Spermophilus_tridecemlineatus Locus ABCF1
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ABCF1
Spermophilus_tridecemlineatus
ABCF1
GeneScaffold_5891
SNORA42
17215..17351
20942
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACCGGAGCGGAA
TAGCACAGGGCGCCGCCGGGGTAGCAGTAACTGCCACCGCAATGCCGAAGAACCCAAGCA
GCAACCACCGGAGCCCGAGTGGATCGGGGACGGAGACAGCACAAGTCCCGCAGGTGAGGA
TCGTATGTACGGAGGAACGGGAGGAGAGGAGAAGGCGCATGCCTTAGGAGGGTTACTAAG
CGCGAGAGTCGTCAGGCCCGTGCACGGGGTCGTGCGCATGTGTGCTGTGGTGTTTGCCCC
GGCAGGAGAGTGTTTGGAGTGGGGAAAGGAAAAATGCCAGAATATCATTTGTGAGCTTAC
AAGGGACTAGACACGGGACAAGGAGGAACATATGGTATCTAGGGAGATTTGGAGAGAAAT
GAGAAAGTCCTCCATTCTTTTATTCTGGACATCTTCTCCATTACTCTGTATAGCTCAGCA
ACATAGAAACTCCGCCTCGACCTCCCCTGCCCCAGCGCGCGAGTGCACATCGCCTAAGTC
CATATCCCTCTAGTTTTTCAGGAAAAGATGACTCCTTGTGTGCTTTTTCTCCTTCTGGGC
CTTTTTTTGTGACAGCTCCATCTAAATCAACTGGAGCAAGGCTATAGATTTTGGATGTTA
GAATAGGGTTTAAGAATTACTTAAAGCAAAGAATGTGGAGCGCTTGTTTTCAGTTAGGTA
TGGTGTATACAGCTTTGGGAGTAGAAGAAAAAAACATGAAGATATCATCGCAGACTTGAA
GTCACTTCAAGGAGTTGATAAATGGACACAAATAACCACAATAGTAACACAATGAGTAAT
GTTACAAGCATTTATGGGTGCCTGGTGTTTACAGGTAGTGTGGGAGTAACTGGGAATCTA
GAGATTAAAAATAAGCTTTTTTTGCTGGAAGTAGTGTTGCAAATGCATGTAGTCCCAGCC
ACTCAGGAGACTGAGGCAGAAGGATCCTTGAGACTAGAGTTGTAGACCAGGCTGGGTACA
TGGTGAGACCCTGTGTCAAAAACGAAAGAAACACAAAAAANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAAAAAAGAGAGATTTCTGTGGAATTCCTGGAATTCTGGTTTTGAG
AATTCAAGCCTAAGAATATTTAAGCTATTGTGGTTAGTTTCTTTGTTTGTCATTATTGTT
GTTGTTGTTGTCTTGTTAAATGATTATAGGAATGCTTTAGATGAATATATGGTTTCTATG
ATAGTGGATAGGCCTGGCATAAAGAGAAATCAAGAGGCTAGTAACTATCTCTCAATCTGA
TGGGTGGCAGATATTAGACATAGTCCTCTACCTTCAGGGAAACAGATGGACTGAAGGGAG
GAGCTGAAAGTAATCCAGTCAGCAAACTTTTTTTTTTTTAAACAGGTGATTGACTCAAGG
ACACTCAACCACTGAGCCACATCCCCAGCCCAATTTTTTTATTTTATTAGAGATAGGTTC
TCACTAAGTTGCTTAGTGCCTCGACATTACGGAAGCTGGCTTTGAACTCGAGATTCTCCT
GTCTCAGCCTTCTGTGCCACTGGGATTACAGGCATGCAACCATGCCCACCAAGTCAGCAA
ACTCATTGACCTCCCACTTTGCTCCCTGTGAATACAAATTAAACTGTTCAGGTGGCTTTT
TAGAATAAAAAACTAACAAACAGGTAAATATGACATTGTGATCTGTGTTGTTAATGTATG
AGCAGAGCAGATGGGGCATGGACCCAGCTGTTTTACCAGATAACTATTTACATGGCTTAC
ATACAACATATCATACACAGCATCCCAAACTGAATTCATGAAATCTTCCTATCATTCCCC
GCATGGAAGTTGAAATTGGGGGAAGGGATCTTTTCCACTGTCTCCTAAATTAGTGAATGG
AACCTATAATCAATTTTAGTAGCTAACAAGATAAGAATGGCTAGGTGTGGTGGATCACGC
CTATAATCCCAGCAGCTCTGGAAGCTAAGGCAGGAAGATGGCAAGTTCAAAGCTAGTCTC
AGCAACTTAGCAAGGCTCTAAGCAACTTACATCCTATCTCAAAAATAAAATATAAAAAGG
GTTGGGGATGTGGCTCAGTGGTTGAGCGCCCTGGGTTCATTATTGGTACCAAAAAAATAA
AGAAATATAGGAATGGTCTCTTGCATGCTCACTTTTTCTTTTATTTTTAAAAATCTGTTG
GTTCTAATTAGTTATACATGACAATAGAATGCATTTTGACCCATTTTACATAAATGAACT
GTAACTTCTCATAATTCTGGTTGTACATGATGTAGGATTACACTGGTCGTGTAATTAAGA
TAGCCAATAGGGGTCCATACTTTCTCTATTTTTTATTTTTAACACTTACTCCATCCCTGT
GAAATTTCTTTTTTTTTTAGTGCAATGGACACATACTTACTTTTATTTATTTATACCTTT
TATTAATTTATATGTGGTTGAGAATCGAACCCCAGTGCCCTCACACGTGCTAAGGCGCGC
ACTCTACCACTTAGCCCCTGAATTCTTGTTTATCTTTCTCCCCCTTGCCACCCCCCTTTT
TTTTTTAAAAAAGAGAGAGTGAGAGGAGAGAGAGAGAGAGAGAGAGAGAGAGAATTTTTA
ATATTTATTCTTTAGTTCTGGGTGGACACAACATCTTTGTTTGTATGTGGTGCTGAGGAT
CGAACCCGGGCCGCACGCATGCCAGGCCAGCGCGCTACCGCTTGAGCCACATCCCCAGCC
CTGCCACCACCCTTAATCAAGCCACTGTTGTCTGTCTCCTGGACTGCTATGACGGACTCC
CAACAGATTGCCCAGTACTCTTGTTCACTCCTGTCTTTGCTCCACTTGAAGCCAGAGCGG
GACTTACAGGGACAAAAGTGACCATATACATAAAGGCCTCATTCATGATTATAAACGCCT
ATATATCCTCACACATGATCATAAACCCTTACTCCAGCCTTACCTTTGCCATTCTACCCT
TCAGCCTCTAAGCTTTAGCCATAGTAAGACTTTCTCTGTTGCCCAGTGGATATGCTTTCT
TATAGCTGGACTTGTGTGTAGCACTGGAACCCCACCATGTGCCTACCAGCTACTCATGCT
TCAGGTGTTAGCTTAAAAGCGATTATGTTGAGAGCCACAGCCAAGGGGCCCCAGCAACAT
CTAGCTGATTGGCTCCTCTGCGCTGATGCTCATTGGGGGACTTCTTTGGCTCCGCCCGCA
TGACCCAGCCAATGGGCCTCAAGAGCAGGAGGATTGTGGGAGGTGGTGAGGCTGGTGTTT
GTGTGAGAGGCTTGTGGGAAGCCGGTGGTGGTGGCAGTTGGGCTCTGAGGGTTTTTCCTG
AGGAGCTGTTTTGTTTGGCCTGTGTGGTTCTAAAAATAAAGTTCAAGTGGCTCCTGAATT
GTGCCCAGCCAGACTGCGGCATTTGATGGCAGGGCACCAGAGATGAGGACAGTGGGGTTG
ATCCCTCTGCATACTGCCAAGTAGGCTTTACCTTTTTAGTTTTGTTTTCGTACTGGGATT
TGAGCCCAGGGTCACTTTACATCCCCAGACCTTTTTTTTTTTTTTTTTTTTTTTTGCTTT
GTTTTTGAGAGAGTCTCACAAAGTTTCCTCATTGAGTTGTCAATTCTGGCCTCAAACTTG
TGATTCTCCTGCCTCAGCCTCCCGAGTTGCTGGGATTACAGGTGTACACCACTCTGCCAA
GCTTGTAATTGCTTTTGAAAAGTCTCTCCCCCAAGCTGAGCACAGTGGTAAATGCCTATA
GTCACAGTGGCTGGGGAGGCTGAGGCAGGAGGATCAAATCAGCCTTAGCAACTTAGCCAG
GCCCTAAGCAAATTAGTGAGACCCTGTCTCTAATAAAAATGTATAAAAAGAGTTGGGGAT
GTTGCTCAGAGATTAAGTCCCTTTGGGTTCAAATCCTGATACCAAGGCGGGGGGACAAAG
AAATCTCTTCCCAAAGCCTACACACTCCAGAGGGAAGCACAGTTGTCTCATTTGCTGCTT
TGTTTGATGCATGGTAGCTGTTTAGTAAAGAGATACTTGTGGGGTGGGATAGGAATGCTA
GGAATTGTGGGGCAGCACAAAGTCTAGGGAGTAATACTTGAGCTGAAAAATATCACAGGT
ATGAGGTGTGAGGGCCACTGTAAGTTTAGCAGGGGAGATCAGGCAGCTTTGGAATTTGTA
GCTGAGCATTTATGATGTCTGCTTAACCTTCCAGACAAGGTGGTGAAGAAAGGGAAGAAG
GACAAGAAGACCAAAAAGACGGTGAGAAAATGAGGGTTGAGGAAGAGCAATGACTGTGGG
TGTTTCCAGGCAAAATAAATGGCCATACTGGGTATGGTGGTGCACGCCTGTATATCTCAG
CAACTTGAGAGGCTGAGGCAAGATACCATAAGTTCAAGGCTAGCTTCAGCAACTTAGCAA
GGCTCTAAAGCAACCCAGCAGAACCCTGTCTTAAAATAAAAAATAAAGAGGGGCTGGGAT
GTGGCTCAGTGATTAAGTGTACCTGGATTCAGTCCCTAGTACCATAAATAAATAAATGGC
TCTGTGAAGGTGGGTGAGAAGTCTATGAGGGGAGGAAAAAAACTTTTGTCAAGAGAGGGG
CCAGAGCCAGGTACATGTAGTACAGCTACTTGGAAGGCTGAGACAGGAGGCTTACTTGAG
CCTAGGAGTTTGAGGCCAGCCTTGGGGCAGTACAGGTGAGATCCCCATCTCAAAACTACA
ACATTAAAAATAAGGTATCCTCTGTTATTTTTGGGGTTTTTTGGTTTGGTTTGTTTTTTT
ACATTATTTTTTTGTGTGTGTGGTAGGGAGGTGGTGTATTGGGATTGAACAAAGGGTGGT
GGTGCACGCCTATAATCCCAGCAACTTGAGAGCATTTACCACTAACCTATACCCCCACTC
CTTTCCCCCCAGTGTATGCCTTTTTTCCCTTCCTGCCCCCCAAACAGGGTCTTGCTAGTT
GCCCAAGTTGGCTTTGAACTTGCAGTCCTCCTGCCTTAGCCTCCACAATTGATTGGGATC
ACAGGCATGCACCACTGTGCCAGGCCTTTTTTTTTTTTTTTTTTTTTTTTTAAGAAAATT
GAGAAGGGGTGAGGGTAGGATGCAGGGCCTGATTGGTCTTGGAGCCACACTGAATCATAT
CTTAACCCCTTTATAGTTCTTTGAGGAGCTGGCAGTAGAAGATAAACAGGCTGGGGAAGA
AGAGAAAGTGCTCAAGGAGAAGGAACAACAGCAGCAGCAGCAGCAACAGCAACAGGTACA
AGTGATAGGGGCCCCTAATCCTGGAGCATCAGGGGTCCACCTCCAGCCAACTCATCTGAT
GGGGAGCATTCCTTGGTGCAGAGAAACAGCAGGGGCCTTCATCCTCCCCTTTTCGTTTTC
TTTCAGCAGCAAAAGAAGAAGCGAGACACTCGAAAAGGCCGGCGGAAGAAGGATGTGGAT
GATGATGGAGAGGAAAAAGAGCTTATGGAGCGCCTTAAGAAGCTTTCTGTACCTGCCAGT
GACGAAGAGGAAGAGAGTAAGTGACCTGAGGGAAAGTAGGTACATGGATTCCTTGCGTGA
TGTGGAATGCCTCATATTTTGATTGTGGATGTGGATAAAATGGAGGAGCCAAGCAGAATT
CTCTTATCAACCTCATCTTTTCCCCTTGTCATTTCAGTACCTGCCCCAATACCCCGAGCA
GGAAAGAAGACCAAGGTGAGCCATTGGTGTGGTAACCAAAGACCCTAAACATGCAACTGT
GACCATCACATTGACTTTTGTGTCCCTTTTTTTAGGGTGGTAATGTTTTTGCAGCCCTGA
TTCAGGATCAGAGTGAAGAGGAGGAGGAGGAAGAAAAACATCCTCCTAAGGCTGCTAAGC
CAGAGAAGAATCGGATCAATAAGGTGAAAGTGATGCAGTTACACCCCATTCTGGCCACAG
TGTGGTAGTTTTCTGCTTTAAACTTAGCTGTTCTAGATTTATCTTATTTAAACTATCAAA
TCTATCTTTTAAAAATACTCTTTGATCAACTGGCCTGGTGGCACATGCTTATAATCCCAG
TGGCCCCGGAGGCTGAGGCAAGAGGATTACAAGTTCAAAGCCAGCCTCAGCAAAAAAGAG
AGGCGCTAAGCAACTCAATGAGACCATGTCTCTAAGTAAAATACAAAAAAGGGCTGGGGA
TGTGGCTTAGTGGTTGAGTGCCCCTAAGTTCAAATCCTGGTACAAAAAAATACTCTATCA
TTTAACAATCTTCAGTGATTCTCTTGCCTTAAATTCAAAATCTAAAACAAGGGCCCTTGG
CCCTTGCTTTTTCACTTGGGACTCTTCCTTTTCCCATCAGCCTGACCACATGTTGGCATT
CACTTTAACGATGTCAGTATTGAAGCCTTTGTACTTCATGTTGCTTCTTTCCCTTCCCTG
GAATCCTCCAAGCCCAACATCCAATACCTCTTCTCTAGATTCATCCTTCCAAGGAAGCCG
TCCATGCTGCATTGGTACCACCTACCCACTTTGTGCACTTGCCTGACTCAGAGTCCCTTA
GATTTACTGATGTTCTCTCACATGTGTTCTCTTCCATCCCCAACTTCCCCGAACCCAGGG
ATGCTTTACCACTGATTACATTGCCAGCCACTTTTAATATTTTTAAAATTTTTTTTTAAC
TATAGAGGGACACAGTGTCTTTATTTTATTTTTTTTAATGTGGTGCTGAGATTGAACCCA
ATGTCTCACACATGCTAGGCAAGCAATCTACCACTGAGCTACAACTCCATCCCCTTTTTA
ATTTTGAGACAAGGTTTTCCTAAATTGCTGAGGCTGATCTCAAAACTTGTGAGCCTCTTG
CCTCATCCTCCTGAGTTGCTGGAATTGCAAGCATGTGCTATCCTGCCCAGCTTTGCTGAT
GTTCTCAAGTTCTCTTTTTGGAGGCTTTTCTGGGTCTCATTTCTCGGGAGTAGTACTCAG
TATCGTTAACTGGAATACAATAGGCTCCCTAAAAATGCTTGTACTCAGCAGCAGAGCAAC
AAACTAATTTCTGTGTGTGCTTGTATCTCCTTCAGGCTGTATCTGAGGAGCAACAGCCTG
GGCTCAAGGGCAAAAAGGGAAAGGAAGAAAAGACGAAAGGGAAGGCCAAGGTGAGAGTGA
CCGACAGAAGGGGATACTGGGTCTCAAGAATTAGAGCATTTCACCATTCCTGTCTTTTCT
CAATTAGCCTCAAAATAAATTTGCTGCTCTGGATAGTGAAGAGGAAGCTGAAGAAGATGA
AATAATGAAAGAAAAGGAGCCTCCCAAACAAGGAAAAGAGAAGGCCAAAAAGTCAGAACA
GGTATTTATCGTGCTTGGGGGAGGTTTGGGGAAGGACTGAGACTCTGTGGCCCTTCTGGG
ATAGTTTTGATGGGGGGCATTGTCACTACCAGAGCAGACTTTTCTATAAAGGGCCACATA
GTAAATATTTTTGGCTTTATAGTTCACAAATGATCTCTGTTGCGTATTCTTCCTTTTTGG
TTTTTGTTGGTTTTAATTTTTTTGTATGTTACTAGGGATTGATCCAGTGGTGCTCTATCA
TTGAGCTACATCCAACTACCATTTTTATCTCACAGGCCATATAGAAACAGGCATCAGGTC
AGATTTGGCTCATGAACTGTAGCTTTTGGCTCCTGATCCAGAGAGGAAAGAGCCCTACGG
TTTATCTTAGTCAGGTCCAGATCTGCCATTCACTACCTGTGTGACCCTCCTACCTCTTGT
TTTCTCAGTTTTTCCATCTGGGTGATGTACAGAATTCTAGTGTTTTCTAGAGTTCGTATA
ACTAATGGTTTATTTATTTTTGATGGTGCTAGGGATTGAACACAGGACCTCTCAGACATG
CTAGGCAAGCACTTTTATCACTCTACTACACTCCCCTAACCCCGCTAAGTAGTTTCTAGT
TCTGAAGTTCTATATTCTTCACTGGTTGTACATTAGGGCTGCCTGATCCTCTCTTTGCAT
GTTAATGTATAAACTACAGAAATTTATTTGATACAAATGAATATCATTTAAAACTCATTT
ATTCCACCCTCAGTTATATTTTCTTAAAAATTGTATCTCTAGGTACATAAACATTGTTAC
ACTTCATATACTCATATTCATACCATCTGTGTTGTCCTATACTTAGTGGCAGAGACTAAT
AGAGTACTGCATGGAGAGCAAGGGGTGGGAGTGAGAATAAGATAGGATCCCAAGACCTCT
CAGGATTGTGGGTGAAGGAGGACAGAACCAGCTGTGGAACTGGGGCCAGGTGGGAGGGGA
GTAAGGTGGGTATGTATGATAGAAATTCAAGTTATAGAAGGGTCTTTATTTTTTTCCATC
ATCCATGCTTTCCACAGGGTTCAGAGGAAGGAGAGGAGGAAGAGGGAGAGTCTAAGGCAG
ATGATCCCTATGCTCACCTTAGCAAAAAGGAGAAGAAAAAGCTCAAGAAACAGGTAAGTC
ATTGGTTCTTAGTGGTCAAAATAAAGGTTTTTTTGTTGTTCTTTTTAATGATTTAACTAA
GGCATATGTGAAGTTAGGGACAAGGCAGGAGAGCTTTGGGGACTACTTGAAATAAAACAA
TTAGAGCAAGGAAAGACTTATGCTCTGAGCATCATCTTAATGCCTGATGACATGGGATTG
TATCATGATAACAGGAAACTGGCAATGTTACAGATGACCTCCAATGTAGTTTTTCCTTCT
CAGATGGATTATGAGCGCCAGGTGGCTTCATTAAAAGCAGCTAATGCTGCCGAAAATGAC
TTCTCTGTATCCCAGGCAGAGGTGTCCTCCCGACAGGCCATGTTAGAAAATGCATCTGAT
ATCAAGGTGAGATCTGAGGAGTCCCTGTCCATCCTGATCACCTAGGAAGGAGTGGGTTCT
CTCACCTGCCCTGAGTGGCTGTGGCAACCCTGGAAGTCGGGGTGTGAAAGGGCTGCTCCA
CCAGGAAGAAAATGGGAACGTATTTTCTGCATCTTGGGTTCTACCAACCTGAGCAAGGAG
ACAGAAAACACAGTGGAAGCAGAGGGGTCCACCTGGGGAGGGAAAAGAATAGGGTACACC
AACCTGGCTAGAGATGGGAAGACTCCGATAAGAGGCAGTAGCCTGCTATGGTGAGAAAAG
GGTGATTCTGCTGGAAGTAGGGGTTTGTCGATCTCCCCTATGGGGCCAAAGCTGTAGCTC
CTGTCCTAGAATGAGACTTCTTATGTTTTTTGACCTTCCCCTTTGCCCCCTGTCCCAATG
GCTGTAGCTGGAGAAGTTCAGTATCTCGGCCCATGGCAAGGAGTTGTTTGTGAATGCAGA
TCTATACATCGTAGCCGGACGCCGCTATGGGCTGGTGGGACCTAACGGGTGAGGAGATGG
GACTGGAGGGGAAAGAAGGGATTTCTCCATGTTGGCCTGATCCTCATAGCTCTCATTCCC
CAGCAAGGGCAAGACCACACTCCTCAAGCACATCGCCAACCGTGCCCTGAGCATCCCTCC
TAACATTGATGTGCTGCTGTGTGAGCAGGGTGAGCCAGTGTGGAGAGGGAGACAGGGTGG
GCAATTAGAGCAGAAGAGCCAGTCAAAAATAGAAGTTGTGGTTGTGAAGTTGGGAAGGAC
ATGAAGGAGGCTGGGGCCTGGGAAAGGGTTGCTAGAAAGACAGGAGAGGAGGATAAATGA
AAGATTTGAGAATATCTTATTTGGAATAAGTACAAAGTGCTGGGAGAGGTTAGGCAGACC
AGCACTGGATCTAAAGGGAAGAGAAAAATAGGTTCTGTGGGCCCAGAAGTGACCTGAGTG
TTGTCCCCCTGCCCTCCAGAGGTAGTAGCAGATGAAACACCAGCAGTGCAGGCTGTTCTT
CGAGCTGACACCAAGCGATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTGAGAGGCTAGAGAAGGTAGAGGAGATGGCACAGGGGAC
ATGGTCTGCGAGACTTGGGGGGAGGGGCCTCTAGGCCCTCAGACATGAGTCCTCTTCTTC
CTCCCAGGTATATGAGGAATTGCGAGCCACTGGGGCAGCAGCTGCAGAGGCCAAAGCACG
ACGGATCCTGGCTGGTCTGGGCTTTGACCCTGAAATGCAGAATAGGCCCACACAGAAGTT
CTCAGGCGGTTGGCGCATGCGTGTCTCTCTGGCCAGGTGGGCCATCTGCCTCACCATCTC
CCTTCCAACCCCAAACTACTAGGACCTTCTCACTTTTTCCCACTCTTTCAAGGCCAGTAG
GGAGTTCTGAGGTCAACTTCTCTCTTACTATGTACATTTTGAGACCTTGGAGTTTTTCTC
CATTTCTCTCCCTACCTGATGATATGTTCTTGTCAACATCTTCTGCCCAAAACCATCTCT
GAAGAGAGGTTAGGAGGGAGTGTTTGTTTTCATGGGCTCTGCCTCCCGGAGGCTTCTCTG
GGGTTTGCTGAGCAGGGATCTTCTTCCAGCCCTGACAGCACTGCCATTCTCTGCTCTAGG
GCACTGTTCATGGAGCCTACACTGCTGATGTTGGATGAACCCACTAATCACCTGGACCTC
AATGCTGTTATCTGGCTCAATAAGTGCGTTGCCCTGGGTTATGGCCTTGGGTCATTGGGT
TTCCATTGTGTACTTTACCCCATCCCTCCCTGCCCTCATTCCCTCTAGTTGTTGTCTGCG
ATGCCCTTGACACCTCCTGGTCCAGTCCTCCTCTTTTCCAGTCCTCCTCATTGTCTGTTT
GCTTTTCTGGACTTGTCTGTCCCTTCACCATTGTGACACTTCCCTACTTCTCTGAACCCA
GCTATCTTCAGGGCTGGCGGAAAACACTGCTGATTGTCTCCCATGACCAGGGCTTTCTGG
ATGATGTGTGTACTGATATCATCCATCTCGATGCCCAGCGTCTCCACTACTATAGAGGCT
ATTATAGTAAGTAGGATTGTTTGTGAAGGGCAGAGGGAGAGATTGACCCTCAATAGGTGG
CCTGGGTAGCAGGGTTGTAGGGGCATTGTGATAACTGAATCTTTATAGATTTCTTAACAG
TGATAGTCTTCCCCATCCTTGTCTATCCTCAGTTGTCCCTCTGCTAGAGAGAGGGACAAC
GTTGAAACTGCTCTCCTTTTTGCATGCTAGTGACCTTCAAGAAGATGTACCAGCAAAAGC
AGAAAGACTGCTGAAACAGTATGAGAGCAGAAAAAAAGCTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTTAGTGTAGATGGA
CAATACCTTTATTTATCTTTATGTGTGTTGAGGCTCAAACCAGTGCCTCACACATGCTAG
GCAAGTGCTCTACCACTAAGCCACAGTCCCAGCCCCAGCAGGGACCTTTCTTTTCCTCTG
AGGCCAGGACATTTAGGGTCACCTTTACAGTAACTGAAATGAGCATAAATTGCTTCATTT
GCTGACTTTCAGGTGTGACATTTGGCTATGAGGGGCAGAAACCACTCTTTAAGAACCTGG
ATTTTGGCATCGACATGGACTCAAGGAGTGAGTTGGTATAGGGTGGTTTGGGTGTGGAAC
AGGAGTCACAGGGAGAGTAGTTTTGGAGATCTCCTGGTTTGGTCATTTCTTTCTTTCAGT
ATGCATCGTGGGTCCTAATGGTGTGGGGAAAAGCACACTACTCCTGCTGCTGACAGGCAA
GCTGACACCGGTGAGTCCTGGAGCCAAGAAGGGAGAGTATGAGAAGTGTGATGGCCCCCC
TGTCCAATGGAAGCTAGAGTCAGGGAACCCCCTTGGTAGGGTGGGTTGAAAACCCCATCA
CAGATGATGCATCTCCCTAAGGAGTAATAGAGGAGGAGAGTGTAAATCAGTTTAGGGAAG
AGAGAAAGGAAAGCCTGGGTTGCAGTGGGGGTACCTCTCCATGTTGAAGAAGCCAATTTT
ACATGTTACAAAAAAAATACATATTGAGGCTGGGCATGATGGCACATGCCTGTAATCTCA
GTGGCTTAGAAGAAGGCTGAGGCAGGAGGATTAGGAGTTCAAAGCCAGCGTCAGCAAAAA
CAAGATGCTGAGACCCTATAAAATACAAAGTAGGACTGAGCATGTGGCTCAGTGTTGAGC
GCCCCTGAGTTTAATTCCCGGTACCAAAAAAAGAAAAAAAAAATACATAAGCTATGCATG
GGTTTGGATTTATGCCAGGCCCGTCCCCTGGGCCTCTAGCATAGTATCCCATGCCAGAGC
ATACTCCGACCCTAAACCATTGCCTGGCCTCTGTGCCTGTAGACTCCTAGTGTTGAAGCA
GGTTGCACAGTGGCAAAAAAAGAATTGTTTGAGCCAAGAGGAAAGTATAGATATGATTGG
TATTTCTGTTCTGGTGGATACCTTTCTCCTTTTTTTCCTTTGCAAAGATACATTAATATT
CTTATGAAGTGGGGTATCACATGAATTGTTATGAGCCTTCTCCAGATAACAATTAAGTGT
TTCTGTATGCTATTTATTATATACTCATACGTTTAGTTTATATGGTCTACCATAATTTAT
TTGGTAATAGGTATTTGCAGGACTTTTGCAGAGTATTGCCATATGGTGCTTTAAAAAGAC
AATAGCCTTTTCTCCTCTCCCAGTGGAGGGTAATCCCTTCCTGGTTGTCCTTTTTTTTCC
CCTTTATCGTTATTTTCCTTCTTACTCCTTTTGCCCCTTCTGATTCCTGGGTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCCAATTCTGGTGTTTTCTTTCAGAAAA
GTTGGGATCTGGCGATGCCAGGGATATAGCTCAGTTAGTAGAGTGCTTGCCTCACATATA
CAAGGCCCTGGGTTTAATCCCCAGCACCACAGAAAAAAGAAAAGTTGGGATCTGGAAGTG
CAGCCCCTTTTGCCCTTTCCCTACCCTTACCATTTGCTTTTTCCTTGCAGACACATGGGG
AAATGAGAAAGAACCACCGACTGGTAAGTTGACTTTGGAAATCAGGGACTGAAAATTGGG
TAGAGGAAGCACCACTTTGATTGGTTACCTCCCTTTCCTCTTGGGCAGAAAATTGGCTTC
TTCAACCAGCAATATGCAGAGCAGCTGCACATGGAGGAGACGCCCACTGAATATCTGCAA
CGGAGCTTCAACCTAGCCTACCAGGATGCACGCAAGTGCCTGGGCCGCTTTGGCCTTGAG
AGTCATGCGCACACCATCCAGATCTGCAAACTCTCTGGTACCAGTCCAGGGGCTGGGGAA
GATGCCCTCCTCATCATGCATGTACACACTGTTCCTAGAGCAGAAAGGAGAAGGAACCAA
GAAATGGGGAGCCTTAGGGCACACATGGGCACTCTTTGAGGGTTACCTTCAGCAGTGTAA
GATGGTGGGAGATATGATAGACTTCCTTTTTCTTCCTTCTTTTTAAATTTTTTTAGTTGT
AGATGGACACAATACCTTTATTTTATTTTATCTTTATGTGGTGCTCTACCACTGAGCCAC
AACTGCAGCCTTAGACCTCCTTTTTCTTTGTGACAGGTGGGCAGAAAGCCCGAGTTGTCT
TTGCAGAGCTGGCCTGTCGGGAGCCCGATGTCCTCATCTTGGTGAGAGAACTGAATGGGA
ATGGGAAAAGAGTAACAGCAGTGCAAGGTAGGAGTTGTAATGGCATTCTTCCTCCTCCAT
AGGACGAGCCAACCAATAACTTGGACATAGAATCTATCGATGCTCTGGGGGAGGCCATCA
ATGAGTACAAGGGTGGTAAGTCAGTTCTGAACATACCTTCCTTCTCCCATTGGGGAACAA
GCTGTAGTGTCCTTTGGCTGGAACTCCCTTCTGTCCATGTTCTGATTTTTCTTCCTCCTT
TCTCCCTGCCTTCTGTTCTCATCGTCTTTCTTCAAGCTGTGATTGTCGTCAGCCATGATG
CCCGGCTCATCACAGAAACCAACTGCCAACTGTGGGTAGTGGAGGAGCAAAGTGTTAGCC
AAATTGATGGGGACTTTGAAGACTACAAGCGGGAGGTGTTGGAGGCCCTGAGCAAAGTCA
TGGTCAATCGACCCCAAGAATGAGATTTCCCTCCTGGAAATCTCCTGAGAGACAGGCTTA
TGTGACCTAGAAGTACCCCCACTGTCTCCCTCTCCTTGGAAGCCTGCCTCTGCCCTGCAG
CTGACCCAGCAACCACTTGGGCACATGATAGTGGAGCTGTGACCAGGATACTACTTTGAT
TGCTTCCTTTGAAAGATTTGTGTGTGCAAATCTTTTCTTCAGACAACTGAGCTGACTTAC
CCGCAGCAGCCCTCTACACCAACAGAGGTGACCATCATTATCGTGGGGTTCCATCCAAGC
AAGCTTAGGTGGCCTCTTGTCTTGAGACTCATTCCTCAGAAGACTGCCTCTGATCCACCC
TAAAGCTTCAGGCCTAGCTGCCCCCACGGGTTTTGAGTGGCGCTTTTCTTTTTTGATGGA
TTTAATGCTGACTTACACAAATAGCCATTTGGACCTCAGAATTGGAGGCAGGTGTCTGAG
GCCTGTGCTGTTATCCAGCCTAAGATTTGGTGCCTGTGGTCACTTGACTGATTGGGGACC
TGAGGGCAGGAAAGGAAAGCTGCAAAACTTTAATTCTCTTTTACACAGGGAAGAAATAAA
GGAAAGGAGTTGCTGCTGCTGCCAAAAAAAAAAAAAAAAGAAAAAATGCTAACAGTTGTA
AATCCAGAGGGAGGAGAGACGGATGCTCGTTGAACCCTTCTTTGACCTATCTGGTATAAA
TAGAAATGTCCAAGAGAACAAAGTTGAAGGGGAAACTGATTCTGATAGTGTCTAAATAAG
AACAAAAGAAGAGGCTGGTGTCTTAGTCCAGTAAAACAGTATCTCTCACAGTTCTGGAGG
CTGGGAACGCAAGGTAGAGAGGCAGGCATCACCCAGGTGTTTGGTGAGAGCCAACACCTG
GTTCATAGTTGGCTGTCTTTTCGCCGTAAGCTCACATGGTGGAAGGAAGGAGGGAGCCTA
CTCTGGGGCCTCTTTTATGAGGACATTAATCCTGACCCTGGGAGCTGCGCTCTCATGACC
TAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1009, 1012..1072, 6574..6620, 7516..7614, 7746..7875, 8017..8054, 8135..8242, 9395..9469, 9547..9660, 10697..10792, 11043..11165, 11587..11687, 11763..11848, 12139..12197, 12201..12267, 13103..13116, 13207..13355, 13679..13762, 13981..14105, 14310..14344, 14347..14364, 14369..14419, 15299..15470, 16512..16586, 16679..16749, 18830..18862, 18948..19116, 19416..19480, 19562..19634, 19776..19942
1001..1009, 1012..1072, 6574..6620, 7516..7614, 7746..7875, 8017..8054, 8135..8242, 9395..9469, 9547..9660, 10697..10792, 11043..11165, 11587..11687, 11763..11848, 12139..12197, 12201..12267, 13103..13116, 13207..13355, 13679..13762, 13981..14105, 14310..14344, 14347..14364, 14369..14419, 15299..15470, 16512..16586, 16679..16749, 18830..18862, 18948..19116, 19416..19480, 19562..19634, 19776..19939
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved