Spermophilus_tridecemlineatus Locus HSPA8
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus HSPA8
Spermophilus_tridecemlineatus
HSPA8
GeneScaffold_1420
SNORD14, SNORD14, SNORD14
1859..1944, 2259..2346, 3035..3119
4418
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGATGATGCAGCAGGCCCAAGTCCAGTAGAATCAAGGAGGACAAAA
AGTTCTATCAGAAGAGTATCATCTATGGTCTGACAAGATGAAGAAATTGCCGAAGCTACT
TGGCACGATAGTTTTTTTGCCATGTAGGAATTTACAAAGAGAGTCTCAGCTGGAATTTGA
GTGCATGTTGAAATTAATTTGATTATGGGACGAAGTAACACAAATTGTACTGTAACTTGG
TATTAATCTGGGTTTTTCTGTGTTTTGTTACTTTATTGTAGACCGTTACCAATGCTGTGG
TCACAGTGCCAGCTTACTTCAATGATTCTCAGCGTCAGGCAACCAAAGATGCCGGAACCA
TTGCTGGTCTCAATGTACTTAGGATAATCAATGAGCCAACTGCTGCTGCTATTGCTTACG
GTTTGGACAAGAAGGTTTGTCTTAGTTTTTGTCTTTGAATGCAAATCTAGATTTAGAATT
TGTTATTAGCTGTCACGAATTTACATATAAGCTTATTTTTTAATGGCAGGTTGGAGCTGA
AAGAAATGTGCTGATTTTTGATTTAGGAGGTGGCACTTTTGATGTGTCAATCCTCACTAT
TGAGGATGGAATCTTTGAGGTCAAATCTACAGCTGGAGACACCCACTTAGGTGGAGAAGA
CTTTGACAACAGAATGGTCAATCATTTTATCGCAGAGTTCAAGCGCAAGCATAAGAAGGA
CATCAGTGAGAACAAAAGAGCTGTCCGACGTCTCCGTACTGCATGTGAAAGAGCTAAGCG
TACCCTCTCTCCAGCACTCAGCCAGTATTGAGATTGATTCTCTCTATGAAAGAAATCGAC
TTCTATACCTCCATTACCCGTGCTCGATTTGAAGAGTTGAATGCTGACCTGTTCCGTGAG
CACCCTCGACCCTGTAGAAAAAAGCTCTTCGAGATGCCAAACTAGACAAGTCACAGATCC
ATGATATTGTACTGGTGAGTGGTTCTACTCGTATCCCCAAGATTCAGAAGCTTCTGCAGG
ACTTCTTCAATGGAAAGGAACTGAATAAGAGCATCAACCCTGATGAGGCTGTTGCTTATG
GTGCAGGTAATCTCAAATTTTAACCTTTATAATAGGCAGCCTTTGGGGCCCAAACCAACT
CGCTGTGATGATGGATTCCAAAACCATTCGTAGTTTCCACCAGAAATTTTGTGTTGGCTA
GTTCCTTCCTTGGATGTCTGAGCGAATGAAATGGGTTAATGAGGTAATTTGAATTTGCTT
TTTTTCTTTCTAATTTTTAATATTTTCTTTAGCTGTCCAGGCAGCCATTTTGTCTGGAGA
CAAGTCTGAAAACGTTCAAGATTTGCTGCTGTTGGATGTCACTCCTCTTTCCCTTGGTAT
TGAAACTGCTGGTGGAGTCATGACTGTCCTCATCAAGCGCAATACCACCATTCCTACCAA
GCAGACACAGACCTTCACAACTTACTCTGACAACCAGCCTGGTGTGCTCATTCAGGTAGG
TGTTGTTTATTAACACTTGTAAAACCAAGAAAATCTTGTTCGCTGTGATGATGGATTCCA
AAACCATTCGTAGTTTCCACCAGAACAATTTTGTGTTGGCCAGTTCCTTCCTTGGATGTC
TGAGCGACTGACTATTCATTCCCAACGAGTTCATAGCACAGAAATTTTAAGTCTTAATAG
TGATTAATTTCTGTTATTGTTTACCCCAAGGTATATGAAGGTGAGCGTGCCATGACCAAG
GATAACAACCTACTTGGCAAGTTTGAACTCACAGGCATACCCCCTGCACCCCGTGGTGTT
CCTCAGATTGAAGTCACATTTGATATTGATGCCAATGGCATCCTGAATGTTTCTGCTGTA
GACAAGAGTACAGGAAAAGAAAACAAGATTACCATCACTAACGACAAAGGTTAGTCTGAA
AAATAAGGCTCTCTTGCCTGGTCTTGATTCATTTGAAGTGTCCCCCACTGTAGGCCAAGG
GAAAAGTTGTAACAGGGACCTACTGAAGATTTTTAATTTTCTAGGTCGTTTGAGCAAGGA
AGACATTGAGCGCATGGTCCAGGAAGCTGAGAAGTACAAAGCTGAAGATGAAAAGCAGAG
GGACAAGGTGTCATCCAAGAATTCGCTCGAGTCCTATGCATTCAACATGAAAGCAACTGT
TGAAGATGAGAAACTTCAAGGAAAGATAAATGATGAGGACAAACAGAAGATTCTTGACAA
ATGTAATGAAATCATCAACTGGCTGGATAAGAACCAGGTAGGTAAATTTCTGCTAAGCAG
TAAAGAGATGCATAGATTCTGGGTTGGCATAACGGTCACAGTGATGAAAGGTCCAAACAT
TCGCAGTTTCCACCAGAATTTGACATGTAGGCAGTTTACCTTCCTTGGATGTCTGAGTGA
CCCAAGACTAAGACCTAGTGTGATGTGCTTTTTTTCTCACTAGCCCTGGGCTCCATGAAT
ATATTAGGTTGCATTATAAGTAAACTTACAATGGTTATTTTTTTTCCCTTCAGACTGCAG
AGAAGGAAGAATTTGAACATCAGCAGAAAGAGCTGGAGAAAGTCTGCAACCCCATCATTA
CCAAGCTGTACCAGAGTGCAGGAGGCATGCCAGGAGGAATGCCTGGGGGATTCCCTGGTG
GGGGAGCTCCTCCCTCTGGTGGTGCTTCCTCTGGGCCCACCATTGAAGAAGTTGATTAAG
CCAGCCCAAGTACAGTTGTAGCATTGTTCCACAGTAAAACATGGAAGAGCCCAAATTTGT
AGCAAATTCTGTGGCAGTTGTAAAGTTGCTGCTATAGTAAATTACTGGGCATTCTCAATA
CTTGAATATGGAACATGTACACAGGGAAAGGAAGTAACATTGCACTTTATAAACACTGTA
TTGTAAGTGGAAAATGCAATGTCTTAAATAAAACTGTATTTAAAAATTGGCACCATATAG
TTGTCTCTTATTAGCTTCTGGTAAGGCCTTAGAGTTAACATTGGGTAATGTGCCATTTGA
TTTAAGTGACAAGTTTTAAAAGCCAGTTCTATGGGTGGAATTTGGCAGAATTGGCTATGA
AGTTGAATAACAAAAGTGAAAAGTCTTGCTCATCCTAAAAGCTTCAATAGTGTCTTCAGT
TAAGAAGGGCAAAAAACCAATGTATCAGGAACAAGAGCTTATTAATTTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1153, 1249..1506, 1509..1517, 1520..1547, 1549..1617, 1619..1636, 1638..1805, 2012..2214, 2430..2628, 2744..2976, 3233..3418
1001..1153, 1249..1506, 1509..1517, 1520..1547, 1549..1617, 1619..1636, 1638..1805, 2012..2214, 2430..2628, 2744..2976, 3233..3415
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved