Spermophilus_tridecemlineatus Locus ENSSTOG00000012944
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ENSSTOG00000012944
Spermophilus_tridecemlineatus
ENSSTOG00000012944
GeneScaffold_3829
SNORA64
3472..3605
4988
GGATTGATAAATTCACTCCACTACACAGGCAGACAGACCAGGGTCCCAATCTGGCTGAC
ACTTAAGACACGTGCCTAAGCCCTACATTTGTGGTATCCGAAAGCAATTTGGCTAGCCCA
GGAAGAAACGCACTACTAGGGCTCGATTTTCCGGCAGGTAGGAGACCCCAAGAACGTCCA
CACATCCCGAGTTAAACAGCTTTATTTGAAACGCTGGGACCACCGATCTCTGCCACGACC
CCCCAAGGTCCTGGCGGCGTCGGCCTCAAGTTCTCTGGGAGATCCGTGTCCTGCGGAGAG
AGAAGATGGGGTCAGGGATGATTGGCCAGGGATATAACCGCGCGAGTAGCCGCAGCGGGG
ATGTCGGGGCCTGGGTTTCGCCTTCCCACACTGGTAGTGGGCGGCGAGCTGAGGCCCCTG
GAGGCTCTGGGCGCCGAATCTCACCCACGGCCACCGCCAGCGCCGAGGGTGATTTTCAAC
CAACGCCGGTCTCTCGGCCACCTGCCGACAGGCTAGCAAATCGGACCTACCAAAGATAAG
GAAAGCACACGGTCCCAGGATCCGCGAAAGGCCGCGGGACCGAGGCGCGTGCATTTATAT
GGGTCCGCCCAGCCGCCCGCCGCGCAGGCCCGGGCCGTGGCAAGAGCCGATGCGCAGGCG
CACGCAAAGTGCGGCGAGGGCGGGGCGCCGCGGAGCCAATCGTAGCCGCCTCGCGGTGCT
AGGGCCACTCGGGGCGAGGCTCCCGAGATCTCGCGGTTTTTGGCCTGCTATAAAAGCTCC
TTCCGAGACGGGTTCTTTCTTCTTCCCTGGAAAAACACGTGAGTAGTTTTATTATCTGTG
GCGGGACGGGGCGCGTGCCGTGGCGATCCGCGGACATCGGATGGCCGGGGCCAGCCCGCA
CGATCGCATCTTCAGACGCGATGCACCGTGTCTGGATTTCCCACGCCGCTACAGAGGCAG
CTCCCCGCTAATTGGCTGGTTCTTGTTTCTCGGTGCAGCAAATGGCGGATGACGCCGGTG
CAGCGGGAGGTCCCGGAGGTCCCGGGGGCCCCGGAATGGGTGGCCGGGGCGGCTTCCGCG
GAGGCTTCGGCAGCGGTCTCCGAGGCCGCGGTCGAGGCCGTGGACGGGGCCGGGGCCGTG
GCCGCGGGGCTCGTGGAGGCAAGGCCGAAGACAAGGAGGTAGGCCCGGGCGCCGGGCGGG
GCGCGTTTGGGGACGGCGCCGAGAAGGTATCCCTGTTGACTGGCACCTTCCCCGCAGTGG
ATCCCGGTGACCAAGCTGGGCCGCCTGGTCAAGGACATGAAGATCAAGTCCCTGGAGGAG
ATCTATCTCTTCTCTTTGCCCATCAAGGTATTGCGCTGAACGACCAGCCTCCCGGAGCTT
AATTTGGTAGGGGCTGGGAGAGTTGCACTTTGAGCCTGTGGTTGCGCTTGTGTGGGTGTC
CACCTTTGACATGGGTATCGCAGAGTGAGTGCTCGGTTTATAGAAAGATGCACTCGACTG
ATCTAGTGATCAGGCTAACACTAACTTTGCACTGGTCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTCTGCCAGGGGCTGCACTG
CCACCTTGGGCAAGTTTGTGGTAGGTGGTCCCTAAAGGAATCACCAGTGAACCCTCTCTC
AGCTCCGCTGAATCACACAGGTGCAGTGTGTGCTTGGCGTATTTTAAGGGAGAGAGAGGA
AGGCCCTCCTAATGCACGGCAGATCTGCCCCTAAGTGGCCTCTCTGTTCCTAGGAGTGCA
ACAGCTTCTGTAGGGGTGGAGGGCTTCTCTGCTATTAGCCACTAACCCTCTTCTGTTTGT
TTTGAAGCCAAGGCCACCTTTGATGCCATCTCCAAGACATACAGCTATTTGACCCCTGAT
CTCTGGAAAGAGACTGTGTTCACCAAGTCTCCTTATCAGGTATTTCTGGTCTAGCTAGTG
AGATTTTACTGTTTTTACATCATGGCCTACCTTATCAACAGGTTTTTTTTGGGGCGGGGG
GACAGAAAAGCCTTAATTTTGTAGGGGAATGGTGTTCCCACTACATAACTGTTGATTTTT
CTTTGTAGGAATTCACTGACCATCTTGTGAAAACCCATACCAGAGTCTCTGTACAGAGGA
CCCAGGCTCCAGCTGTGGCTACAACATAGGGTTTTTACAAAAATAATAAAGTGAATGAAA
CCCATTAGTAAATGATTCTGTCTTCCATATAAACTGGTAGCTGGAATTTCGAAGGGGCTA
ATGACACCACCAGAAGTAGAGTTAAATCACTTTATTTCAGCAATGCAGCAGGTTGGTTAA
GAGGCCTCAGGCAGCAGCAGCCTCCTTAGCAGCTTTTCTCTCTGCCAACATTCTCTGCTT
CTGCTTTGCCAGGCACTTTCTGGCAGAATAATGGGCTCCCAGGTCATGATCTGAGAAGGA
GATGGTGGATGGATTGGCTAATAAGTTGGGTAAGAAAAAACAGGCAAAAAAGGGTGGGCA
GGGCTCAACTTACAGCGGTCCTGGTAGGCCTTGGCCACCTGGGCAAACTGTTCCAGTTCC
ATGGCACAGTTCTGCTTGTAGCTCTCTCCTTCCCTCTGCTGACAGGCCTTAAGCCTCTCC
TGGATGATGTTGACAATTTCTTGATCAACTTTGCTAAAAAGGAGCAAGTACCCAAAGGAT
TGAGTGAAAGCCTTGTCTTCAAAATCTGAGCCAACCCCAAGAGATATACCCACTGGATGA
GGCCATCCCAAGGAATCCCCAGGAAATAATGGGACAGTAGGAAGTGGTCTCATACTTTCT
CAACATTCCCTGCTATACACTTACTAGTCCCTTCTCCATTGCATTTCTGCCTCAAAAATG
CACAGGATATCCTTCTCCTTGCACTCTGTGATGTCTGGCACTCGGCGGTATTGCCGGTGG
TAGTAATAATACCTGTTCTTGGCATGCTGCTGCTCTATAAACTCTAGAAAGGAAACCAGA
TAATTTACATGTCAGTTTAGATAGATGGGTGGAGGTATTTCCTAAATGTTAGAAGCTTTT
ACAGAAACAGCAAACTGGACTCTGAAGGTATGGGACAGCACAGTCTGTAAAGGACTAGGC
TACAAGTGGTGATATCTCGGTTGCATCATCACAGGTGTGACCAGAACAACCCTTTGTCTT
CACAATGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1177, 1257..1346, 2693..2800, 2901..3074, 3175..3297, 3401..3437, 3667..3759, 3909..3988
1001..1177, 1257..1346, 2693..2800, 2901..3074, 3175..3297, 3401..3437, 3667..3759, 3909..3985
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved