Spermophilus_tridecemlineatus Locus ENSSTOG00000012237
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ENSSTOG00000012237
Spermophilus_tridecemlineatus
ENSSTOG00000012237
GeneScaffold_4241
SNORD49
2521..2594
4150
CAGTTTTATACATTCTTTGGAGAAGGCAGGGACCCCCACGTACATCATAGCATCTCTTA
GCAAATCATCACACATCGCGGGAAAATCAAATAACAACTCTAAAACATGATTAGCACATT
CACTGGTGGAAACAAGTTGGGTAGGGGTGATTGGTTACTATAAGAGGGGGATTTATTTGA
ACTGATTGGTTTAAGTCAAGAAGGGTGTTTGTGCTGAACTACATGGTTTCCCAACACCAT
AAACTACTGGGAGGGTCATCTGGCATCCCAGGTATTTCCCTGTCTCATGCTGATTGGTGG
CTGCTAGGGGGTTGCTATGGGTCCCCTCCTAGCCTGACTGAGTCAGGGACACCTGGTGCA
GCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTGAAGAGCAGCTAT
TAATTCTGAACTTGCAGTATGCCCTGGCCCTGCCGTTTCAAGGGATGTTATTTCATGTGG
TATTCAGAACTACATTGTGGGGCGATCGTGTCTTCATTTTCCACACGAACAGTTTTGACC
TCACAAGGGATGAGTAATTTGCTCAAGACCACATAGCTAAAGAGGAGCCATACAAGACTT
CAGCCCCGGGAACTAGGCTCGGAATCCGCCCTTCAACCTCCAAGCAGGCGCAGCGCGCGG
CGTTACCCAGAATTCTCCGCGCCGCGGAAGAGACCACTAGCTCAATGTTCCGGGGGGGAG
TTCTGGGAGGTGTCTGTAGCGTTAAAAGAGCTGGAAGTGCGGTGAGTTTTTTGCCAGATC
ACCCTTTCTTATGTGAGGAATGGGATGTTCCGACATCTTAAGGTCCGTGGACGCTGCAGG
ATCGGCCTTTTCACCATGGACTTTGTGGAGGTAGGGTCTTTTATTGTGTACTGTTGGGTG
TTGGTGGCAAGGACGAAAAGAACTGGAACCTTTTTGTTTCCGGAAGCTTAGTGAAAGGGG
CTGGTGTTGTAACGGCGTTTCTCCGTGGCGCCGATGTCCACGTGGGCTTTGTGGCTGACT
CTGCGTCCGGGTGTCGGGACCCTCACGGGGCAGAATCAGGCCACCGTGGAGCGAGGGTTA
TAGACCGCGTGTTTTTCCTGCAGGGCGACCGCGGCAGGCGCCTCGGGTCCACAGATTTAA
GGATCCAGAACCCCCGGCCCGCCATGGAGGACTGCCGCAACACGACAAAAGCTGGGTGAG
TTGGGTCAGCCTGCAGCTTGAGTCCACGGCCTTGGAGACGGATTTCCATGGGATCGTAAG
GGAGATCGGCTTGCTGTTCTGGTGATACGAATAATAGGAAGTGCCGCCAGAGCGATACTG
ACGATGTTTATGCCTCCCCTGACCGCAGTCGCANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCCCTGGTCTGGAAGGATTATATTTGACGAA
ATTGTAACCTTTGTGGGGTTAAGCATTCAAGTTGGCATTTTAGTTTTGTACATTTAGCTT
TATGGAATGTGTCATTGCATGAAGTGGAACTTCAGAAGATGGAGAGGGATGCATTAAGCT
GCATCTAGAAACTTGTGTTTTTTTCTTTTTTAACTCGGGGATGCTTTATCATTGAGCTGT
ATCCCTGACCTTTTTAAATTTTGAGACTAGGTGTAAGTTGCCTAGGCTGGCCTTTGAACT
TGGCGTTTCTGCCTCATCCTCCAGCATACTGAGATTACAGGTGTGGGCCACCGGGTCCTC
TCTCTTTTTTTTTAAATGTAGTGCTGAGGATTGGACCCAGTGCCTCACACATGCTTAAGT
GAGCGCTCTACCACTGAGCCATAACTCCAGCCCCTCCAGTGGGTTTTTAAGGCAATGTTA
GTTTTGGTTTTGACAATATACAGGTCTCTGGAGCAATATTGGAGAGTAGTGAGGTATTGA
CTGCTCTGATGAAACCATTAATAATAGGAAGTGCCGTCAGAAGCGATAACTGACGATAAC
TATTCCTGGCTGACTGCAGTCAACAAATCTTTACCATTTGTTGGTGCCCAGGATAAAGTT
GGTCTGAACTGTGACAATTGCTATATTCACTCAGGTTGCATATTAGCAGAAGGAACACCA
GCAGCTGAGTTTTGGAGCCTGGAACATTTGCCTTTTCGTGAGGTAAGCTTTGGCCTCTAG
AGAGTATAGTGACCTTTATTGATGATATTCTGGAAATGCTGAGTGGCATGCATAGCCATA
GAGGGGTTCTCAGATTACCTCTTGGTGATTTAATAATCTCGAACCAATTTACCTGTCTAT
TCTGAGGTATAGTATTCCTCATTTGTCAGAAGGAACCATAATCTTAAGTACGTGAGGTTT
GAAATGTGACTGAGTAGAGTTACAGCTCCCAGACAAGCTAATTAAGACTTAATGTAATTC
AGTAATTTTACAAAAAAAAAAAAATCTCTTCTGTAAGGTCTTAAAGGGCTTTTGTTAGGA
TGGACTTTAAATTGTTACCCGGGCTAAAAGAAATGCCTTTCCTGCTTCTGTGGTCTTTAG
GTACTTTGTTTTATCCATTCTCAGGATTTTGGAATGAAGCCCTGAAGTGCAGATTATAGA
CCTGGTGGCAGCAACCTAAGCTCTGGAGGTAAGCCTTGATCTACATAAAAATTACCTTAT
TAGTAGAGTAGATAAAGTGGCTAGTTGTTTTAAGTAACTTAAAAGGATATCACATGATGA
AATCACCCAAAATAGCTGGAATTACCGGCAGATTGGTAGTGGTGAACCTACGGTTTTCTG
AAGATATCATTGCACTTGTGAATGACTGCTGTTAATTGGAGTAGAAAGTAAGATTGAAAT
TTAGTTTCTTTGCAGGCTGTATCTCCCAGAGGATGATCAGTTCCGGGGATCAGTAACCAC
CATTGATTTGGATTCTGAAAATCTAAACAGCTTCAACATTTGGAAACATGGTCACCTTGT
GTGTCAGGCTGTTCACAAGAGATCATTCAGCAGGCCCGATTGGTTTCATTACNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTCTAGGGGTTACTTGGTTTAAAGT
GAGTATGGACAGTGACCCAGTGAGTAGCTCTGTTTCCAGTTTCTCCTTAACAGCTATCTT
GATAACTGCCATAGGCTCACTGGTCCTGGGATTTTAGAAATGCCCTCATAAGTTAGGGGG
TGAAGACAGACCTTCAAGTGATAGGCAAGTGCTCTGCTATTGAGCAAACATCCTTTGCTG
TCCTCAAATTTGTAATTCCTCAGCCTGTGAATAACAGGCTGGCTAAGGATCAAGATTTCT
GATGGGTTTTCCCATGCATGCCTGTGTGCATAGGCACTTGTCACCACAGGATGCTCTAAA
TATTTCAAGGTGTGGTGAGAGCTGGTTTTAGGAGCAGGTCCCTGGACCTGGAAGCTAAAA
TGTGGGAAGTCAGTTCCAAGCCTGAGACCAAGCAAGAAGAGCACCTTCCTTAAGTCCATG
CTTAGCATAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1096, 1099..1101, 1104..1129, 1131..1147, 1150..1196, 1200..1205, 1207..1234, 1237..1249, 1251..1254, 1688..1731, 2674..2686, 2688..2723, 2731..2741, 3144..3150
1001..1096, 1099..1101, 1104..1129, 1131..1147, 1150..1196, 1200..1205, 1207..1234, 1237..1249, 1251..1254, 1688..1731, 2674..2686, 2688..2723, 2731..2741, 3144..3150
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved