACATAAAAATAAATAAAGGTATTGTATTCATCTACAACTAAAA
AAAAATTAAGATGTTTTTAAAAAGGGTATTTTTGATCTTAATAATTGAAATAAACCTGTG
TCTCAATTGTGTTATAAATTCCCCAAATATGCCCTTTAAACTTATGTAAGAATCTGTGTG
ATGAAAGTGCTTTGGTTTGTATTTATTCTTAGGCCCTAGAAACTCTGACAGGTGCCCTGT
TCCAGCGACCCCCACTTATTGCTGCAGTAAAGAGGCAACTCCGAGTGAGGACTATCTATG
AGAGCAAAATGATTGAATATGATCCTGAAAGAAGACTAGGTGAGTCGTTAGACCTGTGAG
GAACTGAATTGCCACAGACTGCAAGTGAGTAGGAATGCATTTTTGAGGGTTCCATTCTGT
TGTTAAAAGTAGATGCACTTAGCGTATTGTATATTCTCCTGCATCTGTCTTCTCTAGTCC
TGATGGCTCAGATGGAGAATAACTCAGGTTCACAACCAAATATGTGTTTACTCTGTAAAA
TAGGTGCAACTTTTTTTGTATATGTGTCTCAGGAATCTTTTGGGTGAGTTGTGAGGCTGG
CACCTACATTCGGACACTGTGTGTACACCTTGGCTTGTTGTTGGGAGTTGGCGGTCAGAT
GCAGGAACTTCGGAGGGTTCGTTCTGGAGTCATGAGTGAAAAGGTATGCCATTGTGGGGC
TAGAGGCTTTAGAACTGATTCTTAATATTTGCCAGCCCTTGATGGAACCTTACATTGCTT
CATATCCTGGGAAAGACGATTTCCAAAGTGTTGAGTTCAGTTCAGGGCAGCTTCCCTGTT
CTGTTAATTAAACTTTGGAACATTAAAATTGACTAGGGGAGATGATCAGATAGAAAATAT
TAATCTATTTTATTTACTTTCTGGTCTACAAAAATGCCTGCTTAAATCTAATTTAGCAAC
AGTTAAAATAACAATTCTAAGAGACTGAAGATTCCTAATGACCTTAGACTAGCAGACAAG
TTCACAAGTAGTTACCTTCAATTTTAAGAAGTTTGGGTTCTGGTGGATATTTGAGATATG
AAGACACTGAATTACTTTCATCTGTGGCTGCTTTTCAGGACCATATGGTGACAATGCATG
ATGTGCTTGATGCTCAGTGGCTATATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTTGGATGCCATCAAACTCTAGGGAGTT
AACCATTGGCCTATAAGTTCTATGCCAAAACTTATGTGATTGAGCAGCCTACTTAACTTT
TTGCAAGTTACTTTGGGATTCTGTTACTGCTTGCATCTTCAGTAAATGTATTGTTCTTTC
TCCTGGTAAAAGTAGGGGGTAATTCATGAAAAGTAAGGCAGGTTTATTTAAAATGACAGC
ACCTATATGTCATAGGAGAAAAGTAGAACCTAAATATCTGATTATGTAACTTAGTGAAGA
AAGAGGGATGTGTTCTTCAGCAACTAGAGATTAATGGGAATAATGAGATGTGTAAAGTTT
TTAGACCAGTGCCTAGCATGCAGTAAGTAGCTGCTACTATTCTGTGACCCTTTGTGTCCT
ATTGAACTCTCAGTGCCATTAGCTACTTTTCCTGCTCTCACCTCTCCTGTTATAGATTGT
AGGAGTAAGATGGAGGGCAGTGGCTGGGGGCCTCACATGTGATACCATCTCTGTAGGTAA
ATGCAATCTGCTATGGGGCCAAGATTATGCTGCCAGGTGTTCTCCGATATGAAGATGGCA
TTGAGGTCAACCAGGAGATTGTGGTCATCACTACCAAGGGGGAAGCAATCTGCATGGGTA
AGGAGGGATGTCACCCTCATCAGTTCTGGAGATGGGGCTCCATTCTCCATCATAGCTATG
TTTGCTGAGAGCCAGTCTGCACATACTGACTCCTTAAGTTGATCTATTCATGGTGTCTCC
TAAGGTCTACAGGTGGTCACAGTAAAGGGGGAGGTCAGTCAGGTGTAGGTGAGGAGGAGA
TAAGTGGGGGTTTCTCTTTCATATGAGTAGATTTTTGGCTCTCCAGAGAGAATATAGGAA
AATCACTGGTGATGAGTGGTTGTGGGTTGTCTGTGGTAATCAAAAATAAAAGATCCTTTT
ATTTTGCTCCTTGTCTGCTTGCAGGTAGCTTAATAAGTAACTTTTTTTTTAATTTATGAA
AGTTTCACTACTATTGGGTCACTTCCTTATGATTTTAAATACCCTGTGCCCCTCTTAATG
AGTGAGTCAGACTATTCATTTAATAGTTCTAATTTATACCAGAAGTAAAGCAAAGCATGT
CAACTCACTCAACTCTGAGCAGGTGAGGCAGTCATAGAAGGCTTCAATCCCACAGATTGA
AGTTTCCGGGATCCATTTTCTTGTAACATTCCGTGGCCCTTAGGGGACATGTGTGTCAAG
CCTATACATGTCCTAAGCCACAAACCTGCCATGTGTATCCACTTGCTTTGGTTAGGTGTC
TTTAAATTGGTAAAGTTAGCATCATTTCAGAAGCTTCCTTCCTATAATGGAGGATTTTTC
TCCATATTCACAGTCTAAGCAAAGGAAACCCCTGTTAAGGTAGTAGATCTCGGGGCTGTA
AGTGGGGTTTTAAAAGTCATGAAGCAGTAGAATTGGGATTCATCAGTTATCAAGCCCTTC
CCCTTCAAATCATTCTTTTCTTTCCAATGCCTACAGCTATTGCGTTGATGACCACAGCAG
TGATCTCTACCTGTGACCATGGTATAGTAGCAAAGATCAAGAGAGTGATTATGGAGAGAG
ACACCTACCCTCGGAAGTGGGGTTTGGGTCCAAAGGTAAGTAGGACTGGGTTTTAGGCCT
TGCTGGGTTATTTTGCTTTGTGTTACTGCTGAGTACCTGCTCTTATAAATCTTGGTGTGT
CCTTACTACTGTAGCCTTGCATCGTGTTGGATTGTTGACAGTGAACAGAGTCAGGCTGCA
TCGTAGACCTCAAAGACTTGTGGCCTCATGGGGCAAAACAGTTGGGCATTTCTTAAATAC
ATACATAGTAGGATGCTGAATTTTAGCCAAGTTAATGGCTTTTAGAAGTGCAGAGATGCT
GGATGCAGTGGTGCACACCTGTAATCCCAGTGGCTCAGGAGGCTGAGGCAAGAGGATGAC
GGGTTCAAAACCAGCCTCAGCAAAAACGAGGCACTAAGCAACTCATTGAGACCCTGTCTC
TAAATAAAATACAAAATAGGGCTGGGGATGTGGCTCAGTTGTTGAGTGCTCCTGAGTTCA
ATCCCTGATACCAAAAGAAAAAGTCAGGGAGGTCCCCAGGGTTAGGGAATCCACAGTGAG
GAGTTTATCTGGGTCAGGTAATCTGGGCAAGGGATTTTCTTTTAAAGCAGTGTGAAGGGT
GGATGGGTTAGGTATTGGTGAGGTGAAGAGGGGAGGGAACAATTCAGGACAATTCTGCAG
AGGAGGGGGGCGCTCTTCTTAGAATACACAAGGCAGAAATGTTATGCCATTCTGTGCAAG
CAGGGTAGGTCTAAGGGTATAGTGTGCAGTCACATTGTCTATTATTTGCATTGATACAGA
CATTCTAATTTTAACCCCTATGTACTACCAGAGCAAGTCAGAAGAAGCTAATCGACCAAG
CACGGTCTTCTGGACAAGCATGGCAAACCCACAGAAAACTCTCCTGCCCACGGAAAGCAG
TAGTACATTGTCTACAGGGGAGGGAAAGAAGCTTCCGGGACTGTCTTAAGACTGGAAACT
TTTCATTTGGAAATTGATGACAGATGAGTGGGCAGATCCCTCGTAGAGAGTGAGAGATTT
ATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTGTTTAAAGGGTGAAAGTATATGTGCACTG
GTCATACTAGTGACTATAACTGTTGCAGACTTTCACTGTCAGATGTGAATTCCAACTTTG
CCTACATTCTGTAAGAATTTAGGGACCACTCTTAGGTCCTGTAGTCCACCTGTGAGAGAA
ATGACTTCTCAGGGCCTTCTAGTCCCTAAACCCCATTCTGCAACTGTGGTACTCCTGTTG
TGTCCCACAGCTTTACTTACTGTTGGGTCTAGTTGGGTTCTTAAGACTTTTGGATGTACT
GAACTTTTCTTGTCTGTAACTAACAAGGATCTAACTTTCAACTAATCATTTTCATTTTAG
CGGAAGCGAGAGAGTGAGAGTGAAAGTGATGAGAACCCTCCAGCAGCTCCCCAGTTGATC
AAGAAGGAAAAGAAGAAGAATAAGAAAGACAAAAAGGCCAAAGCTGCATTAGAGCATGGG
GGCGAGCCTGGAGATGGGGTATGTATAAACAGTTGGATTCCTTGGGCTAGCTTAGTCCTT
GGCTAGGGAAAGAATTAGGTGGTGCTGGCTTCATTGCTCTTGAAGCTATAACACAAGGAT
GGGATGTTACCTTGATCTCTAACCTTTAGTGCTTCCCTGTGTTCTGGAGTGCCTTGTCCA
CTCTCATGGGATGAACATGGGGACATACTATATTAATGGGCCCAGTTCAAATTCTGTTGA
CAGTTGGTAGGAAGGATTTATACCTTCATTATCTGAATGTTTCAGCTTACAAAAGTAGAC
GATTAGGATGTCACAGTCATCAGTTCACATGCAACATTTATCCCAGAATGTCCTTACAAG
TCCTGAAAAGGGTTACAAACTTATGTGGAATTTATCAGATTTTCTTTGTGGGGAGTCATA
ATTGTTTTGCTTAATGGATGCTGTAAGCTTGTTTCTCTTCTCTCCAGGACAGTGACACCA
CAAAGAAGAAGAAGAAGAAGAAGAAGAAAGCAAAAGTAGTGGAAGTGATGTCTGAGTAGT
GAAGGTGACATTAAGCCTTGTGCCCAGGTGGTGGGAGAGATGAAAGCCTTATTGAGAAAA
CAGTTTCTTTTGTTTTGAGGGAGTAGAACAAAGGTTCTGGACAGGGTGGAGAGTTCTGGC
ACATTTTAGCTGCTACTTAAAACCTCAGTGATACTACCTGTTGTGGTCATCCCATCTTGT
CCTGTTTTAAGGATGTGGGTGGATAAAAAAAAAAAAAAAGGCAGATTGTATGCCATTGAC
TTCTATGCTTGCTTGAGTTGGGAAGCCTCAGTTTCAGACCTAGAACTGTCCAGTAACTGT
CTGGATCTGTTTATTAGTGACCATTTTTAACATTATAGTTCTCTCCTACTTTATTCTGGT
TTTGTTTTTTTTTTAACTTTGTTCAAAAAGTTTGTAAAATTAAGTCTGCTCAATGAAACG
GTGTAGAACTCTTGATAAATGAAAGAGTAACTGAACCAACGTATTCACTGGGGAAATCTT
GTCTCCAATGGCTTTTGAGGACAGTGGTCTATTCTGGTGTTGGGTATGGGCCTCACAGGC
CCAGTACTGTCCATTTTGTTTCTGGCCTAGCTGTCAGTCCTTTGTGTACTCGTCCAGTGC
TTGTGTGTTCAGCAGCATTTACCCAAATCCATCTGGCTACTTGTGTTTGCGGCAGAAACA
ACTTTTCCTGTACCCTCATGTTATAAACCCTCATTTACATTTGAAGAATGGACTTGCTTA
TTGCTGCGAGGATAGTGTTGTAATTTTTACATATTAAAGTTGACTCATGGCATTTCTAAA
GTATTCCTGTTGGATTTTATAATTGTCAGTAATCTCAAACTGGCATAACAAAAAAATATA
TAAAATGTTTTGATTAAAAATCTGGGGATTTTAGTGTCCTGTGTAAAATTTTCTTTTCCT
TTGTTAGTTTTACATTTCTGTAGAACATTCACCTTGAGGCCTAATAGGATAAAATACTCT
TGAGGAGAGGTCATAAATCCAATATTTTGTTCAAAAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1016, 1678..1745, 2179..2265, 4182..4273, 4374..4558, 5504..5568, 6032..6158, 6392..6522, 6938..7081, 8336..8456, 9336..9454, 10232..10251, 10253..10319, 10323..10336, 10656..10734, 11280..11417, 11867..11938
1001..1016, 1678..1745, 2179..2265, 4182..4273, 4374..4558, 5504..5568, 6032..6158, 6392..6522, 6938..7081, 8336..8456, 9336..9454, 10232..10251, 10253..10319, 10323..10336, 10656..10734, 11280..11417, 11867..11935
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved