Spermophilus_tridecemlineatus Locus CCT6A
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus CCT6A
Spermophilus_tridecemlineatus
CCT6A
GeneScaffold_3544
SNORA15
9585..9720
12092
AAACAAAGATATTGTGTCCACGTATAACTAAAATATATATATATATATTTTGAAAGTTA
GCATACAAGAAACAGTCCTTATTACTGTATTTTGCACCACATAATGAAAAATAACCAATT
AACCATAAACCTAATTTGATCCAAACTCTGACAACTGAGACTAGAATGATTAAAGCACAT
AATAAATGAACTTAAAATTTGAAACTCCAGAGAGCAGGTCTTTCCAACTCCCCTTCTCTA
CCTGTTAGAAGTTGCCTGAAATTCCAGTCTTCACCTCTGCTCACGGGTTAAGTTTGTCTC
CCTGTGCATCTTCACCAGCAGATGAAGAACTGTCTGCAGAACCAATCACTAGCCTCCTAC
TTTGCAGCATTATTTCTCAAACTTATATAGATGGCTTTGTTATTCTAATTTCACAAACCC
ACCTAAAAACATCATATACTGGCCTACTCGCTGCAGCCTATATAACAGAGGACTGAGAAC
AACTTAAGTGTCAGCAAGAAGATTGGCTCATTATGTCATCTCGTCCCCCCAACCCCACCC
TGGTTTTGGGAATCCAACCCCAAGCCCAGGTCGCGCAGAGGCCCAGCCACGCCCGTCCGC
GCGCGGCACCTGCAGGCCCTGCCCGCCTACGTTCTCAGGTCTCGGGTCCGCCCAGGTGGA
CCCCAGGCCCCGCACTCCCTGAACCGCCACAGGCCCAGAGCACAGGCCCCGAGAAGCCCA
GCTCCTCCCGAAAGCAACCGCGCTGGCCAGGGCGCGAGGGCGGGTCCGCAGGCGCCTAGC
GGCCACGACCAATGAACGCACGCCGACCGGCCTATGGACCAATGGCGGAGGCGCGTGGCA
CGCTGGGGGCGGGACCACGGGGGGCAACGGCGGCGGTGCGTGCGCACGCTGGGGGCGGGT
CCGGCGCGCCCGACTTTTCCAGAAGCTGCTGAGAGCGCCGCCCGGCCACGCGCTGCCGGC
TCCGGTTCAGTGCGCGCCCCTCTTCCTTTCTCCGGACAGCTATGGCGGCCGTGAAGACTC
TGAACCCGAAGGCCGAGGTGGCCCGCGCGCAGGCGGCGCTGGCGGTGAACATCAGCGCGG
CCCGCGGGCTGCAGGACGTGCTGCGGACCAACCTGGGGCCCAAGGGCACCATGAAGATGT
AAGACCGGGCGGGGTCCCGTTTTCTCCCGTGTGCGCTCGCTGCGCCGCCCCTCTCCGGCC
TCCGCGGGCCTTGGAGGGTTGGGAAGGCGCCCCGGGGGCTGACGCGGGAGGCCGGCTGGG
TTCCTTGACAAGGCGCAAGCTGACTTGGCGTTTTTGCCCCCCCCCCCACAGGCTGGTGTC
TGGCGCTGGGGACATCAAGCTCACCAAGGACGGCAACGTGCTGCTGCACGAAATGGTGAG
GTTCCCGTTCTGGTCAGGTCGTCGTTTGCCTTACAGGAGGGGTGGGAGAAAATCGTGTCC
GAGATTCCCCGCAGACGGGGAGGACCAGGAGAGCGGCATGGTCGGGATGGAGTGCCAGTG
CTGTGCAGCCAGGGGCCCTGAGCCTGAATACCGGCTCTCCTGCCACTTGTTGTCTGGGTT
AAAGGATTGTTTTAGTTCATTGTCATTTGAAAAATTAGGGGCGGTTGACACAACCAGCTG
GGCAAAACAGCAAGATTTTCTGTTTTCAATTAAAATTTCTTCGACTGGAGTCGTAGCTCA
CAAGACTGATTGCTTGCCTAGCATGTGCGAGGCTCTGGTTCCTTCCCCAACAGCATTAAA
AAAAAAAAAAAAAAAAACAGGAATACCTTTGATACATCTCTCCACCTTAAGTCCCAGGGA
TCGGTGTTGTTGAAAGGCACTGTGGCACACACCTGTAATCCCACCAATTAAGCAAGGCTG
GGGCAGGAAGCCAGCCTGGGCATTCTAGGGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGCCGATAGTCTTTTTTTT
TTTCTTTCTTTTCTTTTTTTTTTTAAAGAGAGAGTGAGAGGAGAGAGAGAGAGAGAATTT
TTTTTATATTTATTTATTTTTTTTTTTTAGTTCTCGGCAGACACAACATCCTTGTTGGTA
TGTGGTGCTGAGGATCGAACCCGGGCCGCACGCATGCCAGGCGAGCGCGCTACCGCTGAG
CCACATCCCCAGCCCAGCCGATAGTCTTTATAAAGATTCTGTCAAGGCCTATATTCTTTT
TCTTTTTTTTTTTTAAGGTGTAGTTGGACACAATGCCTTTATTTTTTTTTATGTGGTGCT
GAGGATCGAACCCAGAGCCTTGCACATGCTAGGCAAGCGCTCTACACTGAGCCACAACCC
CAGCCTCATGGCCTAGATTCTTAATCAGCCAGGCTCTGTGATCCCAGGAACTTGGGAGGC
TGAGGTGGGAGGATTACAAGTTTAAGACCAGCCTGGGCAATTTAACAAGACCTTGTCTCA
AAATAAGAAGGGCTGGGAGTGCTGGGAGTGTAGGAGTGTAACTCAGTGGTGGAGCACCCG
TGGATTCAATCCCCAGTATCGCAAAAAAAAAAAATGTATCCCCAAAGATAGAGAAGGCTG
AGAGCTATTCAAGGTTAAAGGAGCATAGAAAAACCAAAGGCGGTGCAGGAGATTTGGTTG
AATCCTTTGTGATTAAGAATCTGGAGTGGCTTCAGAGGCATGGTGATTTTCCTGTTTTTA
CATGAAAATTTTTCTTTCCCACAGTGACTCTTTGGAAGATCTTTGCTAAGAGGGTCCCAC
TAAGTTACCACAGATGACCTTGAACTTAAAATCCTCCTTGGTCACTTGCCCAAATAGCTG
GGATTGCCAGTGTGTGTCTCCATATATTTTGATCATCATAGATTGATATGCAAAATAGCA
ATTTGCAATTTTTTTATTAAAGGAGTATTAGTCAAATATTTGGGCAATTAAGGTAGACAG
CATTTAAAGAGGTTCTCAACAGATTGGTTTCAAGGTATATTTATTTTAAGTAATGTAATT
TAAGTAAATTTTTTTCCTTTTTCAGCAAATTCAGCACCCAACAGCCTCCTTGATAGCAAA
AGTAGCAACAGCCCAGGATGACATCACTGGGGATGGCACCACTTCCAATGTCCTTATCAT
TGGAGAGCTGCTCAAACAGGCAGATCTCTACATTTCTGAGGTACATAGAATTGTCTTGTT
TTGATTGTGTGTAAGAAATGTGACGTTTGTAAATTGATGTGTTAACAGTAGCTGAGGCCA
CACAGCATGTAAAGAGCAGGAGTTATAAATCTGAGAACCTGGGTCTTTATCATGGTGGAA
ATAGAAATGTGTGATGATGGATATGTTATGGAATCTTTGTTGGCCTGCAAGTTTTTTAAT
CAAGTTACGTTTCATTTTTTATTTCTATCTAGCTCTACAACAAATTAATAATATGAGATG
TAGAGGTCTGAACTAGCCATAGTTACAAGGAAAAGGTCAACTAAATGTTAGACATTTGAG
TAAAAAGAATTCTACAACTTTTTGTGGGGTAGGGGTACTAAGGATTAAACTCTGGGACAC
CCAACCACTCAGCCACATCCCCAGCCTTGTTTTGTGTTTTATTGAGAGACAGGGTCTCAC
TGAGTTGCTTAGTACCTCGCTTTTGCTGAGGCTGACTTTGAATTCAAGATCCTCCTGTCT
TAGCCTCCCGAGCCGCTGGGATTACAGGTATGCACCTCCACGCCTCACCAAATTCTACAA
CTTTTTTTTAGCCCTGAATAGTTCCAAGTTTAAAGCAAACCTCGGTGAGTAACTAATCCA
CTGTCAGAATTCCCTATGAAGAGAGAGCGAGCAGATGTTTAGTCTATATTTATTTTGATT
GCTAAAGATGTGAATTAATTTCAGATTGCTTGTAGAAAAGTTAAAATGTTCCTACTAGCT
GGGTGTGGAGGTGTACAACTGGAATCCCAGCTACATGGGAAGCTGAGGCAGAAGGATTTC
AAGTTTGAGGCCAGCTAATTGCAATTTAGCAGGACCTTGTCTCAAAAATAAAATAGGACT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTATTATTTTT
TTAGTTGTAGTTGGACATAATTTCCTTATTTTATTTATTTTTATGTGGTGCTGAGGATTG
AACCCAGGGCCTCACAAATGCTCGGCGAGCACTCTACTGCTGAGCCACAACCCCAACCCC
CAATGTTTTTATATAACAGTTGTACTCCTGTTGTAGGCTGTAGTGGACTCCATTTTGGCC
ATTAAAAAAAAAGATGAGCCTATTGACCTGTTCATGGTTGAAATCATGGAGATGAAACAT
AAATCTGAAACTGACACAAGGTAGGTGATAGAGTTCTGTTGAACCACTTCTGAGTGTCTG
TTGGGGTTGAACCTTGTGCCTGTGAGCAGGGGCTCCACCCCTGAGCCAGTCTCCAGCCCT
GAAATAATAATAAAGTGGATTTATAAGTTGGATGTTCACAAAAATAAATATTTATATGTT
TGGGTAAACATAATTTTGTGGAATAAATTGCAGGGTAGTCCATTTGTTCCTAGTGATATT
TCCTCTTGAAGACTGGGGAAGGTATGCTGTGTTTTTTAAAGACCGAGATAATATTTATTT
GAAGGAGGCAATCAAGAGTTTGATGTCTGCCATTTGAGAGTATCTGCAGAATTTTCCATT
GAGGATAGTGGTGTTACTCTTGTTGGAATAGCCTGTCTTGCGCTCTGTAATACTGCTTTT
TCACAATTGACCATCCCTAGGTTTCACTAGAAACTTCAGATAATTCAAGAGAGAAAACTA
ATGGTATAAAAATTGTCAGTATAATCTTTTGAGTGTTTCAGTTTTGTCAGTGAAAGACTC
CTATTTTGGAAATCAGTAACTTTAGCCCACTGCCAGCACAGGCTTCATAAATGAAGGTTC
AGCTATGTGAGAAATCCGAAGGGAGTTTGAATTAAATTGACAGATTCTAATTACCTTTAA
ACCAGCTCCGGGACGGCTTCTCCTACCTCCAGCTTCAAGCTACCTATTAGGGTAGCGAGG
TTTACTGAAGAGGCCAGTGAGAGAGAGAGAACACGCCAGGGAGTGGACTTTATTGGGGAA
CAAAAAATTCTGGGGAAGATCCCATCCAATGAAGTTTAAGGGGGGCAGTGTCCCAAAGTC
ATGGTGCGACAATTGGGTCTTTAGGGGTAGTGGCCAGACACACCTCCACACGGACAAGCC
CTCGGACCTGAGAAGGATGGGGAAAGCTCTGGACACAAAGATGTGTCTAAGCGCCTCTCA
TCCAGCCAGGGAGGTATCTCAAATCATGTACGAGGATGGCCTCCCACAAGTAACAATATG
AATTCTTTTAACAGCTTAATCAGAGGTCTTGTTTTGGACCATGGGGCCCGCCACCCTGAC
ATGAAGAAGAGAGTGGAAAACGCATACATTCTCACATGCAATGTGTCGCTGGAGTATGAA
AAAACGTGAGTGGTCGCCCCTTTAAGGGGGAGTGGAGGAGATTGGTATTTTGCAGCAAGT
TCCTTTTGAAATTCATTTTGTTCACTGTGAGGGCAGTAATAACTCATTTGGGTTTGGGAG
GCCAGGAGCAGATGACTACTAACAATGTACAAGGGGCAGGATTGGGTCTCCGGGACTTTG
TAAGCTTTAAGATGAATCAAGTTTCTCAGGCTGCTTTCTTTGCCGTAAACATTTTTTCTC
TTTTTCTAACAGAGAAGTGAATTCTGGCTTTTTTTACAAGAGTGCAGAAGAGAGAGAGAA
ACTAGTAAAAGCTGAAAGAAAATTTATTGAAGATAGAGTGAAAAAAATAGTAGAACTGAA
AAAGAAAGTCTGTGGTGATTCAGATAAAGGTTTTGTTGTTATCAATCAGAAGGTGAGAAT
GAAAATTAGAGTTACAAAAGAAAAGTCTGTTGTTCTTTTCTACTCTTAAGGGAAGATATA
CTGAAACTGATTTTATTTTTATAGGGGATTGACCCCTTTTCTTTGGATGCGCTTGCAAAA
GAAGGCATAGTAGCTCTGCGCAGAGCTAAACGGAGAAATATGGAAAGGTATGAGCAGATC
ATCTGAATAATGTAAATTTCACTAGTTGGCAAGTGAATTAGGATTTTTCTTTTCCTCCTT
TATTTTTCACTTTTTTGTGGCATCATATAAATAACATCTCCCACTTTAAGGGCTCCAAGG
AGTGGCATTACTGCATTCACACTGTTGTGCAGCTGCCACCAGTGTGCATCTTGAAACTTT
TGTCATCAAGGTAGGTTACTCCCAATTCTCCCTCTCCTTACCTTGGTGAACACAGGTCTG
AGTTCAGTGCCTCCTGTAAATGGAGTCATGGTGTTTGTCCTTTGTATCTGGCTTGTTTTA
TTTACTTGGCTTAGTCTGCATGCTGTATCAGGCCAGAATCTCACTCTTTATTCCATTGTG
TGTGCCATATTTTATCTTTGATCTGTTGGGGGACATTTGGGTTGTAGCCACTTTTTGGCT
ATTGTGAATAATTCTGTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTAT
ATATTCTGGTTTTGAAAATCTCTCTTACAGGGAGAACAGTAGACACCTTTATTGAGAAAT
GTAACAATCCCCGTTCTGTCACATTATTAGTCAAAGGACCAAATAAGCACACACTCACTC
AGATCAAAGATGCTATACGGGATGGCTTAAGGGCAGTCAAAAATGCACTCGATGATGGTA
AGAGCTCATTGTGTTTAAATCTTGTTCTTTTTGCTAGTGTAAAAAGCATGGCTGAATACT
GTGTACTTTAGTCAGTATTTTACACAGCCAGACACCATGCAAAAGTAAAGTCTTCCTTTT
ATAATAACTGTGGTATGCTAAGGTTTTTCATAGTGTGCCCCTATTAAAAGTGAATACAGA
CAAATGAACTAACACATGCTCAAGAGAGTGCCAGCTCAATTGAACTATTGTGCTGTTAGG
TTTGTCCCTTTGCATGTGGGTTGGGTGTGTCACTCAGTGGTGCAGAGCTTGTCTAGTAGC
ATGGGGCCCCAGTTCAATCCGCAGCTCTGCAGAGCAGACAAGTGCAGTGCTGTTGTTAAA
TTTTTAGTTATGAAAAGGGCGGATTCCTAAGAAGTTAATTCATAAGTGGTTTTCTATATA
TATCTTGTTTCCTTGTAATTGGTTCATCATTTTTCTTGAGCTTATTATCATTTCTCCTCT
TCTCCACACAACAGGCTGTGTGGTTCCAGGTGCTGGTGCAGTGGAGGTGGCCATGGCAGA
AGCCCTGATTAAGTATAAGCCCAGTGTGAAAGGCAGGGCCCAACTTGGAGTCCAGGCGTT
TGCTGATGCATTGCTCATTATTCCCAAGGTGTGAAAACTTGAACAGTTATTAAATACATC
AAAACAATTAAACTGAGCAAACCTTTTTGATAATATAGGTTTTCTTCATAATGTGAATTT
TGAGTGAGCAGGTTGAATCCTTTTCTACTTGACACTTATACTCCCATCATATCTATATAC
TTTTTTGGGGGAGGGGGTACAGGAGATTGAACCCAGGGATACTTAACCACTGAGCCTCAT
CCCCAGCCCTTTTTACTTTTTAAAAAATATTTTTTAGTTATAGGTAGATACAGTGTCTTT
TTTATTTTTATGTGGTGCTAGGATCAAACGAGTGCCTGAGTGCTCTCCCTCTGAGCCACA
ACACCAGCCCTTTTTTATTTTGAGACAAGGTCTTGGCTAAATTGCTCAGGTTGGCCTTGA
ACTGTGATCATCCTGCCTCAGCCTTCTGAGCCCCTGTGATTATACTATCCACATCATCTC
AAAGCCTTTTGTTCTGGGAGACTTGACTGTCCTTGAGGTTTTGGATGACAAGAGAACTGT
TTTAAGAATATTTGCAGTAAAGGCTTTATGCTTGAGTACAAGCTTGCTTTTTGTTATTTT
AAACTGATGTTAAAAGTTATAACTTTCTGTTATTTTAAACCACTGTTTTCTGTTTGTTTG
GGGTTTTTTATGGTGCTTGGGATTGAACCCAGGGCCTTGTGCATGTAAGGCAAACACTCC
ACCATCTGAGCTATATCCCCAGCCCTCATTATGAGGTTTTGTGTTTTTACTTTTTGGATT
GTAAATACTGTTCATTTGTTGTAGAACTTCTTAATTCCTGCCTTTTCAAGAATTAAATTT
GTTTACTTTAGGTTCTTGCTCAGAACTCTGGTTTTGACCTTCAAGAAACACTAGTTAAGA
TTCGAGCAGAACATTCAGAATCAGGTCAGCTTGTAGGTGTGGATCTGAACACAGGTAAGA
GAAGGCCTCTCTGTAGGGCAAGAACAATACCAAGCATGTGAGGTCACTCTAGGAGGGTTG
GAAAGAGTCTTGGCAAGCAGCTCTGCAACTTGATGCCAGTGCTGTCCAGAGCTCAGGGCT
CTGCCGGGGTGGATGCCTGAGTATAGATTTCTTGGAGATGTTGCTGAGTGGTGGTATGAA
GCGTCGTTGATAATGAAGGGTTTTTGTATTAACCCAGTCTTTTAATCAGTTCCTGATTAA
AAGAATATATTATGTGATCAGATTGACAAATGAAAATACAGTAAATAACAGAGGGATGTC
CAAGCATGTGGTAACCCATGAGATCACCCTGTCACTGGAAGGCATCTAAGCAGAGGTTAG
CCACTCACCAGAGGTATTGTGGAGGATTTTGTGTAGTTACAGAGGAGAGAATGAGTAATA
AGCAAGTCAGCACCAAACGTTCTTATATTTTAAATGTTTTCAATGGCTTTATTCTGTTTT
AGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1137, 1311..1374, 3925..4059, 5397..5570, 6216..6319, 7334..7444, 7692..7851, 7944..8026, 8868..8964, 9390..9398, 9404..9536, 10034..10167, 10991..11092
1001..1137, 1311..1374, 3925..4059, 5397..5570, 6216..6319, 7334..7444, 7692..7851, 7944..8026, 8868..8964, 9390..9398, 9404..9536, 10034..10167, 10991..11092
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved