Spermophilus_tridecemlineatus Locus SNX5
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNX5
Spermophilus_tridecemlineatus
SNX5
GeneScaffold_2106
SNORD17
5797..6051
23216
ATATCAGGTTTTTTTGTTAAATATACGGATATTTCTTATTTAATCCTCACACACTCTAG
AGTGGGCATTATAGTGATCCCGTTTTACGGACGTGAAATTCGAACTTCTGAAAGGTGGCC
TTGTCACAGGTTGGAGCTAGTAAGCCGCGGTCAGCAGGGCCCGCCGACCTATCCTGACAA
CGTGGTCTCCCGCTCCACAGCAGGTGCAGACCCACGGCGGGGACAGAGCGGCTGTGGGCC
GTGTGGGGATAATGTGGCTCAGGGAAGAGTTACAACTGAAACAGAACGTCAGCCTACAGC
AGGGTTAGTACCTTGGACGCCACCACGCTTTGTTAACTCCCAGGGCGCCAACACCTTCTC
GTGAATCCTAATTTTATCAGTCCCGCGCTTTGGCCTGGAGTCAAGCCCCGCCCCAGGCAA
GACTGCCCCGTCATGCACTGCGGCGCTCACGCCCCACCCCCTGTCCTTTCTCAAGCCTCC
ATAGGCAAGCAACCCATAGGGAGTCCCACCCCTCGTGCTGAAGCGCGGGCACCTCCAAAT
CTCGTACTTTCTCTCTCACGAGATCTTGCATACGTCACCTCTCGTCGCCATCTTGGACTC
GGGCTGAGCAATAAATTGCTTGGTACAGGTGCGTGGTCTCTCTGTCGAAGCGTGCCTCGC
AGGAAGAGGGTCAGTGGCTCCGCTCCGCGTCGCAGTCCTCGGGTCAGCGTTCTCCGCGTG
GTGCGGAGCGAGGGTAGGCCCCGCATTACTTCTTTGCCCGGCTCCAAGATGGACGGCAGC
CGGGACGGGGAGGCCGCTCTAGGGGAGCACGTGGCGCGCCGTTTGCCTGCTCCCGGGGCT
GCTGGGATGGTGGCGGAGTCCCAAGGCCTCCTGCCGCCGTCGGGCAGGGAGGCTAGCGGA
GGCGGGGCCGCGGTCGCCCCTGAGAGGCGCCCCGGCGGTGGTGGCCCAGCCTCTTCTTTC
CTCGCACAGCCAGGCGGCCCCTGCTCTAGGCCCGCGTCGCCATGGCCGCGGTTCCCGAGT
TGCTGCAGCAGCAGGAGGAGGACCGTAACAAGGTGAGGTCCTCCCCTCAGTCTCCAGGAC
GGGAGGCCCAGTCGACCTCCCGGAGCCTTGTTCTTTTCTCCACCCTCTCCCAGGGGCCTG
GCTGCTCTTGGACCCCAACCCCCCCCCCTCCCAGTACCGTAACACATTCGAGATCTGGTG
CCCCTTTTGTGCTCTGTTCCATCTGAAGACTGCCCGGGGTCATCCCGGTGACCCCCGATT
CTCCCACTGGGGAGAGGACCACACATGCTGGAAGGACCCTACTTAGGAATCACTCCTCCA
CTGCCTGATACCGATACCGAGTGGTCTCTTGGCCAGTCTCCTTGACTAATTCTCGAAAAC
CCCAGAATGTGTTTTAATATTAGAAGTTCATAAAACTTCCGTTGGTTTCCATTGGTGACT
GGAAGGTGGACGTGAAATTTACTCATTATGAAACAAAAGTCAGTGGTTTGTAGTCTCCAA
ACTGGCGCCTCTCCCAACTCCCTTTAAGAAAAGGGTCTTTTTAGCCCAAACAACTGGGGA
AATTCAAATCTGTAGCATGTTCCTTGCAACTTCGTAAACGCTAAATGCGTCCTCGTGGGA
GTTGTGTAATTTTTAGTAGGTCTGAAATGTTTACTGAGCTGCGCTTTTATTTTTAAATTC
TGTGTATTTATGTAAGCCCCAGGCACGTTTCTTGAAGTCCAAAAGATTGCAAATGCCATA
AACTGAGGTTACCATAGCCAATTAAAGATTTAGAGGTGAGTCTCCACTCTTTATTGGTCC
TTTAAGTTTGAATTGTTCGGAGCCGCTATCTTAAATGCAGAATCATCATATAGTTTTCTT
GACAGAAAATTTTAAAAATAAAATATAAAACAATTAGTCGCTCTCAAATTTAAGAACTTT
GGATCCATGTTAAAAACAGCTCTTTCGAACTCACAGGCATCTTTGGAGAAACTATTCTTC
TAGTAAGTAAATACCCGAAGTTGCAGGCTGAGCAACTGGACTGTTGGAACAAGGGCGCCA
TTGTATTAGTTATTGAAACAGAGCTTTGTACTGATTTTTTTAAGTTGAAAGAGGTTCATT
TAAGTCAAAGTGAGAACTTGAAGTTAGTTTCTTTGAGTATTCTGGTTATTTTTCTCTTCA
AAATGTAGGTTTTGGATAGAAGTTTTTATAGCCATTTGTTTTTCTTATTTTCTTTGGTGA
GGGGTACCAGGGATGGAACTAGGGGCTGCTTGAATCACAGCAGCTCAGGAGGCTGAGGTA
GGAGGATTTGAAGTTCAAAGCCAGCCTCAGCAACAACAAAAAAGATTTGATTGCTTCAGC
TCACCTTATTTATTTAAATTGGTTTTTAAAATGACTTCCCCAGCACCCTGATTCTCCATC
AAAATTGGAAGAGGGTTATGAACACTACCAACTGCCTCTCAAGTTCCAGGAACTTGGTCT
ATCAGTAGTGAAGATACCTTTTTTGGAAACTATGGGTTCTTTACCACTGAGCTACCTTTT
TACTTTAAGACAGGGTCACACTAAGTTGGTGAGGCTGGCTTTGGTGTCCCTGGGATCCTT
CTGACAAAGTTACAGAAACAAATTACCCTTCATTTTGCTGCCTGATCTGTGCTGATAACT
AGTATTGTGCTGTGGTGGATCAGGTCTAGATAGTTTTACAGTTTATCCAACAGGGAGTTT
GTGGCCAAGTCTTGGGTAAAATCTTGATTAACAAAACAGTTTTAGCCTGGTACGGTGGCA
CACCAACTGTTCAGAGGCTGAAACAGGAGGATCACTATTTCAAAACCAGTCTCAGCAAGG
GGAGGCATTAAGCAACCCAGTGAGACCCTGTCTCTAAATAAAATAAAAATTACGGCTGGG
TAATGTAGCTCAGTGGCCAAGTACCCCTAGGTTTAGTCCCTAGTGCAACCCACCACCACC
ACCATCAAAAAAAAAAATAGTTTTATAGTTTGTTAGTCAACTGAAATATTTGGGGAGGGG
GGATGGTACTTGGAATTGAGTCTAGGGTTGCTTTATAATTGAGGTACATCCCTACTTAAT
TCTTTTTTTAAATTTTGAGACAGTCTTGCTGACTTGCCCAGTCAGGCCTAAAACTTAAAA
TCCTCCTGCCTCAGCTTCCCAATATGCTGGAATTACAGGTGTATGTGCCTGCATCATACA
GAAACATTTACATGTTAGCTTAATGTTTAGATGTTATTTGCTTTAGTTTGCAATTTCCAC
AAGGGTGGAATTCATGGATTTGCATAGACCCTACCACCCTATGGGGTTAAAACAAAAGTA
GAGGGTAAAATTGATTATTGAGGATTTTGAATGCTACTATATACTCATTTTGGAAAAGTG
AGCAAAACTAAAAGTATCGAGCTGTGTCTGGTAGCTGAACACTCCAGTATTTGTAATATC
CTTATGCCTAATGTGTTTGCTTGTTCCTCAAAAATCAGTTCAGGGGAAAAGTTGCATGGT
TAATTTGGTCTTTCTCATTAGTGTAAGGGCAAATCAAATGTAACAGCATTTTTTTGTGGG
TGATAGTCTCTTTGGTTCTGAAAAGCTTCAGATTTTTCTCCTTTATTGTGAGTGGACTGA
AGTAAGCTGAACATTTGGAAAGAAAAAGCTATCTAAGATTGAAATCTGTTCTTAATTGAT
TTGGAAACTTTTAGGGGTGAGGGCACTTAAGCTAGGATAGAGAAATGTCCTGCAGGGCCA
TTCCTGAATTTTGACCAGCTTTAAGTCCAAATTTACCAGTTTTTGTGGTCTAATGTTTTT
TGTTACACTCATGACTATTTTTTCCAGGAAGTTTGACTTATCAAAGCTGCCCACGCCCTA
GTTCTGGATCAGTAACTTGCACACAGTGTCTTAAGGTCCCCATTTGTGAATACTATTTTG
ACAATTTATGATGATCTCCTATTTTTTGGTTACAGGAAGAAATGACCAAGAGGTTATTTG
AGAATTTTCTAGATTTGACTTTTTCTGAGAACTGAATTCTCATTTGGTAAGACATAGTAA
GTGACAACATCTAATCTAGAAGTTTTCTTTAAGCCAGGATTTTTTCCAACTTGAGCACTG
TTGACATTTTGTTTTGGGAACTTGTCTTGTACATACATAGTTGGTTGTTGAACAACATTA
TCAGCCTCTCCTAGGTAACAGCAGCCTCCTCTTCTTCATTTGGATAGTCAGAAATATCTG
TAGCCTTTGTCATATGTCCTTTGAGGCCCAGTAGATTGACCCTTGATTGAAAATCACCAT
TTAAATTGACTCCAAAATGATGTGCTAATGGCTGGCGTAAAGTTGTGTTATAGATGCTAG
TCTTAGTTGGCTAGTTTGATGCAAGTTCTTGAGGTTTATGATTGTGTAAGGAAGTAACAT
AAAACTTAGATAATTGATTTGATATCTTTGGTAGCTTTTCCACTAACATTGAAGAACTTT
GTTGAAAAATGTTAAATGGTTGTCTTCAGCAGGTTCTGGGGCACTTAAAGGTTATAAAGG
GACAACTTTGTATATGTTATGTTTGTGAATGAAGTCCTGGGTTTGGACATTGTAAACCTG
GGGTTCTTGTGCCATAACACCTGTAAAAGCTCTGTGGGCAAAAAATTAAAGCTCACTGAG
AAATGTGCTGTGGTGAGATGATTTTAAATCCTACTGTTTATTTAATTTTGCTTGCTATCT
TTACTACCAGGGCTTTGTTTCTTGAGTAAATTAAGAACAGCATATAGATTAGAAATCTGA
ATATCTCAAATAGCCAGTGGTCAAAGAAGTATGCAGCAAAAGTTAGTATTTAAGGAAACT
TGTAAACTTGATACCCATATTTTTAGAAAAGACTTTCAGAACTTTCAGTTCTGCTTTTTC
GTTTTGAAACAGGAAAAGAAGATGGCTGTAGGACGTCATGTGTCATGAATGTGGTAAACT
TATTTAAGTACCATAATAATTAAAGTCTCTGGGTTGGGGATGTGGTTGACTGGTAGAGCA
TTTGCCTAGCATTCCTGGGTTTGTTCCCCTGCACCAAAAAAAGAGAAGTTTCTCTGATGT
AGCTTTTCAAAAAAAGCACTCTCTCGCCCTCCAACCTATTTCTGGTCAGGTGATATGTTA
CTCCTAAGATAGCTATCTTAATTCTAAAAGAGGGACATGGACTTTTTGTTGTTGTTGTTG
TTTTTTGGTACTAGGGATTGAATCCAGAGTGCTCTACTGAGCTACATTCCCTTTTGCTTG
ATTGCTTATTTTTTTATGTATTTATTTGGACATGGGGTTTTGCTGAGTAGCTGAGGCTGG
CTTTGAACTTGAGGTCCTCCTACCTCAGTCTTCTGGGCAGTGGGATTAGAGGTGTGCACC
ACCGTGCCCAGCTCTTTATTTTGAGTTAGGTTCTCATGAAGTTGCTAGGCTTGCAGTCCT
CTTGTGCCTCATTCTCTGGAATTGCTGGAATTATAGGCATGCAAAACTTTGCACTGGCAT
TTGTTGAGTTTTTTAAGGGAAACCCCAAAGGCAAATCATAAATATGCAAATTTTGGGTGG
AGGTGAAGGGCTTTAGCTCTGAATGAAAGAAATATTTTTTTTCAACTATGGGAGCTTTTT
CTCTTGCAGTGTTGTGGTTGTTTCCCAGTAGGATTTTTGTGCCAAGAGATACTTGCAGAT
CATATGGTTCACCCAACCCTTTTTGCTTTGTGAACTCATTTGAAGATAGTTCAGATATCA
ACTAATTAGATGGATTTCTAGACATGAACTTAATTCAGTGGAATCTCTTTTCTATTTTCT
ATGTTGAGATTTGACTACTGAATGGACTTGCAGCCTTGTGAAATGATGATTCAGTTTATC
CATTCGGCTGAGTGTGCTGCATTGACCTTCTTCCCAAGCCTCAGTTCCTGTTCTAAGAAA
CTTTTGGTGCTATGTAGCCTCCAAATGCCCTGGCAGATCTGCAATGGTCTATTGCAGATT
GCTTGTGTGGTGGTAGCCCATCTGATAAAAAGTGGCTTGATGTCTACAAAGAATGATGCC
CATGTGTGGTTCGAATTTTTACCCAGATGAGTGGGGGGCAAATCTAGATCATCTTGCTTG
CAGACCATTCCAGGTTATTTGTAAACCATAGGGCCTTAATTAATTTCTCTGGTTATTATT
TAGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGTGTGAGGAAA
GAGCTCTATCACTGAGCTACAACTCCAGCCCCAAATCTTAGTTATTTTTAGGGTAGGAGA
AAACAGTAACAATTCAGAATACCAATACTTTGAATCATTTTTGCCTTTTAATACACTTAA
ACCATGAAGGGAGGTATAGGGAAGGCTATGGTATTTCTTAGAGCACTTTCTTCTTGTGAG
TTAAAACAGTAACAAATTAATGTTTTATAAGCATGTGTGAGACAGATCTCAAATATTTGC
AGAAAATAATATAAATCTGGAGTATTTGGACAAGTTTTTCTTTTTTCTTTCTATTTTTTT
GAATTGGATATTGATCCCATGAGTTACATCCCCAGTCTTTTTTGAGACAAGGTCTCTTAA
GTTCCTGTGGCTGACCTTGAACTTGAAATCCTCCCCTCAAATCTCCCCAATCTATGGTAG
AATGTTTTTGCATTTTATTTCATACTAATCAGTATTAGAAAGGAAGGTATTAGTACCTTG
CCTTGCTTTTGCTTACTATGGGGAAAAATTAAAATCTGATCCAGAAGGCATCTTTCCCCT
CTCAGTTCCTTGTACACTTATACAAAACAAATATGTTTTCTCTGTAGTAGTTTCTTTGTA
ATATTCAGATACATAGGGGAATATTGGGACTGACATATAACTTTGTAACATTGTGTACAA
AACTGATTAGATTAAAATAGCTATTTCACTAGCTCCCACTCTGGCATATCCCTGTTTATG
GAGTTTCATTTTGGCTATATGGCACTAGTCTAAATCAGAATTTGCAAGCAGCATAACAAC
CTGACGTTTATAATTTCATGTGTTTTTGTTTCCCCTGTGGGTTTTGAATTTTGGAATATT
GCCCTTTTGCCATCTGTGATCCTTTAGATCTTTTGAAGAGGGAGCTTTGCTGATGGCATT
AAGTCAGTCTTGAGCCAGAATGAGTCACAAGAGAGATTTGAACCAAAAGTGAACGTCCCG
AAGATCTACCGGGTTGTCCTACCACCAGTGCCTGATTGACAAGTGGAGGAAAATGCACAG
GGGAGTCATTAACAGTTTTTCTCCCTTCAGGAAAGTGCCTGGCTCTCTCACCAAAAGCAT
TCAGATTTCTTAAATGGTTTAAGGTTTGTTTCTAAACAAAGCAGTACTTCTTTACCCCTT
GTTGGTCTTGAGGAAGGTGCTTGTAGTCTGCTGGTTTTAATACTGGGGATTGAACCCAGA
AGTACTTTACCAATGAGATATTTCAGCCTCCCATTTTTTTCCCCCCTCGTACTGAGGATT
GAACTCATGGGAACTTAACCACTCACATCCCTATCCCTTTTTTGTATATTATTTAGAGAC
AGGGTCTCACTGAGTTACTGAGGCTGGCTTTGAACTCGTGATCCTCCTTCCTCAGCCTCC
TGAGCTTCTGAGATTATAGGCATGTACCACTGTGCCTGGCTGTATCTCTTATTGAAAGAT
GGATCTGGTAGAGAGGAACTTTATGTTGTGTGTGTGATGCAGTGGTTTATAGGAAAATCT
ATAAGAGTCAGTTTAAAACTCAAATTCCATTGTTTGGGTGTAGGTATTTGAAATTTGATT
CTCTCAATGACAAGGGGTCTGAGAGACAACTGAACTCTACATGTCAAATGTCTGAGATTG
AGCCATTTCCCAGTCCCTAATGTCCAAGGTTGAACCTGGTTCTGAAGCCTTCCCTTATCC
TGCTGAATGTACATGTCTATGTAAATTCTAGGTATTTTAACATCTGTTTAAGTCATTTAA
TATGTGGGTCAAGACAGATGTTCACAGTTTTGGCTTCACCGAATGTGAAATAGTACTCTG
GGTGGTTTAATCAAGATAAGGGGTAGAGGTGGGTAAAAGGAGAAGAATGCTCATCCCTTC
CTACCCCTGAGTCTGGCAATTTATGTAGCAAGTACTGGGGCATGGGACTGAAGGGTATTG
GTTTTGTTAATCAAGTGTAAGAAGGAATGCTGACTTAGATAGAAGCTCTAAGCATTTCAC
AATTCTTTTTTTCCCCCAGTGCTGAGGATTGAACCCAGGGCCTCATACATGATAAGCAAG
AATTCTGTCCCTGAGCGATATCCCCAGTACATTTACAACTTTTTATTCCATGATGATGTG
TGCTTCATCTGGAGGATTGTATGCTACAGTGTGAGAAAGTTGGTGATGTCCTTCTGAGTT
TTTGATATTTTTTTTGTGGTACCTGGGATTGAACCCAGGTTGCTTAACCACAGAGCCACA
TCCCCAGCCCTTCAAAACCATCTTTATAGGGCTACCTCTGGTTTGTTTTTTACAACTTGA
AACCTTTTCTTTGTCACCATGCTTACAGAAAAGAGAAGTACTTACAACTTCTAAGATAGG
GGAGAGAGAAGTAATTATATTTATTGTTTGTTTGTTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGTGATATATAATCTTTACAGTCAATAATGCTACTGGGGATGCAGCCCAG
GGGTGCTTAACCGCTGAGCCTCATCCCCAGTTTTTTTTAAGTTGCTTAGGGTTCCACTAA
GTTGCTGAGACTGGCTTTGAACTCCTCCTTTCTTGGCCTGCCCCATCCCCAACTGCTGGG
AGTTTTGTGCCACTGTGCCTAACTAATAATGTTTCTTGAGGGTCTGGGTCTGTAGCTCAG
TGGCACAGCACCTATCTAGCATGTATGACAGCACTGGGTTTGATCCTTTGCACCACATAA
AAATAAACAAAGGCATGCTGTCCATCTACAACTAAAATTATTTAATAATAATGCTTTTTG
AATGTTGCCATTAACATTTACATAAGAACTCATCTAGTTAGTGTACCGTCATAAGAAATA
CAATTTCATGTACGTGATATTAGAATCATAGTTAGTTGCTTTGTTCAGTTTATAGGAATG
CTTTGGATACATGGATTGGACTTAAAGAGCAGGTTTCCCTATAATTTCAAATATCAAAAC
TGACTTTGTTCTAAGTGATGAAATTAATACTCAAAAAATGTGTTTCAGCTGAGGTCTGTG
TCTGTGGACCTGAATGTTGATCCCTCACTTCAGATTGACATACCTGATGCACTCAGTGAG
AGAGATAAGGTCAAGTTTACAGTGCACACCAAGGTAAGTGACAAAATGGCTTTGGTAATA
CTAACAATGCTAGGTTATAGCCTTGTTCACGTTTGGATGTGAGAAGACTGATTCCATTAA
CTACAATGGTTACTGTTTGCTGTGTACCAACTGCATAGTGTGAACCTCTCTCATATGTAT
AGCTTGCTGTTAGCAAGTGCTGTTGCTTCAGCATCCTTTTGCTATGGTGAAGCCACAATG
ACAAAGTGATATAGCTGGGTGCTGCCTATTTATATAATTCAAACCTTGCACCTTTGGTTT
TATTTGCATCTGAAGGTAGTGTCTGTGGCTTGCTTTAAATCTTATGTTTGGAAGGCCCTT
TTGTTTGTGGTATTCTTCGTATACCTCAGGTATACTTCAGAAGTGTCAAGACGGGCAACC
TGATTCTCTACTTGAGTTGACTTGATCATAGTAGATAAAATTAGCATTCGCAGGAGTTCA
AAGGAAGCCAAGGATAATTTCCACCACCCTAGTAGCTGAGACTTTTTTTAAAAAGATGAT
GATGATGATGATGATATTTTTTGGTCATAACTGGGATAAGTTCCTTTTTTTAAGATGGAA
GTAGGGTTGTTTAACTTCCTGGAACTTTTTCTTTTACTAGTAGATATTTTTCTCTTTGAT
TTGATACCTTGGCAAACTTCCAATAAGTGTAGTTTTGTGAAAAGTCTTCCTTAAAGATCA
GATTGAGTCTTAGCTGTGGCTAAGTGGTAGTTGGAGATCATATACTGCTACTTCTTTATC
ATGATGTTGTATTATGCAGAATTTTCCCATAGTGCAGCCCAGGAAACCCAAACCACATTA
TCAGGTGATGGTTAGCAATTAACTTCTTCCTCTTTACAGACTACACTGCCCACTTTTCAG
AGCTCAGAGTTTTCTGTTACAAGGCAACATGAAGACTTCGTGTGGCTACATGATACACTT
ATTGAAACCACAGACTATGCTGGGCTTATTGTGAGTACGTTTTAGCATACCAAGTAATTA
AGTTATGCTACCTTGGTATTAGATTTCACCAACATTTTATAATGGGTTGTGAAAACTCTT
GATTTTTATCTGCAACTCCAGATTGGTATAGTCTTTAACTGAATAGTGCTGTGAGATGAA
GCATACACAGAATATAGTATATACTTTATAAGTAGGTAAACAAGTTTAATGATTTAAGTC
CTATCTACCTTTTCTCTGGCGTCATTTTTGGGCATTAGTAAGTTGATTTCTAGGAAACTT
CAGTATTGTTATAGTTCCCAGAATAAAGAGGCCATTGTCACTTTGAGAATTAATTTTTGG
CTGTGGGAACTTCTGTTCAGGGGTCTTCTCTTCATTTAAAATTAGGATCTTTTGATTGTC
CTTAGAGGTTGAAAATTTTGCTTTTGTTTAATCATTTTATCTTAATTTTAAGCTAATGTC
AAACTGGTACTCTGCTAGTTCTCTATAAACTGAACAAATGATTATGTCAGAATGCCCAAC
TGTGGGGAATATACTTTGGGGTCAAAAGATTTAAGGATGAAACCCAGTGACTTTAGAGAG
CCCCACTTGGGTGGCCAGAGTTGAATGAGGCATCAACTAAAACGTGGCGGGCAAAATGCT
CATCATGTATTACCTGACTATATTGCAGATTCCCCCTGCTCCTACAAAACCAGATTTCGA
TGGTCCTCGAGAAAAGATGCAGAAACTGGGAGAGGGTGAAGGGTCTATGACCAAAGAAGA
GTTTGCAAAGATGAAGCAAGAACTGGAAGCGTAAGTGGATTTTCTTTTTAAAGTTTGAGA
CTGGGTTTCACTAAGTTGCTGAGGCTGGCTTTGAACTTGTGAACTTGTAGGTGTACCACA
CCTGGTGGGTGGGTTCTTTTTAAACAGTGTAGCTGTTAATTGCCTAGTGTTGATTTCTAA
ATTACATTTTGTAAATATAGTTTTGTGGGGTACAGTTTTTGTACTTCTGACCTTTATTCC
TTGAAAGGCTTTTATTAGGGCATACTGGTCTGGCATAGGGAAGAAAGTGGACCCTTAAAT
CTTCATAAACAACATTTTCAAAGTGTTAAAATGTATAAAAATTTGTCCCTTGAAGTTTTG
TTATAAGAAGTATTAGAAGAAACTAGGTTGTAACAAATGCTGTTATAAAGCATTCTAAAT
AACCATATTGATGGTTTGAAAGAGACCAGGTACATAGGCAGCATATTTTAATCTGCTTTT
AATTTTAAAGCAAAACTGTATTCTTTATTCTGTTTCATAGGTGTAGGTTTGCATTACTGA
GTACTGAAAAACTTATAGCAGATGTTTTTCAACCATTATTTCTTTCCTTAAAACAAATAT
GAATTCTAAAACCACATACCATTTAAGTACTGGAAGGTTAGAGAAAATGTATTGTGCTCT
CCTCACCTCCACCTTGTATTAGGGATTGAACTCCTGAGTGCTTTAGCAATTAGCTATGTA
CCCGGCCCTTTTTATTTTTTGAGACAGAGTCTCACTGAGATGTCAAGGCTAGCCTCAAAC
TTTCCATCGTCTTATCTCATTTTCTCAAATCCATAGAATTATATGTGTGTGCAACTATGT
ATTTCACTTTGTTAAATTGGTTACTTATAGATGATGATTATTATTTTTTTAAATTCTTAT
TCCTCTACTCTTGAACTTCTTTATCTTGGCTCAAAAGCATTCACCCTTTCCTCTTATCAT
CATCGGCAAGTTAGAATTCAGGTGCTCCTTTCAACAACTCTTCAATACTCTGTCCCAAGC
CCATGTTGTGTAGGGCAGGGCTCACACCTGAATAACTCTGTGCACTTTGGAGTGCCTGTG
AGTCCAGCCCTGGGGATAAAGCACTCAACACAAGTTTCCAAACCCTAACATCTTGAATGC
CTTAATTGAGGTAACACTGCTTGGTAATTAATGCTGATCCCAATCCTTATTAAGGATTTG
TGCTGTGTACATGACTGCCTAAAAGGGGTTTCATCCTTTTTAAAGCAACAAATGTCAACG
TACTTGTTAAATTTCAAGTAATTACATGTAGGCTTGGGGAGTCTTAGAAGGCAGAAAAGC
ACCACTTTCTTCCTCTATTGGTTCATTCCAGATTCTAAAATGCCAACTGATTAACTACCA
AATCAAACCAGTATGTTGTTTTGGCCTAGTTGTAGTATTTTACTTAATAAAAATGAGCAG
ATCACTAGATTATAGATCGTTGACCAGCAGCACATGATAATATCCATCAGGTAGTAGAGT
GATGCCAACTGAATTGTGTATGCATTTGTCTTTTCAGTGAATATCTCGCTGTCTTTAAGA
AGACTGTGTCCTCTCATGAAGTATTTCTTCAGCGGCTTTCTTCTCATCCTGTTCTCAGTA
AAGATCGAAACTTTCATGTTTTCCTGGAATATGATCAGGATGTAAGGCAATTTTACTCAC
ATTTCCATGGTTCAGTTAAAATGTATGATTATGACCCAGGCATGATGCCAAATGCCTGTA
ATCCTAGCTACTCAGACTGAGGCAGGATTGCAAGTTTGAACCCAGCCTTGGCAACTTAGA
AAGATCCTGTCTTAAGCTTTAAAAATGACTGGGAGTGTAGCTCAGTACTGGAAAAGAAAA
ATTTATACTTTCTGAAAAATGACTTATCACAAACACAATGGAAATGTTTGGGGATGCTCC
CCCCCCCCCCAATCCATTACAGAAGTCATTTTTGTGACTCTGCCTAAGCTTTGGCTTTTT
TATCCATCTTCCAAAGACTAGTTTTTTCCTTGTTAAGTTTGGGATTGTTAGAAGGAAATT
AAATTGATTTACATTGGTTACCCTTTCTTTTAAAGGAGATGTGCTTGTATCCTTATTTTT
GTATTATTATTTTTTTTTTACATGTTATATTTATTGTCCCTTGATGAAACAAGCCCTGAT
TTAGAGTTCTGAAGCTTAAAGCCTAATCAATGTAGATTGAAAAGAATGTAATTCTGCCAA
GGACTGAAAATCCTCAAAGACTTGGTTCCTACATATGTGATCCTTTTAGAAAGAGATTAC
TTACGTTAAACATTATCCATTTATTATGTTTTCAGTTTAGTTGGTAAAGCAGANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAAAATAGATTTTTGTTTTTATTACAT
ACTGGATTCAGATTTACTACAAAGAAAAAAATATAAAATGTCTTACTACTGTTTTACATT
AGTTATGCGGTTAAGTATAATATAAAATTAATTTACTCTCCCAGAATACCAGTAGAGAAG
TTAGCATCAGAAATTCCTTTTGGGTAGTGCTGTTCTAGAAAATAAGAATTAAAGCACAAG
TCTTTCATTACCCTCATAGATGTGATTTCAAATTTCTTTAATCTTCAGGCCATTCCCCTC
CTTTTAAACTGAGATACTTTAATATTTACCACCAGAATCTGACTTTCTTTCCAGGGTAAG
GCTTAAGTGGGAAACAGTATAGGTGCATAGTAGAGAGGGTAGTTTCATAAATTTGGAAAC
TCTTTGGCACAGTGCTGAGATGTGTGGACTGTCCTATCCATTCATTGAATGATATTTAAC
ATCTTTGGCCAGTGCCTACCAGGTGTACCAGTATGGCCTCTCAAACTGAAGCCATCTAAA
TTTAAATAAAAAATAACCATATGCATATTCTAGTATTCAAGTCTGGGTGGCAGTACCTGA
CTTGGCAGAACTGCTGCAATAGTAATAAAAACATTGGGTCTTGGGTTACCAGAGATTGTT
CTTCAAAATGATTCTGACATTTTCTTGATTATTGCTAGTCCTGGGTATTATCACTGTGTC
TTATCTGTGGAGGTTAAACTTTTTACTTAGAAATTTGTCACAAAATACATTCTTGTAATT
TATGCTAAAGTTCTTTTTTTTTTTTTTCTTATCTCCTTTTAGGAGGTAGATGACTTCTTT
GAGCAAGAGAAGAACTTCCTTATTAACTATTACAACAGGATCAAGGATTCCTGTGCTAAA
GCTGACAGAATGACCAGATCTCACAAAAGTAAATATCTTTTACCCACTAGCCACTTTTGG
CTTTGCTAGTGTGCCTGCTCTGCTCATATAATAAGGATTGCACTGTCTCTCCAGATGTTG
CTGATGACTATATTCACACTGCAGGCCTCCTTGCAGAGCCTGGCTTTAGAAGAACCCACA
GTCATCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTGACTTCC
TGATTGAAGACTACTGAGTGATATAATTAAAGAATAAAGAGTACTGACAGAGGCAGTTCT
TCCCTGGAACACCAGCTTATCAAGAACACTACACTGTTCAGCACTCAAGTGTTTCGAAGG
CACTAGTAAGAGAATCATAGTAGACTTTGGAATCTTCTGTATGTAGCTGAATAGATACGG
TGTAGAGCCTTTATTTCTGTCACATTAAATGACTTCTTTAAAAAAATTTTTTTTTAGTTT
AGTTGGACACAATACCTTTATTTTCGTGTGTGCTGAGGATGAACCCAGGATCTTGTGCAT
CCTAGGCAAGCACTCTACTCCTGAGCCACAACCCCAGCCCAAGTGACTTCCTTTTTGTTC
ATTTTAATTTTGTGGTTGTCTTTGAGAGAAGTTTGCCTTGGTTTTCTTTGTTAATTGATT
CTTGCCGTTCTATCTGGTCTTTCTTGAAGAGATTTCTTTTTGTTGTTGTTGGGGGTGTTT
GTTTCTTTTGCACTGTAGTTTGAACAGAGAGAGAGAGAGAGAGAGAATTTATTTATTTAT
TTTTTTAAGCTTTTGGCAGATACAACATCTTTGTATGTGGTGCTGAGGATTGAACCCGGG
CCACACGCATTCGAGGCGAGCGCGCTACCACTTGAGCCACATCCCCAGCCCAGAACAGGG
ATACTTTACCACTGAGTTATAACCCCAGCAGTATATCTTCCTTCCCCCACCCCCACCCCC
TCCGCCTTTAAAAAATTTTTTTCAGACAGGTTTTTATAAAGTTGCTTGGGGCGTCTAAGT
TACTGGGACTGGTCTCAGACTTATTATTTCTCCTGCCTCATCCTCTTTTCAGTTGCTGGG
ATTATAGGCGAGCACTACCACACCTGGCTCTTGCTGGTTTGGGGAACAATTCAATGACTC
TATCCTGATCTTGGACTTTTACATTTGCTTTCCACTGTTTTTCTGTACTGGGCATTTTGA
GTATAAGACTTTAACCTAACACATCTCTACTTGGTATAATAGGTGATACAACCTCTAACT
TGAAGTTGAAAGACATGCTAATAGTAGAACCAAGATGAGATGGTAGCATATTTTTGCTTT
ATGATGCCCTTGGGGGAAGCTCATTAGAATCTGACCTTCTTTGAACATAGGATAGGCCTT
TGATAACAGCATACTGGATACAAGACAAGGTGACTGAATGGCAAAAAAGAGAGGCTAATG
CCAGTAGGCTGTGGCACTGGAAATGTGCTCAGTTTTATAGTCATTTGGAAGGAAAACACT
ACTTTTAAAAATCAAAGCACATTGTACTCATTCATGTCTTGAGTTTTGATAAGATCATTT
ATTTAATACCTTAAACCACAACTGTTTATTTTCAGATACCTATTGAAGGTTGCTGAACTG
TTTGAAAAACTTAGGGTAAGAATTTTTGTTTCTGTCTTAATAAAATATATATTTTGTAAT
CTGTACATAACTGCTTTGATAGTGACCTTTATTTTTTTAAATAGAAAGTGGAGGGTCGTG
TTTCATCAGATGAAGATTTAAAGCTGACAGAGCTTCTTCGATACTACATGCTCAATATAG
AGGCTGCAAAGGTGAGATGAGGAACTGGGAAACCCAACACAGTGCTAGACCACCTGTTGT
GGCCAGAAACCTAATGCTAGAGCTATTCCTTTTTTTTTGGTAAAAAGGAAAGTTGCTTTA
TAAGAGGGAGATAGGAATTTTATCAGACTTCTTTGTTAAGTGATGTGCCCTTTTTTGGTA
TTGGATCCATAAGTAGTATGCAGAATAAACTCCAATCTCTTGACCTGAGCATACCTTTTC
TTATTTTTATATTTGGACATTTTTAATGCTTTATACATTTTCATGGAATTAAGAGCTAAC
TTATAAAACTAGCTAGGTACAGTAGTTTCACTGAGCTTCAATAGTTTTTGGTGTTGAGGT
GACTTCTAATGATTGCAAAGAATCATTATTTCAAATTAGGTTAGTCCCTAGTATATATAT
CCAGAAGCAGGATTTGCAGGGTAGGGTTATGTGTAGTCCAGACTGCTTTGTTGCTTAGTT
GTATTCTTGAAGTATTCTGCTCTGACTCATCAGCAGTAACGTGATTTGTTGTTGTCATTA
TTAGATTTTGCTGCTATTTGTTTTGTGATACTAGAGGTAGAACCCAAGTGCCTCATGTTT
TGCTAGTCAAGTGTTCTAATTTTATTTTCTCTCTTGAGACTGGATTTCACTAAGTTGCTG
AGGCTGGCCTCAATCCTGTGATCCTCCTGCCTCAACCTCCCAAGTATTGGAATTAGGCAT
ATGTCACCACAACCAACTGTGCATGTGTTTTAGTACACAACATTGCTTTCAATTATTGAA
TCAACTAGAAAATAATCCTTATTTTTACTCTGTTGGATCATCCCGCTACCCCTGCCCCAG
GTACTGGAGATTGAATCCAGGGGCTCTCTACCAGTGAACAACATTCCTCTACCCTTTTAA
ATTTGGAACAAAATATTGCTGAATTGTCTTGGTTGACCAGGATCCTGGGATTCTTTCCCT
GCTGAGTTGCTGGGATTTAGGCATGCATCACCATGCCCCACTGTTGAGTTTTGTTCTGTT
TTAACCTTACACATAAAGAATTCTGGGAAAGCCCTCAAATATGAGTGGCATATCTCTGCT
AATCTTATGAGGGTAGATATAAGCATAAAGGTAGATTAGATTCTGGATTGTGTAAGCTAT
TTGGTATTCCTATTTTGTTCTCTGGAGATTTTTATGTTCTGTTAATTTTCTTCTCAGGAT
CTTTTATACAGACGCACCAAAGCCCTCATTGACTATGAGAACTCAAACAAAGCTCTGGAT
AAGGCCCGGTTAAAAAGCAAAGATGTCAAGTTGGCTGAGGCACACCAACAGGAATGTTGC
CAGAAATTTGAACAGCTTTCTGAATCTGCAAAAGAAGGTTGAGAGGAACATTCTTTACTT
ATTTTACGTTTTATTTGGAAAAGGTTACAGAGAGGAAAAATTTTTCAAAAGTGCAATAAT
ACCCACATGTCCCACATATCCTTTATCACTTGGACACTAACACTTTCCTTCACATGGTGT
AAACATGGATGTCTGGTGTTCCTAGTCCATATGAATATCCTAAAAACTTTGTTGGGTTTC
CTATCTAGTTATCCTAGATCTTAGTCTCCTTTATTAGGAAGTTTTTGGTTATTTAGTTTT
TGTTGTTGTTTGCAATATTTATATCTTTTAACTGTTTTGTAAAATATCTCTTTGTAAAAA
GATTTTTACAAATAGATTATAATGTTTGTGTGCATCTTCTTTCCAGTTGTGGTGTTCATT
TTGGTTACTTAGTCAAGTGTCTACTTTCTCCACTGCACTTAATATTCCCCATCACCTATC
TATAGGGGAGATAACTGAAGATCACATACATGTTCTGCTTTTCACTAAACTTCCCTGGGC
TCAGTGTGTATGATTCTTTCCTAACCAGCATTTAGTCTGATGGTTGCAATTAGATGATGC
CTCCTCCCTCAATTCTAGCATTTCATCTGCAGGTCAGCAGTTGCCTTCATACTACAAACA
AGAGCCCTGCCCCTCCATCCCTTTTAAAATATCATCTTAATTCTTTGTGGGATGCTGGGG
ATTGAATTTAGGCTCTTGAGCATGCTAACCAGGCCTTCTACCACTGTGCTATGGTGCTCA
GAGTGTCCAAACTTTTCCAATGGGAACATCTTGAAACTAGTATGTCTTTGTGACACATTA
AACACACTTTTTTTTTTTTTAAACAGTTAGTTGTTCTATGTAATCTGTAGACATTCAACT
CCAACCCTGGATTTGACCATTTTTCAAGGAGCCGAGGTTCTTTTTCTTAGGTAATAGTAG
CCAAGATTTGGGTGTGCTGGGGCACTTATTGTTTGGGGGTGTCTTTGCATCTAGACCCTT
TAGGAGACAGAATTGTGAGATGTAATTGCACACCTAGACAAGTTTTAGGGATCATGAGTC
TATCCTGATGACTTAATTCCAGTCTGTGTCCACTACACTATATTCTTTCTTGTTCTTCCA
GAACAGGGTTTTTTTTTTTTTTTTAAATCCTGGGATTGAACCCAGGGGGTCTTAAACACT
GAGCTGCCACATTCCCAAACCCTTTTTATTTTTGAGACAGGGCCTTGCTTGGGGCCTTAA
TAAGTTGCTGAGACTGGTTTTGAACTTGGGATCCTCCTGCTTCAGCCTCCTAAGTTTCTG
GGATTATAGACACGTGCCACCATGCCCATCCCTATCTCATTTTAAAGCATATTTGTCACT
GGACTTTTTGGTTTTCTTTTGGCCAGTGGTAGAGCCATTTATGTGTATTGGAATTATCTT
CATAAAAACATGTCTAAGTCTAGATTTTGTAAAGCAAGATGTCTGTGCTTTGCTTCTAAT
GCTTTGTCTGTATGGCAAAGAGCTTTTTATTGCAAGTTTGCAATTGCATGTAAATATTTA
TGTTGCTGGCTGTGTTGGATTGTTTCAAAGTATCTTTTTACTGCCCTAAAGTATCTTTTT
ACTGCCCTATTCTTTCTTTAAAAATAGATTCTATTTTTTTTGTTGTTGTTTGTTTGATTT
TTAAACTAGGGATTGAACCCAGAAATGCTCTACCACTATACTACCCTGTTATCTTTTATT
TGAAACAAGAATTTGCTGGGTGGTCCAGGCTGTCATCTAACTTGAAATCTTCCTGCGTCA
ATCTCTGAGTCTGTAAAGATTACAGATGTACTCCACCGGTTTAGAATTTTGCTTTATTTA
TTTTTTTCTTTAAGGCTGAATAATACTCAATTGTGTCTGTAATTCGTTTTTTTTAAAAAT
TTATTTGTTGTCCATTGATAGACACCGGTTGATTCCATGTCTTGGCTATTGTTAGTAGAG
TTCAAGACGCTTTTGACTGTTGTATTTTGAATAGAGTTTTTACCTTGGGATCCTCCTGAC
TCACTTTTCCCCACTATCTTGAGGGCAAGAGTGAGGCAGTTCTTCAGTGATGCTTGGTGG
TTGAGTAGTGTGTGGCCTGCTTAGGATCACAGTGACCAGAAGACAATTAGTGTATGTCCC
AGTCAGAGTGCTTAAGAAGGAGGAAATAATGGTGGTTTGATCATAATGATATTTGGAAGC
TACGTGAATATGAAAACTTAACATTTCTTGAAACTAGTATGTAACTAGTAGTATTTCTTG
GTTTGATAAACTTTAACTCTTTCTTCCTGTAGAACTTATAAATTTCAAACGGAAGAGAGT
GGCAGCGTTTAGAAAAAACCTAATTGAGATGTCTGAACTGGAAATAAAGCATGCCAGAGT
AAGTGTTTTCAAATTAAACCAATATCATTTTAGGTTCCACCCCTCTTTCCCAGTTCATTG
CCCCAATGTCGTCAGGCAGATAGGGTTTGCCGTGTGGTTTTAATTCCATGTTGTACTAAG
TAAATGGGAACCACCCATCAGAATATTTTTGTTACTGCAAATCAGAAATCCATATCTTGA
AACAGTTTACCTGGTGGGGGGTACTAGGGATTGAACTCAGGGCCACTAAGCCACTACTCC
CCCCCCCCCCTTTTTTTTTTAATTTAGAGACAGGGTCTTACTGAGTTGCTTAGCACCTAT
CTTTTGCTGAGGCTGGCTTTGAATTTGTGATTCCCCCTGCCTCAGTCTCCCAGGCTGCTA
GGGTTATAGGCATGTGCCACAGTGCCTGGCCTTGAAATAGTTTTGAGAAGAGCATTCTTG
GTTACGGCTCCCTTGGTTCCCCCTCACAGGGCTTGTGAGCCAAACTGACAGCCTGCTCTA
GTATTTTAGCAGTAAACTCTTTAGTATCTTGGATTTCATTGGCTTTCAGTAGAAACAACT
TTTTGTTTGCCAAGCTTCTTTCAGTATACTTTCTTGGTTTAGAAAGGAAGACAATCTTCT
GCTGCATATATCTGTAGCTTAGCACAGAAGCAAGAGAACACTGTTCTCAATGCTGGGAAC
ATGTTAGATCTAATGGGGTCTTTTGAGAGTTTTTGGTACCTGAGGGTATCTCCTTTGGCC
ATTCAAGGACTTGGCTTCAGACTGCTATGGACGAGGTCAGCCTGTCAACCTTAAGGACCA
TAACAGGGATTCCTCCCTTGGAAGGAACTGTCACTGGCCTTCAGTTTGTGCTTACTTTTT
ATCCAACCACTGAGCCACATTCCCAGTCCTCATTTTTTTTTTTAATTGGGTCCAGCTTTC
TGTTTATGACTTTTCATTGGAGTTTAAAGCATAATTTTGCATAAATCAGCCATGTTCTGG
GCACTTTTTTCTTTTTTAAGTTGCTTTTGAGGTGGTACTAGATATTGAATCCAGTGATAC
TCTACCACTGAGCTACATCTCCAGTCCTTTTTGAGACAGGGTCTGGCTAAGTTACTGAGG
CTGGCTTTGAACTTGCAAGCCTCCTACCTCAGCCTCCTGTGTCACTGGGATTACAGGTAT
GGACATTGATCACAGCTCTCTAATGTCTTTGAGGTGAGAACTTCGTAAAGCAATTTTTAA
TCTTGCCAATGACTTTTTATTTAGAGACAGTTTTTGAGGTGATCCTCTTATCTCAGCCTC
CCTAGCCACTGGGATTATAGGTGTGCAGTCACTGTGCCCGGCATCAACCTGACTAATTTT
TAAGCAAATCTTTATCTGGTCTATTTAAGGCCTTGTAAAGCAGAACAGGCATGGTTGCGT
TTGGGAGCAGATAGGGTGGGAGATGCTAGAGTAGTCCCAGACAGACTCTCTTAAGGGAGA
GAAACTCTCCAGATGAAATGGGTGGTGAGTAGTTTGTGTACTTTAATTGGGATTTAGAGG
AGAAAGATGACAACCTACTTGGGCTAGTTTTAGATCTCTATGGACATGCTATGTCAGTTG
AATTTATGCTTCATTCTTGAGTATATAACAATTTTGGTCTACTTTGACTTTGATGTTACT
TGTGTTTTTTTTTTTTTTTTCCCCAGAACAATGTCTCCCTCTTGCAGAGCTGCATTGACT
TATTCAAGAACAACTGATCTATCTGCCTTTTCTCTGAAGGAAACAAATGTGAAAACTGCA
TCACTTGCACTTAAATCATTACCATAGAATATGATTAGCTTTGACTTTAGTTTAAAATTA
TGTGAATAAATATTTTGATTTCTAAAAATCTTAACACTTAACCATGTTGGTTTAAAAATA
TTTTTATTGCATGCAGCTTGGATATAACTAATCTTTTCCTTATGCATTTAATACCTCAGA
GTGGGCAGAATCTAAATACTGGATTCTCCTGTAGTTTGTCTTCAGTTATATAAGAAAGGG
TATGGAAGACATGTGCCTTCTGGAAATATGTAGAAGCAATCACCAGGCTCATGTCTGTCA
TCCCGATTCATGTGCCCATGTCCCTACACCCTGATCTGTCAGGAAGGTGCCAGTTCAACA
AATGATAATAGCTACTTGTTACAGCTAACAGACATTCCATTCCTTCATTAGGGTTTTTTT
TTTCCTTGTTACTTTCATGTTTTTGAGTCACCTAAAGTGTTTGTATAATAACAAGGGCAA
AAAAGATCTCATTTATCTTTTTAAAAACCCTTTGCAGTTCCATTTTTATAGTTGGGATAT
AAATATTTGAGGGGAGAGAAGTATGTAGGGGTATATATAAAAATAAACAGTATGGCCTGC
TTTAAAGATGGCTACACAAGAAAGATGTAAGCTCTTTCCCTGATGTTGGGGGAATGTGTG
TTTGGGCTTTTGTTTTTTTATAAAGTATGCAATAAAATAATAAATCATACTACTTATGGA
GTTTTTCTGTGAAAAGATGAAATGCGTTTGCAGCTAAGCTAAGCCTTGTCTAGTTGACTA
CTGAGCCATCTCCAGCCCTATTTTGTATTTAGAGACAGGGTCTCACTGAGTTTTTGAGGC
GGTCCGTCCTTCTATCTAATCTTAATTTTTGAGGACTTTAGGCCAGTTGTTTAGGAGGTC
TCTTAATCCTGGTCTGTTTGTTCCTGTTTTTATTCAGGTTTGTATTTTTGACGGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1051, 9528..9632, 10479..10589, 11248..11369, 12877..13000, 13823..13918, 14862..14967, 15054..15082, 15084..15130, 16595..16634, 16724..16810, 17997..18156, 20432..20517, 22166..22216
1001..1051, 9528..9632, 10479..10589, 11248..11369, 12877..13000, 13823..13918, 14862..14967, 15054..15082, 15084..15130, 16595..16634, 16724..16810, 17997..18156, 20432..20517, 22166..22213
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved