Spermophilus_tridecemlineatus Locus NOL5A
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus NOL5A
Spermophilus_tridecemlineatus
NOL5A
GeneScaffold_3276
SNORD110, SNORA51, SNORD86, SNORD56, SNORD57
2034..2106, 2810..2941, 3829..3914, 4336..4408, 4664..4743
6834
AGATTTACTATCTTGAAATCCCAATGTTTTTTTTTTAAAAAAAAAAACCAGGGTATATA
CTACTTAAGAATAACCAGGTTTTGCGTTTATAATTTTAATATTAGTTATTGAAAGCAAAA
GTAATTTTAAAATCGTCACCCGAGTGCCAAAAGCCGCCCTACAGGACAAGAAAGCAGCTG
CCATTCACTCAGAGCTACTGGACGCGACACGAATTTAGGGCCGCTCTCCAGACTGTGCGC
AACACGTGGCCCGCAAAAGAGGCTGGTCCTGTGAAGCAAGGCAAGAAATCAGCCTAGGAA
GATATGGGATCGCCTTTCCTTTCTGCGGCATTGCCAGCCATCATCATTTTTTGATTGAAT
AATACTAAATAAAATGTAAAAGCATGAATAAGCCGCGAGAAGCCATGTTTCCTGCAGGGT
CTGCGTCAGAGCGCCCCAGGCCAGGCTCCGGTCCCTGGCAAGAGGGGAGGGCGCGCGGAC
CACGGGGTTCACGGGGTTCACTGGGTGGGGGTGGAGGGCACCTGCAGCCGGGGCGTGGGA
GAGTGTCTGGGGTCCCCAAGTCACCAGCGCGGCGGGAAGCCGGCTCTGAAAAGCTCCAGC
CTGGAATGCTCACCTTGGCCCAGATGGTGCCTCCCGCCCCCCGACTTCAAAGAGCTCTCT
CGCCCTCCACTTATACCATAAAACAGGAGTGATCCCACTACTAGGAAAAGAGCCTTTTCA
AACCGTTTTGGGCCTGCAGGCCAAGACGGCTTCCGCGCGTCCCCGGCAACCGCACCCGCC
CGCGCAGCCGCAGAGGCCAGAAAAGACCCGCTGGCTCGCGCTCGGCACCACCTCCGCCCG
CCCTCGCGGCCATACCACTCCAGCGGACCCCTCTGAAGTCCGAGAATGGTGCCTTCCCTA
GCCTCTGATTGGCTAATCGGTAGAGGGCGTGGCCTCTGGATCCTGGTTCCGCGCGCTAGA
GCCTGCTAGCCGCATTGCGAGCCGGGCAGGGAGCAAGCGCCATGGTGAGGAGTGGTTGTG
GGTTGTGGGTGATGTGAAGGCCGTGGTTTAGGTCTGGATTAGAGTTTGAGCCAGGGCCTA
AACCAGGGCCTGCTCTGGGAGCGGGGTCGGGACTCGTGGGCCTAGCTGACTTTTGCGCCC
CGACTCTCGTTCCAGGTTTTGCTACACGTGCTGTTCGAGCACGCGGTAGGCTACGCGCTG
CTGGCGCTGAAGGAAGTGGAGGAGATCAGCCTGTTACTGCCGCAGGTGGGTGAGATGGGT
GGGCTAGCCCGGCTGCACTGCAGCCCCTGGGGCCTTCGAACCCCAGCATGCACCGCGCGC
TCCCACGTGGCCGGCCGCGCGGGTTAGGGAGGGCTAGACAGGGAAAGCAAGCTCTGGAGC
ATGGGTCTTTACCCTGACTCACGGTTAGAATCGCTTAAGAAGCACTTAGAAATAAGCCCC
CAGATTCCGCCTCGAATGGGATTAAAGCTGAACCCGAGATGTGGGGGTGAGGCTTTGGCA
TATTTTAATAATGTCTAGGGCTGATAATTGCTACTCTGCTGCACCGCAGAGGCTAGAGTG
AAGGAAGTAAACCATACATCCTCTTTTGTCCCCACAGGTGGGANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCATGGTTGATCCAGGCTTTGCAG
TGATCCGACTTGTGAAATCTGTCAATCCCCTGAGTGTGATCATTGATGTCTCAATGTCTC
TGAGCAATGCCTGAATGGGAGAGGTCTAGGCATGTCATCCCAGCATGCTTCCAGGGGACC
AGCATGATCAGCTGAGCTTTTACAATTCAAACATCCTTCACCATCTTAGTGGGAACTATT
TTTTTGCCTTGAGGCATTGTTCATGAGGACCTCCGCCTGCTCCTGGAGACCCACCTGCCA
TCCAAAAAGAAGAAAGTGCTTTTGGGGGTTGGGGATCCCAAGATTGGTGCTGCTATACAG
GAGGAGTTAGGGTACAACTGCCAGACTGGAGGTGTGGTAGCCGAGATCCTGCGAGGTGAG
GCTCTCCTGCCATTTTTTGACATCTTAAAGAGGGGTCTAAAAACTTGCTTGAGGTTGCAG
CTTCCTGCTTGCTCACAGTCCTGCTCCCCTCTTAGGAGTTCGTCTGCACTTCCATAATCT
GGTGAAGGGTCTGACCGACCTGTCAGCTTGTAAAGCCCAACTAGGGCTGGGACACAGCTA
TTCTCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAACATGATCATCCAGTCCAT
TAGCCTCTTGGACCAACTGGATAAAGACATCAATACTTTCTCTATGCGTGTCAGGTAAGG
GGCCACCCTTGATAGTGGAGTCTTTGGCCTATAGTTTAGGCAACTATCAGCCCTCAAATT
GGGGCTGACAATCTTGTGGATAGAAAGTTCTTCTGAGTAGGCTGGAGCTGGGCCTCCTGA
TGCTTACCACAGGCTGTGTTCTTACACTGACTGTATAGAAAGGGGAGGCAGAGTAAGCAT
ACCCCATGTACACCTCAGCCCAGGCCCTGTGCCTGGTCTGCATTGTGAATGGGGAAACAT
GGAATTGCTGGAGGGATTTGAGTCTGACTTGTTCCATTTCTTCCAGGCAGAGTAGGCAGA
GAGGGCTAAAGCTACAGCTTTATATAGACATGGCAGCTAGGTCAGGAAGTGAATATCTTT
TGGCAGGGAATCGTTACGGGTATCACTTCCAGAACTGGTGAAGATCATCATGACAATTGC
CACATACTGCGCCTTGCCCAATTCATTGGAAATCGAAAAGAACTGAGTGAGGAAAAGTTG
GAGAAGCTGGAGGAGCTGACAATGGATGGGGCCAAAGCTAAAGCTATTCTGGATGCCTCA
CGGTCCTCCATGGGTCAGTGCAGAGCCCGGCAGCTAGCATAAGGTATGGGACTGAATATC
TGGCCCCTCTGTTCACACTAGGTGTTTCCTAGGCATGGACATATCTGCCATCGACTTGAT
AAACATCGAGAGCTTCTCCAGTCGTGTGGTGTCTTTGTCAGAGTACCGCCAGAGCCTACA
CACTTACCTGCGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGA
AGCGGTGCGTCATGGGGAATACAAAAGTGGGGGATTAGGATTATTACCATTCTGCACTGC
TATACTTCCTGACTGACCCACCATATATATTCCCCAGTTGTGCCTGATGGGGGGTAGAAA
GCAGGGGTTATTTGAATGACAAGTCAGCAATTCCCACTTCTGAATTCTTCCTTGAATCTT
TTTCCAGGTAGGTGCACGTCTCATTGCTCATGCTGGCAGCCTCACCAACCTGGCCAAGTA
TCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTATTCAGGTACCAGTGAGG
GCACCTGCCCATATCAGGTGCCACTTCTGGTGCCCTCTACTTGTTTGGGGATCACAGTGA
TGGCTGACCGGGGCTCCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCT
GGTGTCTGAGTGATTCCTAGGGCCCAGCAAAGGGACCAAGTTTCCAGGTCAGCGACATTG
TTTGCCTTCCCTCTGCCTCTGGGAGCTATGGGTTAGCTTGTGTTGGGGTCTAGCCCAGCC
TGAAGCACACTCTGGAGACTTGGAGGGGAGGGGATGGGAGGAGCTGCTAATGGGGTTGAA
ATTTCTGATCTTAAACTCTCTGCTAAATATTCTCAGAGCCCTGAAGACAAGGGGTAACAC
ACCAAAATATGGACTCATTTTCCATTCTACCTTCATTGGCCGAGCAGCTGCCAAGAACAA
AGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATCGATTGCTT
CTCTGGTATGGGTGAGGAGGTTGGCACTTATGGGTGAGGGGCTGGGAATCGGGGAGGCAA
ACTACCCTAGCAGCTTCTACAATGATGGTTAATATTTTTCGTCAACAGCAGTTCACCTAG
TGAGTGTTGATAACTCTGGGTCTGAGTAAAGCTGAGGGTAGAGGGAATACTGGGAATGGG
GGTGGGGTAGTTTGTCCCTTTGAGGGCTGACAGGTTTTGTTAAACACACACACCCAGAGG
TTCCTACAAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTTGAAGAGCGCCTGTCCTTCT
ATGAGACTGGAGAGATTCCACGGAAGAATCTGGATGTCATGAAGGAAGCAATAGTTCAGG
TCAGTTTGGGCTTTGTAGGGTGGTAGAGAACTCTAGGTAGCTGTTGGAGATGATGAACCA
TCTTGCTTGGCCTGACCTTGTGAAGTGGAGGCAAAAACAAAAACTGATTTAATGAGCCTG
ATCCAATAAAGAAAGAGGTGACTATGGTAAGCCAAGATCTTCAGGCCTTCTCAGAACTTC
TTTTTTGCCAGGCAGAGGAAGCGGCTGCTGAGATTGCCAGGAAACTGGAGAAACAGGAGA
AGAAGCGCTTAAAGAAGGAAAAAAAGCGATTGGCTGCACTTGCCCTGGCATCTTCAGGAA
ATAGCAGTAGCACTCCAGAGGAGTGTGAGGTCAGTCCACCAGATCCACTCAGAGAAGTTT
TTAGGTTGGATTCTCCCAGCAGAACAAAGGATGTGCCATGTCAAGCCATGGTCTGGTGTC
CAGGCTTTTGGACCAAATCTCTTTAACTACCTCTTGATTCTGTAGGAAGGAGATAGGTGC
TGAGAGAACTTGCTCAAGAGCCCAGAGCTGGCTGTAGCACACACCTGTTTCCTGGGCAAG
TGTGCTCTGTCCTCCGCAGCCTCCCAGGAGTCCTCAACCGGGGGTAGTATCAATGCCTGC
TCTTGTTCTCAGATGTGTGTCCAGAAGTTTGTGTTCACAGTGGGGGTGGGGACAAAGGAG
CTAGCTCTTCAGTGCACCAGGTTAGAATCATTTCCTGTTTTCGTTTTTAGTGCCTTTTGT
GACCATTTCAGTCTCTTCTCTGGAACTTACATGATCACTCTAGTGTAACCAGCATGGTTT
CCTATAGGTTACTTATACAAATTTATTTAGAAAATTTTTTACAAGCCTTCCAGTTCTGAC
TTCTGACAGTAGATGTCCAAAGTTAGACCCACACCATTAAACAACCATCCCAAAAGCACT
GGGCAGTTGGTTTTCTGCTGCATCTTAATGGGTGGGGGGAATTGCATATACCATAGATAA
CACTGTCCTTATGCCTGTTTGCCCCTTTTCCCCTTTAGGAGATGAATGAAAAACCCAAAA
AGAAGAAAAAACAAAAGCCCCAGGAGGTTCCTCAGGAGAATGGAATGGAGGAGCCATCTG
TCTCTTACACCAAACCCAAGAAAAAGAGGAAATCTCTTTTCCAAGGAGGAGCCAGTCAGC
AGCGGCCCTGAAGAGGCTGCTAGCAGCAAAACCAGCACCAAGAAAAAGAAAAAATTGCAC
AAAGCATCACAAGACTAAAACGGACATTCCTTGGGGGGCAGGGGCATACCCCAAGGTGAC
TTCCCACCCCATGTCCCAAACCCCAATAAAAACAAATTCACAAAAATTGATATGCATGTT
TTATTGGTAAACACCTTACAGGACCTATGGGTGGGGTAGGGCAGCAATGACAGCCTCAGT
GAAGTCGTGGCAAGTGGCATAGCCACCCATGTCAGAGGTTCGAACCTGTGGGGGAGAAGT
GTCATCATCCTGTGACCTAGGTCCCACCCCTTATCTTAAAGCCCCCACCGTCCAGTATAA
GTTCCCTAAGGAAGCCAGCCCCAGGACAACCTAGGCTCTGCCCAGAAATTAATTATGGTC
CACTGTCTAGAGGTTCAAGGTGTCTTCCCTGGTCCACTGTACTGAAGGGTATGGTCCTTG
TGAGGTTGGAGGGAATAAAGAGCTCTAGACCCCATGGGGATGCAGGTGGCCGATGACAGA
CTTGATGAAGTCGGTTGTGGTGCTGTAGCCGCCCATGTCTCGAGTCCGCACCTACAGCCA
CCATCAGCAATAGCCGTGGGGAAGAAGAGAAGAGAGCCCGTGAAGGGAGATAAGGGCAGC
GTAGTCAAGGAGATGGAACCCAAGAAAACAGATGGCCAAAAAGAAGATGCGATGCAGCAG
GGATGAAAGGAGGTAGCCAGGTGAGGAGCAAATTGCCCACTCTTCTGAGCCACTAGGAAA
ACTGCTGCAAGGTAGGATGGAAGGCTGAGCAGGAAGTGAGATGGGGAAGTGCATATCAGG
ATGAAGTTACCTTGGAGGAAATAAGGAGACAGACCAGGTAGGAGAAATGGAGATGAAGAT
TTGGCTCCCAGCATGACAAGATGAAGCTGTGCTCATCTGACTGCTCTCCCTCATTGCTCC
ACCCCCAGAAGAGAGAACTGCAAGTCTGCATTCACATGACATGAAAAGGGCAATGGATGG
AGCAGCAAAGAGGGAACAGCAGATGGGAACTAAAGGAGGCAGAAAAGACCAAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1155..1244, 1597..1600, 1753..1863, 2233..2394, 2495..2693, 3066..3070, 3072..3085, 3088..3108, 3111..3115, 3117..3126, 3129..3252, 3332..3483, 3667..3767, 4116..4264, 4497..4618, 4811..4948, 5618..5734, 5736..5834
1001..1003, 1155..1244, 1597..1600, 1753..1863, 2233..2394, 2495..2693, 3066..3070, 3072..3085, 3088..3108, 3111..3115, 3117..3126, 3129..3252, 3332..3483, 3667..3767, 4116..4264, 4497..4618, 4811..4948, 5618..5734, 5736..5834
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved