Spermophilus_tridecemlineatus Locus PABPC4
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus PABPC4
Spermophilus_tridecemlineatus
PABPC4
GeneScaffold_2166
SNORA55
9467..9599
16332
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCTTAACCTCCGGGAGCCGGGGCCTA
TATTCTCATTAGAGAGAACGCGTGTCCCCAAGGCCGCCGTGGGTAGCATCTGGTTGCCTC
TTGAAGAATTTTTGACCCCAAGGAAGGGGATTCCCCGCTTTTATTCCTCTTAATTTTTGG
AATTTGGAGCTTCGAGCCAGGACAGCTGGAAACTACAAACTCCCGGAGAGGGCCATATTG
TTTTTGAGAGCCTTTGTCTGAGGTTTTGCGGTCCCGTGTGAGCTGCCCGAACTCTCTCGT
CCTGCCTCTGAGCCTCCCTGCTGCAGCTTCTTCCCAGCCTCGCTCTGTGCCACCTGTGAG
CCGCGGCGTGGGCCACGGCTCCGAGAGAAGCCCCTTTTGTCCTGCGGTGGGCCCCGTAAG
AAGTCCTCCTGGCGGGGCTCGGGGTGGTGGGGGGCGGGGAGATGAACGCTGCCGCCAGCA
GCTACCCCATGGCCTCCCTGTACGTGGGCGACCTGCACTCGGACGTCACCGAGGCCATGC
TGTACGAAAAGTTCAGTCCTGCCGGGCCTGTGCTGTCCATCCGGGTCTGCCGCGATATGA
TCACCCGCCGCTCGCTGGGTTATGCCTACGTCAACTTCCAGCAGCCAGCCGACGGTGAGT
AGAAGTCGTGCCTACACGTTCGTAGGCTCTCGGGGGACATTAAGGGTCATCTCCTAAGGA
GGGCCCTCTTGCCAGGGAGGGGGCAGCAGGACAGCATATTGCCACAGAAGCCATAGTGGG
AAGCAGGATGCAGGTATTGAGCACATAGCTTGGCTTGTTTCCACAGCCAGAGTTTGTCTT
GATTCCACCACTTGCCAACTAGATGACCTTGACTAATGGTGGTAATGGTGGTGGTCGGGA
ATGCTAGGAAGCTGTAAATCCGTATCTGAATGAAGTGATTTTTGTTATTCCCGTATGTCT
GGTTCTGTCCAAGTTAGGTTGAGCGGTTGCAGAACCTCCCTGGCCTGGCCAGTGGTCATG
GGCACGTGCCCCTCAAACACAGGCCTATTAAAAAATAGTGCCCTGCAGAAGTTTCAGATT
GCAACACTGCTAGCCCCTCCCACCTTTAACTTGATTTTGTGCTGATAAGGGATGGCTTGG
GGCAAGTAGGAAGCAAAGGAAACAATCTTGTACATTAGCCTCAAGGAGCTTAAGTTGGTG
CCACCAGCACTACTTGTGCTGGGCCAGCTCCTTACTCTTTTCAGAATCTTTTTACTTCAT
CTCATCTGAAGAAAATAAGACTCCAGGGAAGGAAAAGGAACTGCAAAAAAGTTCAGGTTG
GGACTCCCAGTGCAGAGTTCTGCCACCCAGATTGTCTCAGCAGTGGAGAGGTATGCTGCA
GGGCGTGGCACAAGTGAGCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCACGTGACTCCAGATTAAAAGGGAACAACTGCAGAGACCATTACTGGGAGAAAC
AAGCAATTTTGTGTCAAAGGATCTTCAGGTCCCTGTTATTTTTGTCCCTACTTTGTTCAC
TGTCCATGATGCAGAGAATGTTACTTGCCCAGCTTATAGCTGAGAACAGAGAATTGGACT
AGTTGACAAAATATTGCTGCTTACTATCAATCCAGTGTACTCTGAGCTGTGTTATGTCTT
TGAACACAAAGGAGGTAGCTGAATGTGACTTCTGAGGTGGGGTATTGGGTAAGATAGCTG
TTGCCTGCCTCCTTGGCTCTTCTGAATAAAAGTCCTGTCACTTGGAGATAGCAGAAGCCA
TTGGTCAGTGTGTCTGCCAACACATACCTCTGTAGGACTTCTCCATGCTATAAATAAGTG
TAGCCAAATTTGTCAGACTTAGCCAGACTTGCCCTATGCAGTACTGTCTGGAAATAGACC
AGGACCTGTGTTGGAATGAGTTCCTTTACTGCTAATTAACAAAGTAGTTTGAGGTCCCAT
GCTGAATTTATCAGGTGGCCACCCAAGCAAACTTGTCTGTACCTGGACTTTTCTGGCTTG
GATCTGTACTGTTGTCTCCCCTTCCCCAGTCATCCCCCATACAAATGTGCGCACCTTCTG
AGGAAGGTGGAAAATTGTTGGAAATGAGTGAAAAGATTCCTTTTTGTTGATTGGATAGAT
GAACCTGTAGAGGGGCAGAGTTGGAGTTTTGTCCCCTTTTTAAATGAAATACTTTGAGGC
AAGGAATAATTTCCTGCACTCCTTTAATTCCTTTGTGGAAGGGGTTCTGGGTGATGTCAT
TTATTTAGTGCAGTCACTGAGATAACAAGGACAAGTTGCCACCAATGAAGGAAAGGAAGT
GTTCTGGCATTCAGGTGATGGGTTACCTGTACATAAACATGCACATATATATATAGCCTT
TGGTCCTTTACATGATCTTGATTTGGAAGCTAAGGAAGTGCATGGAGAATGCGGTCACCA
GGGCAGTTGAATTCCTAGAATCCATACAACTTAGATTAATGCTTCCAAAGGCCTAGACCC
CATCGAGTATAGGCCCTCCTGAAATTGAAACTCTTAAGAAACTGGGCTGATACCAGACAC
AGTGGCGCACACCTGTAATCCCAGCTATTTTAAAAAGGACCAGGAATGTAGCTCAGTGTT
AGAATGCTTGCCTACCATGGGGAAAGCCCTGGATTTAATTTCAAGTACACTAAAGCAGCT
GGACTGAATTCAGGGATGGTATCTGAAAATGATAATTTCTTAAATACTATATATAGTTAG
CTGCACAACTTAGCCATCCTGCAGAACACTTGCCTGCCGTGCACCAGACCCTGGGTTCAA
TCATGATAATTACAATCATCCTACCTGAGTCACTGTGGACATAGGCTGCAAAGTCTCTCT
AAATGATAAAGCTTAGTCAAAAGTGAGGTTGTATCTGATCTTGGTGGCTTTGAAGGCTGT
TTCAGCAGGGTTGACTTTTGTCCGTGATTACCTAGAAAAACATTGGTGTAATCTGTTCTT
GTAATCTTATGGCAGTCACCAGAGTTGATGTTTTACATCCTTGATTAAAATGTGTTTCTC
TATTTTAGCTGAGCGGGCCTTGGACACCATGAACTTTGATGTGATTAAGGGAAAGCCAAT
CCGGATCATGTGGTCTCAGAGGGATCCCTCTTTGAGAAAATCTGGTGTGGGAAACGTCTT
CATCAAGAATTTGGACAAATCTATAGATAACAAGGCACTTTATGATACTTTCTCTGCCTT
TGGGAACATTCTGTCCTGCAAGGTAAGCATGGATAAAGTGATTTCAGTGGAATAATTGAC
ACTTAAAATACTAAATGGGAAGCTAGCTTGGAATGGGGGTCAAGGGAGTATATGGTAATT
TTCGAAGTGCTGGAAATGGAATTTTTAAAGTTCTGTATGTTGGGGCACAATCCAGTATAA
CCAGTGGGTTCTTTCTGGTTCATTTATTCTTCCTTATCCTGAAAATTCTTTTCTGTTTTC
TAGCTTTAGAAGCTCAAAATGTTTTTGTTTTGAATAAGGGAAACGTGATGACCAGAGAAG
TGTGTGTTCTCCTGGAAGTTCTGCTTAAACCATTTTAAAATCATAAATTCAGCCTCCTCT
TTTTTTGGGGGGGGTACTCAGGATTGAACTCGGGCCCTCAATCACTGAGCCATATCCCTG
GCCCTATTTTGTATTTTATTTAGAGATGGGGTCTCACTAAGTTGCTTAGAGCCTCACCAT
TGCTGAAGCTGGCTTTGAACCTGTGATCCTCCTGTCTCAGCCTCCCAAGCCACTGGGATT
ACAGGCATGCACCACTGCACCTGGCATCCCCAGCCCTTTTTATTTCTCTTTGATACAGGG
GCTCATTGAGCTTCCCAGGCTCATCTCTTGAGTCAGTAGGTTTGGAGATGTATACCACTG
TGCCTGGCTGTCTCCAGCCTTTATTTTTATTTTGAGACAGGGGTTCACTAAATTACCTAG
GCTGGTTTCAAATTTGCAGTCATCTTCCCTTGGCCTCCCAAATCTGGGAGTATAGGTGTA
CACTACTGTGCCTGCCTTCTGTTTATGTGGAGTGCTTTGTGAAACATACATAATGATGGT
TTATATGCTTGACACTACACAAAACTAAAATTCTTCTAATAAAAATGAACAAGAGATTAT
TTGGAAACAGAAGCAGCCTACTGGCAGTAACCATTTATGAGTAGTGTACATGCAAGGTTC
CTGGTCCTTGGGCTAAATGTTAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGTGAGTGTCCCAGTCTGGAGCATCAACCATCGCATGAGC
CAGCCGTGGCCCCACCTCGGTATTAACTGGCACACACAAGGCGGCTACTGGTTCTCTCGG
CCCAAGTGTGGCCTGCTCCTACCTCTCCACTCCAGGGCTGGTGAGTCTCCCTGCCTGAGC
CATGGCAGCTCTTTTGACTCGCCAAGGTGGGCTCCCTGCCCAAGCCATGGCCTGCCTGCC
GCCTCTCCCTTAAAGGCATCCATCTGTGGGTTTTGTGAGCATCAGCAACTGTGGCTGGCT
GGAAGGCAGCTCTAAGCCCACTCTGAGCAGGGGCCTTGGCCAGCAGCAGAGTGGAGAGGG
CCCTGGGCTGGCCAGGAGCTGTATACTAGCTTTGCGACCTTGGCTGTCCTTTGACTCAGT
TCTGTTCATGGGTCTCTGGTTGTTGATGCCAAATTGTCCTTCTAGTTTTCCATTCTCTTA
ACCTATGACTGACTAATATAAGGCTGGCTCCACAGTGATACTTAAATTGGTTACAAAGAA
AAACCCCATTCCTTTGTGGACACTTCATAACACATCTTGTTGCTCTGGTGTGGTTATTAC
TGTGGAATGTGGAGAGGGGATTCAGAGCCATGCTGGGAAGAGAAGGGACTATACACCTTG
GCTCTTATAAGCGAAAGTCATCTCTGTCCTTTGTGGTGTTGAATAGACCAGAAGATTGGT
TGTTTATAATGTCTCTGTGCTTAGTGAGGGTTGTACAGGTATCACTAGAAAGAGACAGAA
AAATGTTCAATGTACAGAGTTTTTTTTTTTTTTTTTTTTTTTGAGTACACCAAAATGAAT
GCAGTAAAAAGGAAAGATTGGCTGGATGTGGTGACACATACCCGTAATCCCAGCAATTTA
AGGCTGAGGCAGGAGGATTGCAGGTTCTGGGCCAACCTGGGTAACTTAGCAAGTCACTGT
CTAATTTTTTAAAAGAAAAAAAGGGCTGTGGATATAGCTCAGTTGTAGAGTTCCCCTGGG
TTCAGTCTCCAGTACTGCCAAAAAAAATCCCACCAAAGTTTGCTCTTCACTCCAACAGTC
TCACTCCTAAGACTAACCACTGTTAACAGTTTGGTTTATGTCCTTCCAGACCTTTTCTAT
GCATTTACATAGATGCACAGAAATGACGTTTTTAAAACCTGGTCGTCAGGTTTCTTCACG
AAGGCAGTATGATGTGGTAGGAGTAGCCCTGGTCTGAGCCAGGAGCCCTGGGGCTGGTCC
TTGCAGGGTAGTCCTGCCTCTTTCTCTTTCTGCTGGGGACTTTGGACATCTCTGAGCTTC
TCTTGGTGGTGGATGGGGACCTCATGTGTTTTAACCTCTCCTGTCAGCCTTTAACCTGCA
TTCCTTTGGGCCCCAGGAAGCCATATTTTTTTCTCCTGGGTGATCACTATTTTTCATGGT
TTCTTTGTAGGTTTGTGGGCAGATTCAAGTCTCGAAAAGAGCGGGAAGCTGAACTTGGAG
CCAAAGCTAAGGAATTCACCAATGTTTATATCAAAAACTTTGGGGAAGAAATAGATGATG
AGAGTCTAAAAGAGCTGTTCAGCCAATTTGGTAAGTTGGGGTCCTTGCCCCCACTTGTTC
CTTTAGGTAGTCTACCAGCCCTAGAATCATTTTAAGTTTACTTAAGAGACAAAGCACTCA
GACCCAGAAATAAAACACTTATCTGTGATAAAGTGGATAGAGATAGATCCAGGCCTTTGC
TTTATCCTTTCTCCTTCTGTCCCTACAATCATCTTAGCTACTAGGTCAGAAAGAATTAGA
AGAGGAGGCATGGTGTCTCTTTCTGTCTTAGATCCATCTAGGTTTAGTCAAAGGTTTGGT
TCAAGTTCCTAGAGAGATGCTTTGTCTCCTTAAGCTGTAGTTAGAGGGTTTCACTAATAG
TTCTGTTTTTTGGGGAACAGGTAAGACCTTAAGTGTGAAGGTGATGAGAGATCCCAGTGG
AAAATCCAAAGGCTTTGGCTTTGTGAGTTACGAAAAACATGAAGATGCCAATAAGGTGAG
AGTACCACAATGGTTGGGAAGAATTTGTAGGAGGTGAATCCAGAGTGTGGACAGGGTGTT
GCTTAGCTCATTGTAGAGCAGGAATCCTCTGAGTAGCAGTGAATTGAATTCAGCTATTGT
TCTCTAGGATATCTCGGGTTTCTACCTATACATTGTTTACCTAGTTACAAAGCACTTGCA
TATCATTTGAAAAAATAAGGCAGGTGTTTTTTTCCCATTTCTAGGTGAGGGAACTAAAAC
CCAGAGAGTTGAGCTGATTACAGCACAGCAGCTACTTAGGAGCAAAGCACTTTGATAGGC
TCTCCATATATATCACTTCAATAAATGCCCAAAAAAGAACCTGAGAAATTTTTAGCGACA
ACCAGAATATCAACCTGTGATCACCACCATGCTTGTATTTGTACTACTGTGTTGTCATCG
CCCACTTAATATTATCTGGACCAATAACCCACCACTTAGATATTAACCTCTTTTAACAAA
TGAGGTATTTAGATTCCTTTAGCTGGCTTCAAAATGGGATGGAATTAATTTTAGTCCTGT
AAGAAAGGTTTTCTCTCAATACGTGGACTTGATTATCTCCAAAATAGCCACAAGCAATTG
TACAAGCTTATAATTCCAACTACATGGGAGGTTATGGCAAGAGAATCACAAATTCAAAAC
TAACCTCAGCAATTTAGTGAAACTCTGTCTCAAAAAAGGGCTGGGGATATAGCTCAGGAA
AATGTTCATGGGTTCAATCCCTAGTGCCACTTGAAAACACAGAAACCATTCCCCAGCAAG
GCATTTTTCCTCTGCAACTTTGTTTTAAGGATGGGCATTTCCTTTCTAGGCTGTGGAAGA
GATGAATGGAAAAGAAATCAGCGGGAAAGTCATATTCGTAGGCCGTGCACAGAAGAAAGT
AGAACGCCAGGCTGAATTAAAAAGGAAATTTGAGCAGCTCAAACAGGAGAGAATTAGTCG
ATACCAGGTGAGGTGGTGTTGGACCAGCCTACAAATGTTTAGTATGCAATATTTGTAAAG
CCAGCTTTATCAGACTCTCTTTGGGGTCTTGGAGTCTACACTTCAAGAATATGGAACTAC
CGGATGGGACAAGAATTGTTGAACAGGGGCTTCTCTACTTCAGAAGCCTCAGCTTGTTAT
TTTTTGGATGTAGCTCAGTGGTAGGGCATTTGCCTACCATGTGTGAGGCACTATGTTTGA
TCTCCAGCACAGAAAAGTTATCTGCTTTTAACTGTAGGCTCCTTAAAAATGGCCCTTTGG
AATGATGGCAGAGAGTAACACTGAGAGATAAGTGGTCAGCCAAAGGCCCTGTGGGGAAGG
ATAAAAAGTGAATGCATTGATGAGCCTATTAAGTCTTAGGGAAATAATTTCTCAACTTTG
GGCTAGCACCAGAATCATCTGCAGAACTTATTAAAACACAGATTGTTTGGTTCTAACTAT
GGAGCCTAATGCATGGTTTAGGGTTAGGCCCAAGTATTTTCATTTTTCTAACAAGTTCCC
CAAGATGCTGCTGCTGGGTCAAGGGATCACAATTTGTAAACCACTGTCTTAGAATCTGTG
ATGTAGAAGTGCAATAACATGATTCTTCTCCTTTAGGGGGTGAATCTCTACATTAAGAAC
TTGGATGACACCATTGATGATGAGAAATTAAGGAAAGAGTTTTCTCCTTTTGGATCAATC
ACCAGTGCTAAGGTATTTTGGTGTGAGATTTGGGGTCTGAATACAGAGTATTCCTGGGAT
GTAGCTCAATGGCATAGCCTTTGCAGCATATGCATGAGATCCTGGATTCAAACCCTAGTA
CAGAGTTGAGGGGATGAGCGGAATATTCTCTTACAGGTTTGTTGGCATTTGTTTCATTGA
AGAGTCTCAATTGAGTTGATAGTTCAGAGAGCAATCACATTATTCTAGCAAGCTCCTCTT
CCCCTTCAGTTACCCAACTGAATAATGCTCTGTAGAATGGCATTTTATTAGGTTAATATT
ACACTGTCTCCCAGCACTGGAGTGTGATGACTCTCTCTAGCCCTGAAGCACCCGATCTTT
CCCATTCCTGCTGCTTCGTGCTGGTCTGGGGACAGATGGTGCTACACTATGAGCAGAGGA
TATCCAGACGGGTTGTTTTCCATTTGTCTTGGGACCTGTCTCTACAACTCTGCCACATTT
TCTCCTTAAGGATGAAGGTATTTGAAGATTCTGGAGCTGGAGTTGGGAACTTTCCTGTGG
TTTCACTTAGAAGGAAAGGGAGTGAAAAGTTTGGTTTTTCATGTTTTATAATGTGTATCA
TTTGCTTGATATTTTAAAACTTCATTTAAAAAAAAATTGAGTCCCTGAGCAAGAGAATGT
TGGCCACCTGGGGATGTGTGCGGCAAGTCCTTGGCACTTTGGGAGTGTGACAAGAGAGTT
TGTGTCATCTGCTGCATCTATTATCAGGCAGGACAGTATCTACATCAGGTTATGATCCCA
AAGTCCTTCAGGTGAGACAGGCTGATAAAGGTCAACTCTGGGTTTCTCTCACCCACTTGA
ATGTCCCCTATCAGTGCAGGGCAAAATAGTCTTTACTTGCTTATCTCTACAGTAGGCAGA
TTGACAATTGTAAAAAGCAAAAGCATTCTGTCTTTAGTTCTGGGGCCCCATTTTCAAGAT
CACAGTAGGGCATTGTTTATATACACCTTATTGCCCACCTCATTGATAGAAAGGTATGGG
ATTGATATATGCATTTAACTTTCATGCCTTCCACTTTGGGAGGCTCCCCATGCTGTGAAC
TCTGATACTGATACTAACAAGTTGGTGCCATGACTCATGCCTGTAATCCCAGCAGCTCGG
GAGGCTAAGGCAGGAGGATCATGAATTCAAAGCTAGCCTCAGCAATTCAGCGAGGCCCTC
AGCAACTCAGTGAAACCCTGTTCGACTCCTAGCTAATTATTATTCCCATTGAGTGCCACT
ATTAGGTGGCAGTCATTGGTAACCTGGGAGTTTTATAATTGCCCACATGTGATATTTCAA
AGCATTTTCCTAACTAAGTGAGCCTGTTCAGGTTTTGTCCACCGTTTGGACTGGATGAAT
TCTACAAATAAATTGTTCAGCACTATTGTCAAGATGTCTCATAGAATTAGGAACATGTTT
AGGTTCCTAGTTTTACCATTAGCCACATTGTAGTTGGGAAACTTTAGCTTACCTGAGGAT
GTTTTTTAAAAAAAAAGCCTAAGTTGTGATGTTGGTTTTAGGTACATCCTGGGCCAGGGT
TGAACTCTGGCTTAGATGGTAACTTAGCAGCACAGTCCAGGATTTTTGACAATTGTGAAG
AACGAGCCTGTTGATGCTGTCCCTCCTCATCCCCAATACATAAACCTTTTTCTTAGTAGC
TGGTCTCATTTATAGGTAATGCTGGAGGATGGAAGAAGCAAAGGGTTTGGGTTCGTCTGC
TTCTCATCTCCTGAAGAGGCAACCAAAGCAGTCACTGAAATGAATGGACGCATTGTGGGC
TCCAAGCCACTATATGTTGCCTTGGCCCAGAGGAAGGAAGAGAGAAAGGCTCACCTGACC
AACCAGTATATGCAGCGGGTAGCTGGGATGAGAGCACTCCCTGCCAATGCCATCTTAAAT
CAGTTCCAGCCTGCAGCTGGTGGCTACTTTGTGCCAGCAGTTCCACAGGTGGGTCTGCCC
TGTGATCATGACCGTTTGCAGTAGTTGGAGAGAAGGGATTTTTGATTTTTTTTTTTTTAA
TCAAAACATTACAGAGCTCATGATATATCATCTTTCATACATTTGACTCAGTTGGGGGAT
TTTGGATATTGGAACTCCAGAAAGTCAATAGACTCTTCAAATAAAATGAGAAAGTACTTA
CCCATGGTCATACACATATATACCCAGTAGCAGAGGTAGGGTAAAACTGCTCCCACTATG
ACCCTTCAGGGCTTTGAGTAGGCTTTATTCCAAATAATAGGCTAAGGTTGAGTCGTAAGG
TGAGATAAAATGAGATGAGGTTTGGTTTTGTTTTGTTCTAATGTTGGTTCAGGCCTGTAA
TATAAAAAGGCTTAGTGCTCTTTTTCCTTACAGGCTCAAGGAAGACCTCCATATTACACA
CCTAACCAGTTAGCACAAATGAGGCCTAATCCACGCTGGCAACAAGGTGGGAGACCTCAA
GGTAGGTGGTAGAAAACAGTGATTTGGTCACCTAGAATATATCATGCCTATCCTGGTCTA
CCTGCCTTTCTTGCACTTGTCCCTTCTAGGGCATAGCCTGGCTTTTGGTCATTGTTGCTT
ATCAGTGGTAAGCGCTTTTTATCTTCTCACCAGGCTTCCAAGGAATGCCAAGTGCTATAC
GTCAGTCTGGGCCTCGTCCAACTCTTCGCCATCTGGCTCCAACTGGTAATGCTCCGGCCT
CTCGTGGCCTTCCTACTACCACTCAGAGAGTCGGTGAGCAAACTGGCCTATAGGAGAAAA
GCCTGGGGAGGAGGGAGTCAGGATGGCTAGCTCTTCCTTAACGTGGTCAGTTTGTTGGGC
TCAAGTTTTTTTGAGTCCTGGTTCTGTCATCTTACTCTTGTGTGCTTAGGTAGGTACTTG
ATTCAGGAACAGAACTAATGTGAGTTCTAGGTGTGCTGGTTACATTTAACATTCTTTATT
GATTGGTACTCATGAGAAGATTAATTTTAGAAGTTTGCTAGCTGGATGACTACAGAGAGA
GAGCCTGTTTTTTGGTAGAGTAGGGTGGGGGGACAATGAAACTTTTTTACAGAGTAAGTC
CTGCATTACAAAATGTGGATAGAGTTGTATGTTATTCTTTGGCTCAACCCTGAAAGTAGC
AGTAGTGGCCCCCATGTGTGGTGTCGTGTGATCATGCTTTGGAATTTCTCCTTCCGTGGG
ACGTGGCCAGTTGGACATCTGCTGCCAACACTGATGTGCATTTGCTGGTCTGTTGTAGGG
TCTGAGTGCCCGGACCGCTTGGCTATGGACTTTGGTGGGGCTGGTGCCGCCCAGCAAGGG
CTGACTGACAGCTGCCAGTCTGGAGGTGGTATTGGATGCACACAGAAGGGGGAACGATGG
GATTTGACGGGTCTTTGATCAGACTGATGGGCTTTAATTGTAATTGTAATTGTCCTTTCC
ACAGGTGTTCCCACAGCTGTGCCAAACCTTGCACCACGTGCTGCAGTTGCTGCTGCTGCT
CCTCGGGCTGTAGCACCATACAAGTATGCCTCTAGCGTCCGCAGCCCTCACCCTGCCATA
CAGCCTCTGCAGGTGAGGCCCACCAAATGGTGCTGGAGGTGTTTTCCCCGTTTTCCCTTG
ATTTTCAAAAGATGCTTGGGCTAGGGATATAGCTCAGTTGGTAGAGTGCTTTCCTCTCAT
GCACAAGGCCCTGGGTTCGATCCCCAGCGCCACACATAAAAAAATGATGCTTGGCTTTGG
TTCATGCAGTGGGTATCACATTGCCCAGTCTGTGGCAGGGTGTATATTCTGTGTGGTGAT
TTGAATAGTGTCACTAAAGGGCTTGAAATTCTTCTTCCCAGAAAAGCTCCATAGGAGGCA
AACTGGTGCTTTTCTGGGTTTTGGCTTTTATGTCTTTGCAGCACTGGGGATGGAATCTGG
GGTATAATAGGCAAGCACTCATCACCAGCCCTTTTTGAGACAGGGTCTTGCTGAGTGCCT
AGACTGATCTTGAATTTGTCATCTTCCCACCTCAGCCTTCTTAGTAGCTAGAAGTCCTAC
TCTCCTTTTGTGACATACCTGCACTTGTTCAGGTCCTTGAGCCTTCATAACTTTTTCATC
CACTGGCCTGTTTGATCCTTGGCTGTTCTGCAAAGTTTTGAGATATTAAGGCAGGAAATA
ACATCAACTTACAGAAGAGAAATTCAACTTCAGCTGGGCATGGTGGCATGATCCTATAGT
CTAAGGGCTGAGGCTGGAAGATCACTTAAACCCAGGAGTGAGATTAACCTAGGTAACAGA
GCAAGACCTTATCTCAAAGAAAAATAATTCAGTTTCAGAGATATATTAAGGGGTTGAGGG
ACAGGGGTGAGAGCTTAGATTGCCTAAATTGAATTTTTTTTTTTTTTTTAATTTCTTTTG
GAATTGTTAGTATTTATTTTTTAGTTTTTGGCGGACACAACATCTTTGTATGTGGTGCTG
AGGATCGAACCTGGGCCGCATGCATGCCAGGCGAGCGCGCTACCGCTTGAGCCACATCCC
CAGCCCTAAATTGAAATTTGCTACTTCTACAACTATGCTCTTTAATACATAAGCAAAGAC
ACAAGTGTTTTGGGTACCTGGGATTGAACTCAGGGACACTTAAACATTGAGCCACATACC
TGTTTTTTAAGAGAGTCTTACTAAATTGCTAAGGCTGGTTTGAACTTGCAATCTCATGCT
TCAGCCATCAGTAGCAATTATCTGGTGGGGCCACACTCAGCCTTCAGGCCTAAAAGTTCC
TTGGTAGACAGATGATCTTTTGGCTGTCTTCCTTCCCCATATTCTCTAACTTGAAGATTT
CTCAGAGCTTAATTCCAAGTAAAATGTCTTTTTTGCCAACAAGACCCTATTTTTAGGGCT
GTGATTAGCATTAATGTTCCATATTGATAGTCCCCAAAGCTGTTGATTCAACAAAAATAT
CTAGTATAATGAAGATGCTATGTGTAAATGTTATATTCACACCCTTTGGCCCTGTCTGTA
CCAGAATTGTCTCTAAAGGGAACTTTTAGGGAAAAGCTATCCAGATGTTCGCTGTGGCTG
ATTTATCAGAAGGCCTTATTTTGGGGTAACTGGGTAAATCAAAACATCAGCACAAGCTTG
CCTAGCATTGTAGGCATTATATAGGTTTTTTGTTTTGTTTTTGTTTTTTTTTTTTTGTAC
TGGGAATCTAACCCAAAGGATGTTGTACCACTGGGACTACCCAGCCCCCCACTCCCTTTT
TTTTAACTTTTTAATTTTGAGACACGGTGTCACTAAGTTTACTGGGACTGGGCCTGGAAC
TTTGAATCCTGTCTTCAGCCTCCCATGTCTTCGAGGATTACAGCATTTGCCATTGTGCCC
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGGTAAGCTGTCAGCACCAGAAGCCCAGGGATCATCTATATTCTCGCCAGTGGGC
TGAGCACCAGAGAGGGGCCAGCTGGCTTGCCTGAGTCACTGACAACCTGGAGATTTCTCA
TAGGTGGATGAAGCTGTGGCGGTTCTACAAGCTCATCATGCCAAGAAAGAAGCTGCCCAG
AAGGTGGGCGCTGTTGCTGCTGCTACCTCTTAGACGAGGAAAAACAGTATGTTTGGCTTT
TTCACTTCCTGCCAGTTTTTGTTTGTGCTAGAATTCAGGGGTGCTCTACCACTGAGCTAC
ATTCCCAGTTGTTGTTCCTTTTTATTTTGTGATGGGATATGACTGAGTTGCCCAGGCTGG
ACTTACACTTAAGATCTTCCCAAGTCTCTAGGATTACAGACATGCACCACTACCCCTGGT
TTCTGCCATATAACCTGAAAACTTGGCAGGCTGTTACCTAAGCCTTTCTGTTATTAGGAT
CTGTTATTATGGAAAGAAAAATAATGGTTGTAAATTAAAAACTTGGGAGAACTGGGTGTG
ATAGTGTGCACCCATAGGCCCAGGTACTTGAGATAAGGCAGGAGATTCACTTGGGGCCCA
GGACTTCAGGCCAGTCTATAGCAACACTGAAAATCCCATGGTTTCCTCATGAAGAACACC
TGGTCAGATCTTTATTGGGGGCTGGGATTGTGGTCATTCACCTAGCACGTGCAATGCCCT
GGGTTCCATCCTTAGCACCACATAAAAATAAATATTGTGCCCAACTACAACTAAAAGATA
AATATTAAAAATTATTGGTGGAGCTGGGGATATATAGCTCAGTTGGTAGAGTGTTTGCCT
TGCATGCACAAGGCCCTGGGTTCAATCCCTAACACCAAAAAAAAAGTCTAGGGGCTGGGA
TCCTGGCTCAGGTAGAGTGCCTGCCTAGCATGCATGAGGCACTGGGTTCGATTCTCAGCA
CCACATTAAAATAAAGCTGTCTAACTAAAATATTTTTAAAAAATAATTATTGGTATAGAG
GTTGTTGCTCAGTAATAGAACACATCATTATGTGTAAAGCCCTGGGTTCAGTCTTCAATC
CTTTATGCCCCAGTTACCTTTGTCCTGAGATAGTGATCTGATATACAAGGAGTTTTCATA
ATCAGATCCCAGCTGTAAGCATCATTTTGCCAAGTTAGCCCATTGAGGTTATATGTGTAC
ATACTTAATGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 3848..4041, 5155..5270, 6850..6989, 7340..7434, 8269..8406, 9036..9131, 10815..11087, 11493..11580, 11733..11852, 12358..12444, 12544..12671, 14631..14724, 14825..14955, 15243..15332
1001..1193, 3848..4041, 5155..5270, 6850..6989, 7340..7434, 8269..8406, 9036..9131, 10815..11087, 11493..11580, 11733..11852, 12358..12444, 12544..12671, 14631..14724, 14825..14955, 15243..15329
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved