Spermophilus_tridecemlineatus Locus GNL3
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus GNL3
Spermophilus_tridecemlineatus
GNL3
GeneScaffold_92
SNORD19
1166..1243
5466
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTCTCGACCTGCACGAGTGAGG
TATGAGGAAAACATCTGAACAGTCTTGATTGTCACTGAAGACTGATAAGATCCAACTCTG
ACCTCAACAAAGCCAGAGCACGTGCACTGTAGTTGCCAAAGATAGCGCTGGGTGGTGGGA
AATAGGTTGTTTCCACAAGTGATAGGACTGTTTTTTCCTATTCTTTTGCTATTTGGTACT
TTCATGTAAAGAACTGTTGAGATTTGGGTGCAGTGGTGCATGCCTGTAATCCCAGTGACT
TGGGAGGCTATAGTAGGAGGATCATGAGTTCAAAGCCAGACTTAGCAACTCAGTGAGACC
TTGTCTTTAAATAAAATACAAAAAAGGGCTGGGATTGTGGCCCATTGGTTAAGCGCCCCT
TAATCCCTGGTTTTCCCCTTCAAAATGTGATGACAGTGTTCAAAATTCCTGCCACCTGCA
CAATGTTGAGTATTAGATCAAAGCAAGTGAAATTTATGTGACAAATATTTAAATGAAAGA
TTGTCTAAGTTTGAGCAGTGGAAGGGTGAAACCAGAAAGTAGAAACCAGAACAGAGACTC
TTTGAAACATAATGTAAGAATAATCACTGTTAAGGTTAGAATCCCAGGTTGTTAAATTAA
TTGAGGGTAAATCCTGGAAATAACTGTAGGGTATAATGTAGAGGTTGACTTCAGTTCTGG
AAGGTTGAGCTATACAGGAGGAACTGAAATACAGAAGTGTAGATATTAGGATGAGGGCAG
CTTGCCCTTCCCTCATTTTCCATTTAAATCCTTTTGAAAAAAGGCAAACAATAGTGAAAT
TTAAATTGAAGAATATGTCATATTTGTAATTCCTATCAGATCTAATACCAAGGGAGAATT
TGGAGAGCTGGCTAAATTATTTGAAGAAAGAATTGCCAACAGTGGTGTTTAAAGCCTCAA
CATACCTGAAGGACAAAGGGAAGATAACCAAGGTACACTTTACTATTAGTGGTGAGAAGT
GTGGTTCTTTCAGATTTTCAATGGTTGAAATATGATGAGTATGCAAAATGTTGATTTTTA
AAAAATGAAAGACAATAAGATCCAACTCTGATTTCATCCAGAGATATCTGAAAGGCAATT
GTCTAGTGATGCCAGATTTCTTGGGTTTTATCTATTGTCAGAATAATTAAACTAATGTAT
TTTGAATTTTAACATGTCAAGATGAAGAAAGTTGTTCCACTCAAACATAAAGTGTGCTTT
GGCAAAGAATGCCTCTTGAAACTTCTTGGAGGTTTTCAGGAGACTTACGGCAGAGCTATT
CACGTTGGAGTAATTGGTGAGTTTTAATTCACCACATTCTACCTTTTTTCTTGGGTCAAG
AACTACTTAGCAGGTCAATATGCCTGTAATCCTCAGCAGCTCAGAAAGATAGGAGAGTTC
AAAGCCAGTCTCAGGAATTTAGCAAGGTGCTAAGCAACTCAGTGAAACTCTGTCTCTAAG
TAAATATGGATTCGGGCAGGGGGTGTGGCTCGGTGGTCTAGTGCCCCTGAGTTCTAATCA
AATTTCAAGATCTACTTAGCTGATATTAAGTGACAACAAGGTTATGAAATAGTTTACTCA
AAAATTAGCTCTTGATGGGGCTGGGGATGTGGCTCAAGTGGTAGCGCGCTCGCCTGGCAT
GCGTGCGGCCTGGGTTTGATCCTCAGCACCACATACCAACAAAGATGTTGTGTCCGCCGA
GAACTAAAAAATAAATATTAAAAAAAAAAATTAGCTCTTGCCCCATTTACCACCATACAA
AAGATTTAGAGAAAAATTTACATAATTGCGCCTAAGTTCAGTTCACTGTAGCAAGTTGGC
TCATGGTAGATATGGATGTAGCTCAGTGGTAAGAGCACTTGTTTTTCATGTGCAAGGCCT
TGTGTATGCAAATGAATACATACAGGCATACTCCTCCTTTATTTGCATTAATAGTATTTT
CCTGCCCTCTTATTACTTCTGTAAGGAATGAAGGAGCTAATTATTGGTCCTAGTGTTGCG
AAGACACTCAGATCCAACTCTTGCTCTAAACATCGGGCAAACATAAAATTGTGCAGAGGA
AATTTCATAATGATCAGTCCATACTGTCTTTTATATCTGAATTATTTATTTGTAGGTTTC
CCAAATGTAGGCAAGAGCAGCATCATTAACAGCTTAAAAAAAGAGCGGATATGTAATGTT
GGTGTTTCCATGGGTCTTACAAGGTAAATTATGGTGTTCTATAACAAAGAATTTTTCTTA
CAGATGAGTAAATATGATTTTATTATCCAGAGGATGGTCATTTCCTTTCAGTAAAGAGGG
TGGAACCAGCGGTGTGCTTGGGGAAGAATTGATTGGAGTGGGGTGGCTGCTTGCAATATA
GTTTTAAAGACAAATTAAGCAACTAATTTGAGAGAGAAAAGAGCCGCCTCCGAGAAAGTG
ATGTTGCACCTGGCTTTGGGAAATGAGAGACAGGTTGCCAGGTAGAAAAAAATGACAGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGGAGGCTGCCAGTGCCATCCTGTCCAGGCTGATGCTCGACAGGTAAAGAC
TCCTTCCCCTTCTATTGAGCTCCTCATCACCATTTTGTAGTATAAGCATTTTAAATAGAT
AATTTTTTTTTCATTTACTCAATTAGTCAAATGAAATTTCCTATTTTGCTTTAAGGTTGT
ACTGCATTATACTGTCCCAGACTATAAGAATTCTCTGGAATTGTTTACTAAACTTGCTCA
GAGGAGAGGTCTGCACCAAAAAGGTGGAAGCCCAAATGTTGAACGTGCTGCCAAACTACT
GTGGTCTGAGTGGACAGGGTAAGGATTCTATTGGCATTGTTTGAGTACTAGGGATTGAAC
CCAGGAGCTCTCCATTGCTGAGCCACATCCATCCCCAGCACGTTTGTGTGGGTGGGTGTG
TGGGGGGAGAGGGGGAAGTACCAGTAATTGAACCCAGGAGCACTTAGCCACATCCCCAGC
CCTTTTGTTTTTGTTTTGTTTTTTTGAGACAGAGTCTTGCCAAAGTTGTTTAGGGCTTTG
CTAAGTTGCTGAAGCTGACTTTGAACTTGGAATCTTCCTGCCTCAGCCTCCTAAGCCACT
GGATTCACCTGGCAGTAACTGTTTTTTTATAGATCCTATTTTTAATTTCAGTGCCTCATT
AAGTTACTATTGTCATCCCCCAACTTCCTGGACTCCTCCTCCACATTTTAATGAAAGTAT
TGTGGCAGGCATGAAAAGGGGCTTAAATCTTGAGGAACTGGAAAAGAGCAATGCACATAG
CATAGAAGGTGAGAGAGACTTTTGTTTCACTGCTTATTTTCATCTGCTTAAAAGATCTTT
ATTAGGTCATATCTGTTTATATGGTCTTTTATTTTCCTTTACTAGCCATCAAGGGCCCTC
ATTTAGCCAAGAGCATACTTTTCCAGTCTTCGGGTCTGACAAATGGAGTAATAGAGGAAA
AGGACATACCTGAAGAATTACCAAGACAGAGAGAAAGAAAACAGGAGGAGGGGAAGGATA
ATGAAAACATGGTCAGTGAGGAAGAGATTGTTGACTGTGAAGAAGCTGATGTAAGTGTAT
TCTCTCTCTGAGTCAAAGTGAGTTTTCTGGTATTGTAACAAGTGTACATTCAAAGACTAT
TAAATTATCTGCATCATTTCTTTATCCCATAGGAAAAGATCTCAGACATGCCTCCTATAG
AAGAGAAAAGAGAGCCACCTCCACCTGAAGAATCTACAGCAGGTGAGCTTGAGGCTAAGG
ACTTCTAACAAAGTAGCTTAAGCATAGAATTGCTTTGTAAACCTCACTTTATTTTTCTCC
ATTTCAGGTGAATCTGCAAGCTCTTTAAACTTGGATAAAATGACTCAAGAAGATGATGCT
TATGATTTCAGCACAGATTATGTGTAATAGAAACTTGTCCTTTGCTTAAGATGTTAAGGA
AATCCTTATAAAACTATCAAAATGTTCTGTGTATAATGTGCCAGTTTTGCCATGACAAAG
TGTAAATTTTGTGAATATGTGTTATGATGTATACATTAATACAAATACAGTTTTAAAAAA
TATATACAGTGGTAGAGCACTTGCCTAGCATATGTGACACACTGGATTTGATTCTCAACA
TTGCATATAAACAATAAAGGACCATCAATGACTAAAAATATATATTTTTAAAAAATTTAC
ATTGAACTCCTCTCTTAAACAGTGAAGGGATAGAAGTATTTATCTAAAAGCAAAGAAGTC
TACTGAAAAATGTAGGTTTATTTACAGATTGGGCCACAGGTTTACAAAATTAAAACCAGG
CAGCAGTTTTGAGCTAGCCATACGAGCTAGCTGAACTGGTTATATCAGTCTTACCAGTTC
TTTCTTCTGGCCAGTCAGCACTGTAGTAAGCAAACAGTTGGTAAGACAGATGGAGACATA
TTTTTAGTCTATCTGGGAAGCTGACTGCCAGACAGGGCAATTTGTCATCTTTACTGAGCT
GAAACATCTCTTTTTCCATGGGTTGCAACAAATAGGAATTGAGGCCTACCAACTGTTACT
TCCCACACTGTTACTTTCAAGGATTTCTTGAGAAATGCTTATAGTTTTAAATTCTAGTTT
ACTTTATGTTTGCGATCTCCATATGTCTTCGGATTAGGCTGAATTTGCCTGTTGGATCTG
GAATATACCATTTTTCCCAAACATCAGTATATGAAGCAGTTCTTCCCCATGGTTTAAAGT
GTCCATTCCAATGGAGTAACTTGGCAGCCTTTACAAACTGAGGTGAATACCGTTTTCCAG
CACTGGAACCTTAAGAGAAAGAGCCAAATGATTATACCTGTCAAACACAAGGCAATACCA
TGCCAAACAACTTGAAACAGTGTTAAGTCCAATTCTTGAAGGTAGTTCCTTCCTTGGACA
CTTAATC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1111, 1332..1455, 2275..2362, 2788..2919, 3070..3094, 3097..3111, 3235..3377, 3711..3847, 3945..4129, 4232..4301, 4387..4466
1001..1111, 1332..1455, 2275..2362, 2788..2919, 3070..3094, 3097..3111, 3235..3377, 3711..3847, 3945..4129, 4232..4301, 4387..4463
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved