Spermophilus_tridecemlineatus Locus SRCAP
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SRCAP
Spermophilus_tridecemlineatus
SRCAP
GeneScaffold_3621
SNORA30
7016..7144
31593
TTTTTTTTTTTAATTTGTAGTTGTAGATGGACACAACACCTCCATTTTATCCATTTATT
TCTTTGTGGTGCTGAGGATCGAACCCAGCGCCTCACACATGGTAGGCAAATTCACCACCA
CCAAGCCCCAGGCCCAGCCCCAGCCCCCAAGTGCATTACTTTTCAGACTCAATAGATCTA
GGTTTGTGAACAGTAGGGTTTTTTTTTGTTGTTGTTCTGGAGATTGAACCCAGGGGCACT
TAACACAAGCCACATCCCCAGACCTTTTTTATATTTTATTTAGGGATGGTCTTGCTGAGT
GCTTATGGCCTTGCTAAGTTGGTGAGGCTGGCTTTGAAATCACATCCCCCTGAGCCACTG
GGATATAGGCATTGCTACACACTGCTCTCTTTCTTTTGCCCTACAGTAGCCTTTAGGAGT
GTATGGATTTGATATCAGTTTTTTCTTTTCTTTTTTAAAATAACTTTTATTTTTTTTAGT
GTAGTGTTGAGGATTGAACCCAGTGCCTCACATATGCTAGGCAAGCACTCTACCACTGAG
CTGAACTCCAGCCCCTGTATTTGATCTTTAGCAATTGGTAAAATGTGTCACTTAGCTGAG
GTAGGAATTTGTTGTACTGTAAGGTTTGTGTGTTGGAGTGAAATTCATGAGTTCCCTGAG
GATTCATATTTTAGTAGAACTTTATTTTGTATATCTTATGCATTACTTTGTAAAGTAATA
TGTAGATGTTTGAGAACACTATCCATCTCCAACCCCACATCCCCAGTGTGAAGAGTTTTT
TTCTAGTGTCTCTTGATTTTAGTGGTAACTCAGATTTATTGCATAGGACTATAAAATTGC
CACTACCATCTTGAGCAACTTGTTAAAATTTCATCTTAATTTTTTTTTAAACGAGATTGA
TAATCTTATTCCAGAATTTTGTATGAAAATGGGATAGAATAATATACTTAAAACATTTAA
CACGGTACATTCATTTTCTTCATCATTTTTCCATTTTCTAGATGGTGTCGGACGGCATGA
CAGGCAGCAATCCTGTGTCCCCTGCCTCATCTAGTTCCCCAGCCTCTAGTGGGGCAGGCG
GCATCTCCCCCCAGCACATAGCTCAAGATTCCTCTCTGGATGGACCTCCAGGCCCCCCAG
ATAGTGCCACAGTGCCCTTGGAGGGGCTCAGTTTACCACAGGCTGCTGACCTGGCTAACA
GGGGCCCAAAGTGGGAGAAGAGCCATGCTGAAATTGCAGAGCAGGCCAAGCATGTATGTA
CTAAGAAAACTCATGAGAATTTTTAGGAGTCTTCTCTTAATTTCCATGTCCATGGGTATA
TGTATATTGTATAACTATTTCTTATGGATTTAGTATGGACTCTTTATTAATTTATATCAT
TTTGAGCAAATTGCTTGAGCTTGAATTTTTTTTTTTAAATAATTTTTTTTAGTGGTAGGT
AGACACAATACTTTTATTTTATTTTTATGTGGTGCTGAGAATTGAACCCAGTGCGTCACA
CGTACTAGACAAGCACTCTACTACCACTGAGCCATAACCCCAGTTCTGGAACTTGAATTC
TAAGCAATGTTTTGTTTTTTTTTTTTTTTGGAGGTGGGTCCTCACTGTGTTGCTCAGGCT
AGCCTTGAACTTGTGTTCCTCCTGCCTCAGCCTTCTGAATAGCTGCGATTACAGGCATGC
ATCATCATTCTTTTTTATTAAAATAGGGATAGGGATGGTGTGAGATTTACTGTAGAATTT
TTAAAAATTTTTTTGTACTGAGGATTGAACTTAGGGGTGCTTAAACACTGAACCACATCC
CCAGACCTTTTTTATATTTTATTTGGAGACAGGGTCTCACTGCCTCAGCCTCCTGAGTTG
CTGAGATTACAGGAATGCACTACTGTGTCTAGCTTCTTTGTCTTTCCTTTCTTCCTTTTT
TTCTTTCTTTCTCTTTGGTACCAGGGATTGAACTCAGGGGCATTGAGTCTCTGAGCCACA
TCCCCCAGCCCTATATTGTATTTTATTAAGAGACAGGGTCTCACTGAGTTGCTTAGTGCC
TCACTTTTGTTGAGGCTGGCTTTGAACTTGCGATCCTCCTGTCTCAGCCTCCCAAGTTGC
TGGGATTTCTTTCTTTCTTTTTTTTTTTTGAGCAGAGCTGGGATTGAGCCCAGGGTTTCA
CGAGTACTAGAGAGGTATTCCTCCACACAACTACATCCTGGCTCTGTTACGAGGTTTAAA
TTAAAGAAGGAATTAGACATGAAAGTGCTTTGTAAATGGTGATGCTCACGGGTTTGTACT
TATTTGTACTTATTATTTCAGTATTGCAACTTGTTTTATTTATGTAGTGGTATGTGGTCC
CTGGGAACTTGTTAGAGAAATAGGTTTTTTTCCTTTTTTTTTAAATATTTATGTTTTAGT
TGTAGTTGCACAGAATACCTTTATTTATAGGCAGTGCTGAAGATTGAACCCAGGGCCTCA
CACATGCTAGGCAAGTGCTCTACCACTGAGCCACAACCCCCAGCCCTGTCTTGGATTTTT
TAAACCACCGCTATTAAAACATTTCAGAGGGTTTTAATGTTTATCTTACTACAAATTTAA
TCAATGTAGAAATTTTAGTAATGATGACTATCTCATTGTATTTTTGTTATACTTAATCAC
TGTTAAATCTTTTTTTTTTTTTTTTTTTTGGGTGATGGTATGGATTAAACCCAGGGCCTT
GTATGTGCTAGTCAAGTGCTACCACTGAGCTACATCTCCAGCCCCCAGAATGACTTTAAA
TACAGAAAGATGATTGTGTAAATTGGGTTATGTACCATATTTATAATCTTAATACAGCTT
GAACATATCCTGAGGAAATAGAATTCTACAGTAATAAAGAGCCCTTTTATCTAGAGTTAA
GAAGTAAGCAGCCAGGCATGGTTTTATAGCCTGTAATCCCAGCTACTCAAGAGGCAGAAG
TGGGAGGATTTCAAATTTGAGGCTGGCTTCGGCAACTTCAACTCAGAAAAGACAAGACTG
GGGTGTGGGTATAACTCAGTGGGCCCTGGGTTAAATTTACAGTACCAAAAAAAAAATGAA
AGAGAGAAGGAAATCTACTTTCTGCTTGAAAAAACGTGTTTTTTCAAATTTCACCTGTGT
CCACAGGATGTGGAGATTGTGTGAAAGAATGGAAATCACATGAAATGTTGTCTGTAATCC
TTAGAACTGTTTTTTTTTTTTTTGGTTCCCAACTTTTACTATCTGGTTTTATGATTTCAT
ACAAATCATTTAATCTCTCTGATCTTTGTTTCTCCTCATCTGAAGATTGGCATATGGACA
CAATGTAAGCATAGCATACTCGGCTGGATCAATGCTCAGGAATTCAGTTATTATAATGAG
ATGGCCTGTATATCTAGGAGTTGTTGACCTAACTTTCCCTCATTAGGAAGCTGAAATTGA
GACTCGGATTGCTGAGCTGCGGAAAGAGGGTTTCTGGTCACTGAAGAGGTTGCCTAAGGT
GCCAGAGCCCCCTCGGCCCAAGGGCCACTGGGATTACCTGTGTGAGGAGATGCAGTGGCT
CTCTGCCGACTTTGCTCAGGAGCGCCGATGGAAACGGGGTGTGGCCCGTAAGGTATGTTC
TCAGTGGGGTGTACCTTCGATTCAGGTATGCTTTCCCTTAATGCGTAGCTCAGTTGGAAG
AGAGCCAAACAGAATGGTGTAGACATTTTTTTGATGCTTATAGAATTAAGAGGCAAGCCT
AACATCTTGTATTTCTTGGCCTTTGCTTTTGGTTGGATGGATATGGAGGTCTGGCTTTGA
GTGTTTTCACTCTGGGTCTTTATTCTTAGGTGGTGCGCATGGTGATCCGACACCACGAGG
AGCAGCGGCAGAAAGAGGAACGGGCTCGGAGGGAAGAACAGGCAAAGTTGCGCCGAATTG
CTTCCACTATGGCCAAGGATGTCAGACAGTTCTGGAGTAATGTGGAAAAGGTAAGTGATG
GGAATTGGAAAAAGGAAATGGTCATAGATCATGTTGGAGGATGGTAAGATAGTAGGAATG
ATGAAAACTTTCCTTGACAGAATGAATATTATAATTTCAAGGAACTCTTAATGACATTTC
TCTTGTGCATTGGGCCTTTTTAGCATTTAGTGCTGTGAGAAAGAAGGAAATATGGTGGCA
AGATAAGGGCCATGCATTTGGGGATTATTAATAGGACTCCTTGGCCCATTTGTTCTTCGA
AAGGCTTATAGTATGCTTTTACTTTCCTCTTCCTTTTTTTTTTTTTTTAATGTGAGTTCT
AGCTAAGTTGCTGAGGCTGGCCTTAGCCTTGAACTTTGGATCCTCCAGCCTCAATCTCCT
GAGTGCATTGGAATTACAGGCATGCACCACCACACCTGACTAACATGCTTTTTCTGAAAC
ACATTTATGTCATATATGTGTTTATTTTTCTTGAATGCCATCAAAATTCCCATTGCCTGT
GTGTTAAGTTGTAAATGGTTTCTCAAGTTCTGTCCTCCCTCAGTATCCGTAGGGAATTAG
TTCAAGCAAGTACCAAAACTTGGGAATGCTCAAGTCCAATATGTAAAAGGCCACAGTATT
TGCATATAACCTACCCACATCTTCCCATGTCCTTTAAAAAATATTTTTAGGGCTGAAGTT
GTAGCTCACGGGTAGAGCTTAGCACATGCAAGGTCCTGGGTTTGATCCTCAGCACCACAT
AAAGATAAATAAAGTATAGTGTTGTGTTCAACTACAATTAAAAAATAAATATTTAAAAAT
ATATTTCTAGATTACTAGTATGACACAAATGCTAGATAATTATTAAAATATTAACAAATG
CTTCACAAATAAAATAGTCTTTATAATGTATTCATAAATGCTACATAAGTCATGGTTACA
ATGTTTTGTTTAGAGAGTAACTATGAAGAAATACATACAAATTCAGAATTTAGTACATGC
CCAGTTTTGTAGAGATGACATCTCACTATGTTGTACAGGGTGGTCTTGAACTTAATGGGT
TCATATGATTCTTTTATCTCAGCCACTCAGGAGCTGGGACTACAGGCATGTGCCATCATG
TCTGACTGCAGTGCACTCTACCACTGAGCTACATCCCCAGCCCTTTATTTTTTTATTTTG
AGACAGGTTTCTCTAAGTTGCTGAAGTTAGCCTGGATGTTGTAATCCTTCCAAGTAGATA
GGATTACAATCATGCAACACCATGCCTGACTTGCTTTTTGCCCCCCCCCCCTTTTTTTTT
TTTTGATGCTGGGGAATTGAAGTTAAGGTCTTGGTCTTGCATGCTAAGTTCTTGCTCTGC
CTCTGCCACCGAATTGTACTTGCAGTGCTTTTTTTTTAATCTTTTTTTTTTTTTTTTTAA
TATTTATTTATTTTAGTTCTCGGCGGGCGAACACAACATCTGTGTTTGTATGTGGTGCTG
AGGTTTGAACCCGGGCTGCACGCATGCCAGGCGAGCACGCTACCACTTGAGCCACATCCC
CAGCCCTTTTTTTGAATCTTTTTTCATCTTAGTTTATACATCCTTCTGACCATTTTACAC
AAGATCTTTTTGCACCTGGGAAGACCTTTCTCATTTGTACTTAAGAAACATCTACTTTTT
TTTTTTCTATTCTATTCTGAGGGTTGAACAGGGCTTTTGTGCTCTGAGCTACCACAGTGC
CACATGTTTTAAGATATAGCTCCAGATTCATCTGTAAATCATCCCGAGCTGGTGAAGTCT
AAATTCTTCTATTCCTTCTATTCCTTTTGTGCTTCCCTCAGAAGTATCCTATTAAATCAT
GAGATCCTTCAGATTATTTAAGGGTTTTTCTTCTTTTTGGTTTTTTTTTGTAGCTTTGAG
GGTCAAACATAGGGCTTTGTGCATTGTAGGCAAGTACTCTACTATTGAGTTATACATCTC
AAACCTCCTAAAAACTATTTAGCTCTTCTTGAGTGGTCAGCCCAAGGTCTAGGATAGAAG
AGGCCTTCCTAAAGTTAGACAAAAGAGTATATACATGGTTATTTTGGTGAGCAGTCCCTT
TCATGATGGTGGCAGGTGGTGCAATTCAAGCAACAGTCCCGGCTTGAGGAAAAGCGCAAA
AAAGCCTTGGACCTCCACCTGGACTTCATTGTGGGGCAAACTGAAAAGTACTCAGACCTT
CTGTCTCAGAGCCTCAACCAACCACTAGCCTCCAGCAAAGCTGGCTCTTCCCCTTGCCTT
GGCTCTTCCTCAGCTGCTTCCAGTCCTCCACCCGCTGCTTCACGGCTGGATGATGAAGGT
GTGTATTCTCTTTGGCCCTGTTACTCTTCCCCTCATACCCTTTCCAGAGCTGAAAAACCC
ACCCTGTGGCTTGCAGGGCCCGTGGACTTTGTGACCTTGTTCTCCTGCTATAGATGGGGA
CTTCCAGCCCCAAGAGGAGGAGGAGGAAGATGATGAGGAAACCATTGAGGTTGAAGAACA
ACAGGAAGGCAATGATGCAGAGACCCAGAGGCGTGAGATTGAGCTGCTTCGACGTGAGGG
AGAACTGCCCCTGGAAGAGCTGCTCCGTTCTCTCCCCCCTCAACTGTTGGGAGGGCCTTC
TAGCCCCTTTCAAACCCCTTCCTCTCATGATAGTGACACACGAGATGGGCCTGAAGAAAG
TGTTGAAGAAGAACCTTCTCAGGTGTTGGAGGTATGGGAACAGGAGTTGGAGGGGAGGGT
TCAGAGTAGAAGAACAGGGAGAATTTCAGGTTTGAGTTCTGGGCTATGATGTTGGATGTA
TTTTTGAGAGTTCTCCCTGATTAAGGACAGTTGAGTTCTAATTTAGGAGTGGCTAGGAAA
GAATCTGGGTTTTAGCCTGCAGTTAGCAGTTTCTGTTATAGTGAAAAGAGTTTACTTACT
GTACTCTAAATTGCAGTTTGGTCTTATTTTGGCTATTCCTTGTCACTTCTGTGAAATGAC
CATAATACTCCTTGTATTAGTTTGTAAGTTGAGCGTTGGGATGGTCACCTTGAAGTCTTC
TCTGGACCTGTGTGCTGTGTTTATCCATACGTCCATTTGTTGGGGACTATTACTTCCTAG
CACTTTCACAGATCCTGCCCCAGCAGTGGGGACAGGATTTGGTAGCTGGGGCTGAGAGAA
AACCCTTGATTGCGTCCTTGCCCCTGGTACTGTAGCAGTAGCAGGTGTTACTCATTGGAA
CAGAGATCATTTTGTGATGTCTTACTCAACATTGTACCTTCCTCTTGCTCTTCTAACCTC
CTTTTCATCCATTTAGGTGAAGCCCCCACCTTCCTCTGTCACACAGCGCAACAAACAACC
TTGGCATCCAGATGAAGATGATGAAGAGTTTACTGCCAATGAAGATGAAGGTTAGCCCTA
TTCTCTTAATCCTCTTGCCCCTTACCCCTTGAATAATGTTTGGACCTAACCTTTCAGGCT
TTCTCATTTCTTCTCTTTGAACTGTCTTGTGTCTCTTTCTTGATCCTGCTTCATTCTATC
TCCTAGCGGAGGATGAAGAGGATACTATAGCAGCTGAGGAGCAGTTGGAAGGGGATGTGG
ATCATGCCATGGAACTGAGCGAGTTGGCTCGAGAAGGTGATAGTCCCTTGGTATTTTACT
GAGCATCCACTTGATGCAGAGGGTCTAGAACAGAGCAATGAATAAGATACTTTTTTTTTT
TTTTAACTTTTAGTTGTCATTGAACCTTTATTTTATTTACTTATATATGGTGCTGAGAAT
TGAACCCAGTGCCTTGCACATGCTAGACAGGCGTTCTACCACTGAGTCACCACTCTAGCC
CCCCTAAAATATTTTTTATTTCTCTGGTGTAACTCTGGGTCTAATGGTAAAGGTAGAATT
ATAAAGGAAAAACGAAGTAGAAAGTGCTGAATACTCATAGTGGAAATTTGAAGCTTGATA
TTGGAGTTTAGTGCAGGGAAGAGCTGCTTTAAAAGGATATTGGTGGGGCTGGGTTGTAGC
TCAGTGGTAGTGCGCTTGTCTGGCATGTATGAGGCACTGGGTTTGATCCTCAGCACTGCA
TAATAAAGGATATTGGCAATATTTGACCTGAATCTTGAAAGGAAGTTTACCAGATTGATA
ACATACTTCTCAGAAGAAGGCAGCACCACCATGGTTGTATCCCAGGTTGGACTTGGCTTT
GGTAGCTGGTACTGAAAAGTACACTCTTGTCTTCCTTTAGACTTGGGCCTAGTAATGGTT
ATAGAGTTCTAGATAAAATGAACTGATAACACTTAAACCCTTTCTTCCTCCCCTTCAAAG
CAACCAGGAACATACCCTTTATTTGATCACCAGGTGAGCTAATTATGGAGAACTGTTGCA
GCAGTATGCAGGAGCCTATGCCTCTGATGTCTCTGCTGTAGGCTCTGGGAAGAAGTGAAG
AAGAAGATGAAGATGAGGATGTTGAGGCTATAGCCTGAATGTGAACTAGAGGGGTCCACA
GAAGCTGGAGAAGCTCCTCAAGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAGGATAGTAGCAGTCAGTCAGGTAAAGGTGTGGTCATAAGGCAGGAACTGGTGA
GGGCAGGTGTTGGAGGACAGTTATGGTGAGCACTAAGCCTTGGTCTTTTGATTTAGACTC
TGCTGAGGAGCAGAGTGAGGATGAGGAAGATGAGCATTCAGAGGAAGAAGAGACAGGTGG
GAGTTCAGAATCGGAGGAATCTGAATCTGATGAGTCTGAAGATGCTGGATCACAAAGCCA
AGCAGATCAAGAGGAGGAGGAAGATGATGATTTTGGGGTTGAGTACTTGCTTGCCCGTGA
TGAAGAGCAGAGTGAGGCAGATGGAGGCAGTGGGCCTCCTACCCCGGGGCCCACTACCAC
TCTGGGCCCTAAGAAAGAAATTACTGACATTGCTGCAGCAGCTGAAAGTCTACAGCCCAA
GGGTTACACCTTGGCCACTACCCAGGTATCCCCAGACCCATATTCTGCTTTCTCATATCT
GAACTATGGTTTTCCAGTGACAGATAACTCACTTCAACTATGGTGATTCTTTTTTATTTT
CTCTCCCTGTAAGGTAAAGACACCTATTCCCCTGCTCCTACGGGGCCAACTCCGGGAGTA
CCAACACATTGGGCTTGACTGGTTGGTTACTATGTATGAGAAGAAGCTTAATGGCATTCT
TGCAGATGAGATGGGACTGGGGAAGACAATCCAGACCATCTCCCTGCTTGCCCACTTGGC
CTGTGAAAAAGGTAAGTAGCAGGGAGGTCCCTTTCTGGGCCCTCTTGGCCAACTCAGTGA
GAGTTTATTTGGTGGTGACTTGACCTGCAGGAGAGTGAAGTACTTAATTTGACTCTGGTT
AATAACCCTGTAGGGAGAACAGTGTGGGTTCTAGAATTCTTAGGAAGGGCTATTAGGAAA
GGGTGGTCAGGGTTATATCTTAGGAACCAGAACTGCAAAGCTTACTTATCCTCACTATGT
CTTAATTCTTTTTCTAAACAGGTAACTGGGGTCCCCACTTAATCATTGTTCCTACCAGCG
TGATGTTGAACTGGGAGATGGAGTTGAAACGTTGGTGCCCCAGCTTTAAAATCCTTACTT
ACTATGGAGCCCAAAAAGAGAGGAAGCTTAAGCGGCAGGTTCGATCATCCATGTGGTTAC
TTTCTTATATTGATGCTTTCTTCAGTTTTGGCCTTTTCCTCAGATAAAGTCCCTCTTTCC
TCTTCCTATTATTCCATCCTCTTCCAACCTGACTTCTATCCCTTGAGGACCTTAACTTGT
CTTCCCTTAGTCCTCTTTGTTTTCTTTTCATTCCACACACTATGACTTTCTCTCTTATGT
CCCTCAGGGCTGGACCAAGCCCAATGCCTTCCATGTGTGTATCACATCTTACAAGCTGGT
GCTGCAGGACCACCAGGCCTTCCGCTGCAAGAACTGGCGCTATCTCATTCTGGATGAAGC
TCAAAACATCAAGAACTTCAAGTCCCAACGCTGGCAGTCATTGCTGAATTTTAATAGGTA
CCGATTGAGATGGGCAGTTGTGAGAGGATTGGCTTTACCTGAAGGATGAACTACTGGGTT
GAGGAGTATATTAAGGATACTTAGAAGGTTGGAACCTTGCTGACCATTCTTCCTATTCCC
TTTGTCTCTTTGCAGCCAGAGGCGCCTGCTCCTTACAGGAACTCCCTTGCAGAATAGTCT
CATGGAGCTGTGGTCCTTGATGCACTTTTTGATGCCCCATGTCTTCCAGTCTCATCGTGA
ATTCAAGGAATGGTTCTCTAACCCCCTAACTGGCATGATTGAGGGCAGCCAAGAGTATCA
TGAAGGATTAGTCAAACGCCTCACAAGGTAGAGCCTGTAGTAGTTCCCAAGGGTATTGGT
GAAGAGCTCAGGACAATAACCAGAAAATCCTGGTGGGGAGAGGGAAATCTGCACTAGGCT
GAACTTGTCAAGCAGTAATATGCTAGTGACTCACCCATTATTAAATAGAGTGACTTCACT
TGAGTCATCATTCTACTTGTTTTGAGTGGGGATGTTTTTGTCCTTACTTTGTTTGAATGA
AATGATACTGTCGGGGCTGGGTTTGTGGCTCAGTGGTAATGCGCTTGCCTTGCATGGGTG
GTCCTTAATTTTCTTTTCAGTCTGTGTATCTCATATGCATTACCATTCCCAAGGCTATGT
GATAATAATTCTTCAATTACAACACCTTGAGTTTCTAGATCTCTTGACCTAAATTTTAAT
TTCTATCTTTAATTAAAAGTTCTTCTTTGTGGGGGAGAGTGCTTTGGTGCTGGGAGATAA
ACTGAGGGTCTTGTGAAAGAAGCAGATACTCTGTCACTAAGCTACATCTACAACCCAGAA
AGTTTCTCTTAAATTCACTCTTCTCTCAGCCAAATATCTGTGGCCTTTACATCCTGTTAT
TTCTTAGCCAAATATTGCTAATAATTTATTTTTCTTTTTTTTTTAATATTTATTTTTTAG
GGCTGGGATTGTGGCTCAGCGGTAGAGCGCTCATCTAGCACGTGTGAGGCCCTGGGTTCA
GTCCTCAGCATCACATAAAAATAAATAAGCAAAATAAAGATATTGTGTCCAACTACTTCT
AAAATGTAAATATTTTTTAAAAAATACTTTTTAGTTTTAGGTGGACACAATATCTTTATT
TTTTTGTGGGGCTGAGGATTGAATCCAGTGTCTCATGCATGCCAGGCGAGCACGCTACCA
CTTGAGCCATATCCCCAGCCCCAAATAATTTCTTGGTCAGTTACATTGTTTTATAAAACC
AAGCTAGAAATCAGGAAATCTTCCTTAACTACTACACTTCATTTCTCTTTCTTCCTTTAC
TTCTCCATGTCACTAGAGATATGGAAGATTGTGTTCTCTATGAACTTTTTTATATACTGA
GATAAAAGATTTGTTTTTTTTTATTCTGCTTTAGTTTTAGTGCTGAGGTTTGAACTTGGT
GCCTCATGCATTCTAAGTACGGACTCTGCCAATGAGCTACACTCCCAGCCCCAAAGCCAC
AATATTTATTCTCAGTTTCTCTCCTGGATTTATTTTTGTAATCTCGTAAACTAACAGTCA
CTCCTTGAAATGTAGTTTTAGTCATCTCTTGTGTAGGGTTGGTTTGTTCTCACTGCTTCC
TCATGTATCTTTATTTTGGTATGGTTATCTTTGTCTCCTTCATTGGATAATGAATTTCTT
GAGAAGAGGGCTTACTTCTAATTTATTCTTATCTGACTGGTATATGGCATACTGCATGAC
TCCATGATAGTTAGCTGGTTAAGTCAGCACTCACCTGGCATGGGGCCAAGACCCAGCTAG
AGGGGCTAGGCTGGAGCTTAGTACCCACTGTCTCCTGTCAGCCTCCTGCTTATTTGCTTT
AGGTTTTACGACCTTTCTTGCTGCGCCGAGTTAAGGTGGATGTCGAGAAGCAGATGCCCA
AAAAGTATGAGCATGTTATCCGCTGCCGACTCTCCAAGCGTCAGCGCTGTCTTTATGATG
ACTTCATGGCACAGACCACGTAAGGGAGGACTGAGGGTGAGCCCTGGGACCCTGGATTGG
AGTGCAGATGGCTGTCAGAATGTCCCATTTATTTTTCTTCTCTCCAGAACTAAGGAGACA
CTAGCCACAGGCCATTTCATGAGCGTCATCAACATTTTGATGCAGCTGCGAAAAGTCTGC
AATCATCCAAATCTATTTGACCCTCGACCTGTTACCTCTCCCTTCATCACCCCAGGTATC
TGCTTCAGCACCGCCTCTCTGGTGCTAAGAAGCGCACTGATGTCCACCCGCTCCAGGTAA
GTAGTTGCCCCCAAGGTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCTCGGCCCTCCTGATAGCTGCTTCTCTCTCTTTCTCTTTTCCCTTAACCCAGGGAATGT
GGTGCACTTGGTGTCAGCAGGGGGGCAGCACCACCTCATCAGCCAGCCTGCCCATGTGGC
CCTCATCCAGGCCGTGGCCCCGACCCCTGGCCCCACCCCTGTCTCTGTGCTGCCTTCTTC
GACCCCCAGCACCACCCCTGCCCCCACTGGCCTCAGCCTTCCGCTTGCTGCTAACCAGGG
TGAGGCTCCTGGCCTTCTTACTTAGCCCTTGCTGGCCTTGGTCTTTCCAGATGTGTCCTG
GGCTATTGTCTGTCCAGCCTTCCCTTGTTGTTTTCCCTTGCCAGCATCTTCAGTATCTGT
CTGCCACCCTCTCCTGCCCCTATTGGGGACTTCTTCCATCCTTTGGGTCTCTTGTTTTTT
TTTTCTACCTTCCTCTCAATGTAGTTTCCTCTTGCAGTGCCACCATCCATGGTGAATAAC
ACAGGCGTGGTGAAGATCGTAGTGAGACAGGCCCCTAGGGATGGACTGACTCCAGTTCCA
CCACTGGCACCAGCACCCAGGCCTGCGAGTTCTGGGCTTCAAGCTGCATTGACTCCACGC
CCCACATTAAGCCCTGGTCGGCTATCCACACCTACCCTGGGTACTGCCCGGGCCCCCATA
CCTGCGCCCACTCTGGTGAGGCCCCTTCTCAAGCTGGTCCACAGTCCTTCACCTGATGTC
AGTGGTGAGTCCAGATTACTGATGCTAGGAATAGAAATGCGATGGGGTGGTCTTGAAGGT
TTCTTGGTCACAACAGAGCCCCTTGTTATCAGCATGCTATCTTAGTTTGCACTGGGCTCC
AGAGTGGGCTGCCCAAGCCCTAACTTAATTCCAAGATAAATTTATTGCTTTTTGAAGGAG
AGGAAATAAAGTTGTCCTGTTCTTTTAATTTTTGGTGTTATGTTGTGGGAGTGATGGCTT
TCTGGGAAATAGGTTAAGTTTGGGGTAAGAGATCAGGAAAGTAATTTTAGAGCTAATTTG
TCTTCTGTCTCCACAGCTTCAGCACCCGGAGCTGCTCCCATGACCATCTCTTCTTCTCTC
CATGTGCCATCCTCACTTCCTGGGCCAGCCTCTTCTCCAATGCCAATTCCCAACTCCTCT
CCCCTAGCTAGTCCTGTGCCCTCTACAGTTTCAGTTCCACTGTCATCTTCACTCCCCATC
TCTGTTCCTTCCACACTTCCCACCTCAGCCTCAACTCCATTAACCATCCCCATTTCAGCC
CCCTTGCCTGTTTCGGCTTCAGGCCCAGCTCTCCTGACCAATGTGACTCCAGCACTGGCA
CCCGTTGTTTCAGTGTCTCCTGGACCTCCCTCTTTGGCACCAGCTGGGCTTCCCCAACAG
CATCAGCCTTGACTCTAGGTTTGCTACACTCCAGCCCTGTCCCCACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACTG
TCTGAGAGTTTCAGTTCTCCACATTTTCACCAACCACCTACTTGTTTTTTTTTTTTTTTT
AATTACAGCCATCCTAGTGGGTTTGAAGTGGAATCTCATTGTGTTTTTGATTTACATTTC
CCTGTTGGCTAATGCTGAGCATCTTTTCATGTGGTTTTGGCCATTTGTGTATCTTTGAAG
AAATATCTATTCAGATCTCTTGGCATTTTTAAATAGAGAATTTGACTTAATATTGAGTTG
TAAAAATTCTTTTAATATTCTGGTTGCAAGTCCCCTTTCAAATGTCTGGTTTGCAAATAT
TTTCTTTTGCTACTGTTTTTCCCTCTATTAGGACATTTTTCATTCCTCACTTAGTACCTC
AAGCTAAGGAATAAAGCTTAAGATAGCAGTCAGAAAGAAATATTTGGGGCACTGCACTGC
TTTTTCAAGAACAGATACTGTTCATTTTATGTGGATCTTGATAGTTTCAATGAAGACATT
AATTATGCAAATGTAAAACTACAAGCATGGTAAGTGCTTTTACAAAGGAGAATTTGATGG
TTTTATAGACTGTGAAACTGGAAGCCAGAGATGAAAAAAAATTGAATCAAAGTCATACAG
GTCTTGTGACTGCCTTTTTTCCTCTCCTGAATATATGGTTAGCAGTTTCTATCCTACCCC
ATTTCATTCTGGTTCTTGGCAAAAATCTGCTGTGGATTTGATTAACCAGTTTGTTTCTGG
GTCAGTGATTTGAAGAAGGCTTCTTTTTTTTTTTTTTATGGTGCTGGGGATTGAACCCAG
GGCCATATGCATGTGAGGCCTGGGCTATATCCTCAGCCCAAGGCTTTTTTTTTATTTTTT
ATTTTTTTATTTTTTCAGTGCTGGGATTGAACATGCTAAGCAGGTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCTA
AGCAGGTGTTTCACTACTGAGCCATACCCCCACGCCTCAAGGAAGCCTTCTAATGTTTTG
GACTCACAAGAAGATGAAATGAGTTCAGTGTTACATAGGAAAGTTCTCAAAAATCATTCG
TGTTACAATCTGTTGGATATTCAGATCTTTTTTTTTTTTTTTAAAGAGAGAGAGAATTCT
AATATTTATTTTTTTAGTTTTTGGCGGACACAACATCTTTGTATGTGGTGCTGAGGATCG
AACCCGGGCCGCACGAATGCCAGGCAAGCGTGCTACCGCTTGAGCCGCATCCCCAGCCCC
GGATATTCAGATCTTAATTTTGAATATTCAGGCATTCTGCTTTGGTAGCATACAGGGAAA
GATGAGTTATCTTTTGTAGAGAGAGATTTATTTTGTATAACATTAAGAAAGGAATACTTG
TCATTAACAGCTTGGATAACTTCAAAAAGTATAGTATAACTTTTTGGATCTCATGGTTTC
TGTTTCCACTTGGGGAGAACCATCAGGTTTTCTGTAATTTTTTTTTTTTTTTAATGAACT
CTTGGGGATACTGATTACTTTCTCGGTTTTGTTCCCATCCCTAGGAGTCTCTGGAGGAAA
AGCGGAAGCGGCAGAGGTCTGAACGCCTGGAACGGATTTTCCAACTTAGTGAGGCTCATG
GGGCCCTGGCACCTGTGTATGGGACTGAAGTCCTGGATTTCTGTACCCTGCCCCAACCTG
TTGCCAGCCCCATCGGCCCTCGTTCTCCTGGCCCCAGCCACCCCACCTTTTGGACTTATA
CCGAGGCTGCCCACCGGGCTGTACTGTTTCCCCAGCAGCGACTAGACCAGCTGTCAGAAA
TCATTGAGAGGTTGGCAGGGCTAAGTCCTAATGGGGAGTGGATATAGAGGTTAGGGCTGG
TGAAGGTGCTAACTTTTGGGATTTTTCAGAGTCCCATTTTTTACACTACTTGCCTTCTTC
CTTTTCACAGGTTCATCTTTGTCATGCCTCCTGTGGAGGCACCTCCCCCTTCCCTGCATG
CCTGCCACCCACCTCCTTGGCTGGCTCCTCGGCAGGCAGCCTTCCAGGAGCAATTGGCCA
GTGAGCTCTGGCCCCGGGCTCGTCCTTTGCACCGTATTGTATGTAACATGCGCACCCAGT
TCCCTGACTTGAGACTCATCCAGTATGATTGCGGTGAGTTCATTGGCTAGTGCAGGACCG
TTGACCTCTTACAGCAGGACTGTTACATCAGAGGACATGTCCCTCAGAATTTCTGTACAT
TATAGGCAGTTTTTTAGATTATGCTTATAAGCAAAATGGGGAATTGTAGGCTCTTTAATG
GATTTATGGCATTCATGAATTTAACTTCCTTGAAAGTATATACTGCTATTTCATTTATGC
TCACAGTGATTGTTTTGTGAACATTTATCATATTTTACAAATTATTTGGGACCCAATATT
GAGTGAGTCTACGTAGCATAGTTTTTAAATTTATGGGGAAAAGGTATTTGGTGGTAAATA
ATTTGCCAGGTATGGTTGGCATACACCTATAATCCAGCAACTTGGGAAAACTAAGGCAGG
AGAATCACAAGTTTGAGGCCAGCTTAGCGACTTAGTGAGACCCTGTCTCAAAAATAAGAT
TGGGATATAGCTCAGTGCTTCTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACATCCCCAGTCTTTTTTTTTTTTTTT
TTTTTAACTTTTGATAAAAAATGTTATTGGGCTTGGGTCGTAGCTCAGTGGTAGAGTGCT
CATCTAGCACATGTGAGGCCCTGGGTTCAATCCTCAGCACCACATTAAAAAATAGGTATT
AATTAATTAATTAATTTATTTATTTATTTTGAGACAGGGTCTAAGTTGCCTAGGGCCTTG
CTAAGTTGTTGAGGCTGGCTTTGACCTTGTGATCCTCTTGCCTTAGACTTGAGCTGCTGA
TATTACAGGCATGTGCCACCATGCCCAGCTCAGTAAATATTTTCCTAAACACATTTTAAA
CATTTGAAACCAGAGTGATGAATTGAAGGCCTTTGTTAAAAGTGGTAAAACTGGCCAGGT
GAAATGACACATGCTTGTAATCCCAGCAGCTTGGGAGGATGAGGCAGGAGGATTGGGGAG
TTCAAAGCCAGCTTTAGCAACTTAGCAAGGCCTTGAGCAACTCAGTAAGACCCTGCCTCT
AAATATAAAAAAAGGCCTGGGAGTATGGCTGAGTAGTTGGTGGCTTAGTGCCTCCTCCTG
AGCTGGTGACATGCCACCATACCTGGCTACCCTTGATTATCTCTTAACCACAGCCTTGAG
TATTCTGCCATTCCAGCTTGTAGCTAGTTCCTTGTACCCCTTCATATTTCTTCAGGAAAG
TTGCAAACCTTGGCAGCACTGGTGCGGCAGCTCAAGGCAGAGGGCCACCGGGTACTCATC
TTCACCCAGATGACCCGGATGGTGGAAGTTTTATAGGAGTTTCTCACCTACCATGGCCAC
CTCTACTTGGGGTGGATGGGGCTACTAGAGTTGAACAAAGACAGGTAACCCAGGCATCTG
TAGGCCGTTAAAGGCTCCTCAGCATCTGTCTCTTTTCCTAAACCTTGGCTTCTAGAAGGG
CGCTCCTTAATCCCTAAAGATGTGGGGGAGAAGGTTCGCATACCATCTTTTCCGCTTTCC
CTCTAGCCTGATGGAACGGTCATGCAACAAACGATATCTGGTCATCCTTTCAATCGAAGG
GGGGTGGGCGGACCTGAAAAGAGCAAACTGGTGTTTTTANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGG
GGTTACTTTGATATATTTGGCTGTTTATACCTGGCCTCCATCTCCTAGACTTATCAGTGA
ACGGACAGTAGAAGAAAACATCCTAAAAAAGGCAAATCAGAAGAGAATGTTGGGAGACAT
GGCCATTGAGGGAGGCAACTTCACAACAGCCTATTTTAAACAGGTACAAAGTAAGATCTT
TCGACATAAGCAGAAGAAATTGCTCTGCTAGTAGGAACTCCTCCTGCTTATTAAAAGTTG
CTGCTTTGGTCTTCACAGACTACTTTTCACCTAGTGGCACCTCTGATATTTTGGGGAGCT
ATCAGTCTCACAGTTGTAGACCTAGGACTAGCATTCTATTGGCTGACACTTTTCCTTCTG
TCCAATAGCAGACCATCCGAGAGCTGTTTGATATGCCTCTAGAGGAGCCATCTGGCTCAT
CTGTATCCTCTGCCCCTGAGGAGGAAGAGGAGACTGTGGCCAGCAAGCAAACCCATATTC
TGGAGCAGGTGAAAAAAGAGTGGGCAATCCTAAAATAGAGCTATGGCTTGAAGTATAACT
TGTCTTTTATAAGTATGTTGACTTTGGGGGAAAGAATTGTTTCTGTTGCTTTCCAGACTA
TAGTCAGCCTTTGATAGTTTTAAGTTAATTAAGTTCACATTATCTAATAAGGAAAAAAAC
AAAACAGGATTTGTAGTTCTGAGTCCTAGGTTTGTGTTCCAGCAATGCTGTCACTTTTTT
AAATTTTATTTTTGAAATAGGAGTCTTGCTGTGTTTCCCAAGCTGTTCTTAAAACTTTGG
GCTCAAGCTATCTTCCTACTACAATGGTAGTGCTTCTTAATTGCATTTATTAAGCCAAAT
CACAAATTACTCTTTTGAGCCTTACTTTCTACCTAGTATGAATGGGTAGGAAATAGTAAC
TTTTAGGATTAAGTGATGTAGTGCATTTAAGAAGTACCTTGTATATGATGCAAAACTCTG
TTTTCTAAGCATTGAAGCATAACAGAGTCTCTTAGAAAGGTTTTTTTGTTTTTTAAATAA
CATTCTTATCTGGCTGGGTGTGGCAATGCACACCTATAATCCCTGTGGCTCTGGAGGCTG
AGGTCTGAGATCATGAGTTCAAAGGCAGCCTCAGCAAAAGCGAGGCACTAAACAACTCAG
TGAAACCCTGTCTCTAAGTAAAATGCAAAATAGGACTGGGGATGTGGCTGGTGGTTAAGT
GCCCCTGAGTTCAATCCCTGGTACCCAAAAAAGGAAAAAAAAAAATAGTATAGAGCACTA
TACCGTTGGACTACATCCCCCACCCTACCCCCTTTTAAAAATATATTTTTAGTTATCAAT
GGATCTTTTTTTTAAATTTATTTTTATGTGGTACTGAGAATCGAACACAGTGGCTCACAC
ATGCTAGGCAAATGCTCTACCACTGAGCCCCATTCCCAACCCTTTTTTTAAAATTTTGAA
ACAGTTTCACACTAAGTTGCCAGGCTGGTATCAAGCTTCTGATCCTCCTGTCTTAGCTTC
CCTGAGTATCTGGAATTAATAAGTGTGCACCATTGCATGTGGCTGGGAAGGCTTTTGAGG
GCTAGGGATGTAGCTCATTGGTAGAGTACTTGGGCCTAGCTGTGGGTTCAATCCCCAGCA
CTGCCAAAATTAAAAAATTATTCCTGGGCCCTAACTCAAAATTTACTAAATTGAAAACGA
TGTTGCATCTGAGCATTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCATCCTTTGCAATGGGGAGGCATTAAGCAACTCAGTGAGAC
CCTGTCTCTAAATAAAAAAATAGGGCTGGGGATATGGCTCAGTGGTCAAGTGCCCGAGTT
CAATCCCTGGTACCAAAAAAAGAAAAAAGGCTGGCTGTTCAATCCCAGTACACCTCCACA
TACACATAAAGTGCTGTTCAAGCCAGGCACGGTGGTGCACACCAGTAATCCCAGTGGCTC
ACAAGGCTGAGGCAGGAAGATCACGAGTTCAAAGCCAGCTTTAGCAATTTAGTGAGGCCC
TAAGCAATCCAGGAAGATTCTCTGAATGAAATATAGAAAAAGGCTGGAGATATGTGGCTC
AATGGTTAAGTGACCCTGGGTTCGATCCGTAGTTATCAAAGGGGGAAAAAATGCTGTTTA
GATCTTTCTGTGACTACTTGTTTGTCTGTCTTTGGTTAGGCAACTTTGAAGTTGACACCT
AAGGAAACAAAGTAGAGTTAATAGAGTCTCTCCAAAATAGTTGTTTTCCCTATTGGGAGA
GCTAGTAAAATCTATTCCATCTTAAATGAACTATTGAGTTGCTTTGGTAACTCTTATGAT
CCTAGATGGTTGAATTCTTGTGAACCTTGTTTTATGTAAACCTGGCCTCAGATTTTTGCC
ACAGTTAATTCCTAGGGTGTAAGCTTCTTTAAGTCTTAATGTTTTTTATTTTTATTTTTC
CTCTGTACCCTCTTTAAAGGCATTGTGTCGGGCTGAGGATGAAGAGGATATCCGTGCTGC
CACCCAGGCTAAGGCTGAACAAGTGGCTGAACTTGCAGAATTTAATGAGAATGATGGTTT
TCTTGCTGGTGAGGGAGAGGAGGCTGGTCGGCCTGGGGCTGAGGATGAGGAGATGTCCAG
GGCTGAGCAGGAGATTGCTGCCCTTGTAGAACAGGTCAGTGTTGAACAGACCCATTAGTT
CTTGCCTTTATCCTGTACTCAGGACCCTTTTATCTGTCTTCCCTGAAGATAATAGATAAG
GGTGCAAGAGCCCAGGTCCTATGTTCATCACATCTGCTCTTCCCTGCAGCTGACCCCCAT
TGAGCGTTATGCCATGAAATTTCTGGAGGCCTCGCTTGAGGAAGTGAGCCGAGAGGAGCT
TAAGCAGGCAGAAGTAAGTATCTCTGGGGGCTGAGACTTCCTGCTGATTTCTATATATTC
CTTGCTCTGCTTGCCTGATGCTGACCCCCCTTGGGTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTCTGAGACCTCCCCGCTTCCTC
TTGTACCCCCTAAGGATCTGTTGCCAGTTTCTGTTGAGATCATGCCCGTATCTGAGAAGA
ACCTTCCTCTCATCCCTTCTGCACCTAGCCCAACCTTGGAGGCTGACGGCATCCCCAATG
GTCAAGAGCAGGGGGTACCATCTTCTGCTGAGGGGACCATCCTTACAGTGCTGCCTGATG
GTGAGGAGTTGCCCTCGGGTCTGAGAGAGAGCAATGGGCTGGAGCTCCCACCTACAGCAA
CATGTGATGAGCCACTTCAGGAGCCACTGGAGGCTGACAGGAACTTGGAAGAGCTGGTAG
AAGAAGTTCAGACCCCAACCTCAAGCCCAGAGAAGCCACAAGAACTTGCTGCACCTGAGG
TCACAGCCCCATCAACCTCATCTTCAGCCACTTCCTCTCCTGAGGGTCCTTCACCTGCCC
GGCCCCCTCGTCGTCGCACCAGTGCTGATGTAGAAATTAGGGGTCAGGGGGCTGGTCGTT
CAGGGCAACCTCCAGGCCCCAAAGTGCTTCGCAAGCTGCCAGGACGGCTAATAACTGTGG
TGGAAGAAAAGGAACTTGTGAGGCGAAGGCGACAGCAGCGGGGAACTGCCAGCACCCTAA
TACCTGGGGTCTCTGAGACTAGTGCCAGCCCAGGAAGCCCATCTACCCGCAGCTTGTCAG
GGCCAGAATCCTCACCTCCCACCAGTGGGCCCTGTGAAGCTGCTCCCTCATTCTCACTGC
CTACACCAACCCAGCCACCCTTCATAGCTCGTCGTCACATTGAGCTGGGAATGACTGGTG
GGGGCAGCCCAGAGAATGGAGAAGGGGCACTGCTTGCTATCACTCCACCTGCTGTGAAAC
GTCGGAGGGGAAGGCCCCCCAAGAAGAACAGGTCTCCAGCAGATGCTGGGAGAGGGGTGG
AGGAGGCACCCTCATCCACCTCTAAGGGAACAACCAATGGGGCTGACCCAGTTCCTGGAG
CTGAGACCCTAATTGTTGCGGAGCCTGTCTTGGAGCCTCAGCTTATTCCTGGGCCCCAGC
CTCTTGGACCCCCATCAATTCACAGACCAGAGCCCATCGTCCTGTCACCTGTGGAGAAAA
GAAGGCGTGGGCGGCCCCCTAAGGCACGGGATTTGCCCATCCCTGGGACTATGTCCTCTC
CAGGGGATGGCAATTTAGAGAGCCGGACACAGCCACTCCCACTACCACCACCATTGCCAC
CACCCCTACCACTTTTATCCTGTCCCACTGCTACTGTCGCCAACACTGTCACCACCGTCA
CCATTTCAACATCCCCACCCAAGCGAAAGCGGGGCCGACCTCCCAAGAATCCACCATCAC
CTCGGCCCAGCCAACTTCCTGTTTTGGACCGCGACAGCTCTTCTGTCCTTGAGAGCTGTG
GATTAGGGAGGCGTCGGCAAGCCCAGGACCTCGGGGAGCCCGTGGAGTGGTTCTTCTGAT
GAGGATGGAAGCCGCCCCCTTACCCTACGGTCCCGCCTGCGGCTGGAAGCTGAGGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAAGCCTCCAGGGAGAT
GTAAGGGCCTTCTCCCTTCTTTCCACCAAAGTAGAGAGGTAGGCAACTGGTTGTCATGGA
AATGAGGCTCATCACAATCCCCCTTCCCTTCCACCCCACATGAGCTGGAGCAGTGTTAAG
AGTGGCAAGATAGTCTGTCCCCACCCCCTTGTACTTGATTCCCCAGCTATCTTCACAGCC
CCACACCCTTAGAGAGAAAGAGAGATAGAGCTTCTCTACAATGAGTTTTTTTTTCTTTTT
TCTTTTTCTTTTTCTTTTTTTTTTTTTTTTAAGAAGAAAAAAAATAATAAACTTAGTTTC
TGTACGAGCATCCGCGTAAGGAGGCTTCTGATTTTCTGGTCTGGTGGAGGGTTGGGTGGG
AACTTGGGCATCATTTTTTCTACTCTTGCTCTTGGGAAGACCCATATTTAACTGATCTCT
AAACCAGGATTGTATACCTTTGAGGCAGAAAACACCCTCAGGAGGAGGAAAGATAAGCAA
ATCTGATTTGGCAAGGTGTGTTTCCAAAAAATATCTCAGTTTAAGTCACTCAGACACACT
TCCTCTCTCCTCTCCCTTCTGTCCCCTTGGCTCTTGGCCTTTCCCTCAGCTTTCTCCAAT
GCCTCACTTTTTCCCTTCTTTTAACCCTCTTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1252, 3406..3591, 3809..3949, 6015..6237, 6353..6630, 7216..7309, 7446..7535, 8253..8266, 8269..8328, 8330..8368, 8371..8373, 8376..8421, 8526..8546, 8636..8964, 9073..9250, 9501..9637, 9847..10016, 10155..10338, 10341..10346, 11882..12018, 12107..12268, 12271..12295, 12420..12589, 12690..12955, 13056..13220, 13777..14043, 14356..14684, 14687..14719, 14722..14727, 14730..14744, 14746..15852, 18284..18549, 18670..18872, 20935..21032, 21036..21068, 21071..21103, 21247..21258, 21263..21265, 21268..21270, 21273..21278, 21283..21291, 21294..21308, 21310..21324, 21326..21337, 21339..21427, 23208..23322, 23528..23647, 27139..27333, 27469..27552, 28373..30524, 30526..30593
1001..1252, 3406..3591, 3809..3949, 6015..6237, 6353..6630, 7216..7309, 7446..7535, 8253..8266, 8269..8328, 8330..8368, 8371..8373, 8376..8421, 8526..8546, 8636..8964, 9073..9250, 9501..9637, 9847..10016, 10155..10338, 10341..10346, 11882..12018, 12107..12268, 12271..12295, 12420..12589, 12690..12955, 13056..13220, 13777..14043, 14356..14684, 14687..14719, 14722..14727, 14730..14744, 14746..15852, 18284..18549, 18670..18872, 20935..21032, 21036..21068, 21071..21103, 21247..21258, 21263..21265, 21268..21270, 21273..21278, 21283..21291, 21294..21308, 21310..21324, 21326..21337, 21339..21427, 23208..23322, 23528..23647, 27139..27333, 27469..27552, 28373..30524, 30526..30593
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved