Spermophilus_tridecemlineatus Locus RPL5
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus RPL5
Spermophilus_tridecemlineatus
RPL5
GeneScaffold_1976
SNORD21
5582..5676
5874
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGAT
TCGGTTTTCGGAAGTGAGATGCACAGTATTCAAGGCACTGCTGAATTGTTGTGGAGCAGT
GTTTCCCCAAAAGGAGGTGCAAATGATTTGGATGGTATTAGGGTGTGAGGGAACAAGTAC
AGAAATTGTGATAGGCGTTTTAAAACTTTTAAAAATAAATGTTACAAGATCTTGTACCCT
GTTGAATCTAATTGAAGCTTGCATTTTATCAGTTTGTGACAGATGGAAAGCAGAAGAAAA
AAGTGTTACTTCAATTGGTTTGAAAAGTGAGATGCTATGAAAGTTGACAGTTGTATGGAT
TTGCTTTTGAAAGTACATGATTAATTCGTGTTTAAAGTGTCATAGTCTAAAACATTTATT
TAAGTTTTAAAAACATTCTTTTTTGTTTGTTTTTCTTTAAGGGGTTTGTTAAAGTTGTGA
AGAATAAGGCTTACTTTAAGAGATACCAAGTGAAATTTAGAAGACGACGAGGTATGGGCA
GTTTTTCATGTTTTCAATATTAAAAGAATCTGCTTTGTAATGGAAATATTCCTTCTTAAG
TTATTATGGTTTTTCTTTCAGAGGGCAAAACTGATTACTATGCTCGGAAACGCTTGGTGA
TCCAGGACAAAAATAAGTACAACACACCCAAATACAGGATGATAGTTCGTGTAACTAACA
GAGATATCATTTGCCAGGTAAGTTGTAGCCTAGGATCAGACTGTGGGTGATAAATCTTTT
TTCACTGAGCTAGAGAAATTGTCCTTGGGAAGCAAAGCACATGGGTTAAAGGGCCATTTT
GTTCCTCCAGAAACATTGAATAGTTTGATTCCTTTTAATAGTAATAGAGTGAGATAGTAG
GAAACTGATATTAAAACACGTGTACACACACAAATTTAAGAGTCTTTGGAAAACTTGACC
CAGTTTAATTTTATTCCCATTTTCTAATTTGGGAAAAAGACTTAGAGAAACCGGTTGTAT
GGGGGTGGGGAAATACATGAGACAAGTATTGCCATCCCAGTTCCAGACTAAATCCTGACT
TATGTTATATGACCTTACATGCTGTTTAACTCATTGTAAGAGTTAAGTGAAACCCAAGAT
TGTTTTTATTTCTGCTTATTGTTTGAAATAAGTTTTAATAAAATGTACCAAAGTGACTTG
CTTAAAAAAGATCTTTAAAATGTAGTTCCCAGAGTCCAGTGTTCAGGACTTTTACAACTA
GGGAACATTTATAGGTGGAGGGATATTTGGGATAGAATACAGGGCCTTGTACATACTGGC
AAGTGCTGTATCACTGAGATGTATTCCTAGATCTTTATAAGAAATTTATTTTGAGACACN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTGTGGA
TGGAGGCTTGTCTATCCCCCATAGGTATATAGTATTCAGACCTCAAATATAACTAATACT
TTCCTGTGTTTAACTGGGTGGTGGAGATTATCAGATCAATAAAGTTGTTATCATTGAATG
CCTGCTCTATGCTAGGTACTCTGCAGGAAGGATTTCTAACATTTTATAAATGATGACACC
AAGACTCAGAAACAGATTTGTCCAGGGCTTTGATGCTAATAAGTGGTATGGAAAGAACTA
TCTTTTGCATGACTTGATTTCGATCAGAAATGAGCAACTCCATTTATTTCCCCTCCCCCC
CCCAGAATTTTTTTCCCATTTAGAATAAAATTTGACCTAAACTTTCAGCTGGAAATAATA
TTATACATGGCAGGCCATTCTTGAAAGTCAAGTAGGTTATTGAATTGCTAATTCCTTTGG
TTTGAGTTAATATTTTGATTTTGTTTGTTGTTTTGCAGTAGTAGGGAATGAACTCAGGGC
TTAATACATGCCAGGCAGACACTACCTCTCAGCCACATCCTCAACACACATTTTGATATT
TTAATTTATAGCTTTTTTAGTGGTTACCTAATAAGAAAAAAAAGTTTGTGATTCTTGTTT
GTTTCACTTTTATTTTATACATTTTATTTATTTTGGGGGGTAAGCCTAAATTAAAATTGA
ACTAAAACTGGGTGTGTGTGGTAGTATATATCTGTAAGCCCAGCTACTTAGTAGGATTTG
CAGGTTCAGGGCCAGCCTGGGAAACCCAGACCCTGTCTCAGAATTAAATAGGGCTGTGGA
TATAGCTGAGTGCATAAGGTCCTGCATTCATTCTGTCTACAACAATCAAGCCTCACTATT
AAAAAGAAGCTAGTGAAGTGCAAGTGTACCAGTTGTATTCTCGTTAGATGATTTCATTAA
TTGTGATCTTGGACAAGTCTCCTATTCCTCCCTTATCCTGAGGTACCTTGAGAAATTATA
GGATTTGCTGGATACGTTTGAAATTGCTTTCCATGCTAATATGTAGGAGAACTTCTATTA
ACAGAAAGCCTTGATATAGTTTAAAGGCATTTGTCACTGAGTAGGGTGGGGCACTTAGTC
CAGGCAACTTGGGAAATAGACAGGGGAGTACTTGAGTCCAGGAGTTTTAAGACCAGTCTG
GGCAATGTCTCCAAATAAAAGGTGTTTGTGGTATGAATTTCTTTGGAATTCACAGATGAG
CTGCTGAATGATGATATCCCACTAACTGAGCAGTCAGTAGTTGGTCCTTTGGTTGCATAT
GATGCAATAATTGTTTCAAGACGGGACTGATGGCAGCTACTGAAATGAATTCCTGTGGGT
GAACAAATTTCAGTTAATCTATACTAAAATATAAAAAAACTTTATTTTAGTACCAAACGA
TTCCCTGGTTATGATTCTGAAAGCAAGGAGTTCAATGCAGAAGTACATCGGAAGCACATT
ATGGGTCAGAATGTTGCCTGTATAAGGATGCGCTATCTAATGGAAGAAGATGAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 1161..1276, 2992..3126, 4201..4403, 5750..5870
1001..1070, 1161..1276, 2992..3126, 4201..4403, 5750..5870
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved