Spermophilus_tridecemlineatus Locus GNB2L1
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus GNB2L1
Spermophilus_tridecemlineatus
GNB2L1
GeneScaffold_3124
SNORD95, SNORD96
1392..1459, 2584..2662
6597
ACAGCCCAGTACCCAAAAGGTGCTCCTTAAATTCTGAAACACTGCCAGGCATTTTTGGG
GATGTAGGTACTAATATTATTTCCAATTTTATTTCACAGATGAGAAACCAAAGTTAACTT
TCCATCTTACAAAGAGAAAAGTAAATACTTATGTATAAATCCCACCCCTTTATTTTACAT
AGATATCAGTGGTTGCAAACTTAATGATATATGCCACTCCTTAAAAAAATATTTGGAGCC
AGGCACTGTGGTGTGTTCCTGCAATCCCACCTGCTCCGGATGCTGAGGCAGAAGGATTGC
GAATTCAAAGCCAGATCATCAGAAACTAAGCGAGGCCCTAAGCAACTGAACAAGACCCAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGGCGGGGAAGCGCTCTCT
TTTCCTTTGCAGGGCTGCGGCGCGGTGGCCGCGGTGCTTGTCTCTCTGAGGTATCCCGTG
CCATCCTCGTCGCTGCGGCGACATCTCCACCCGCCGCTGCCATGACTGAACAGATGACCC
TTCGTGGTACCCTCAAGGGCCACAACGGATGGGTAACCCAGATCGCTACTACTCCGCAGT
TCCCGGACATGATACTGTCCGCCTCTCGAGGTACAAGCTAAGGTGTTGGGCGAGACGGGT
GATGGGGGTAGGGGTGTTGCGCTTGTCGTGGGACTGGGCGGGTGGCGCGCGAATTTGCAG
GCCGAGTAAGCTCTGTCACCGACTGTGAGTTGGTGAGTACAAACCCGATCCTAGGCTTCA
ACCGAGACGAGCAATTTTACAGATCAGCACGAGTCATAGTCCGTCATTGCCAGGAATGGC
TGAAGACTTTTTAAATCTCTGGCCCACTTCTCACTTGTGGTCAAATATTCCCAGGGACCA
CCTGGCTGGGCGGAGCGGTGATGACACCAACATGCCATCTGAATGCCATGTGCTGAAAAA
CAGAGGCTGTTTCTGAGCTGCCGCCGGCCCTGGATTCAATGGGAATTGGGTAGACTCCAG
AGGGGCCTTGTGACCCACATCTCCCAGCCTGCACTTTCAGCCCTCTCTCACTCTTGTACC
TAATAGAGCTTAGAAAGGTCTTGGGCTTTACCTTAGCTGCCACAGAATGAAAAATCGCCC
AAGGGCTAGGTTCATGTCTGACACTTATTAATTTTCAGACTTGTTGAATGAGCCGCATTT
CCATAAAAGCATCCAGTCCTGTAGCATATGAAGAGACTTATCAGCTTTGATTTCTGTATT
TCTGTCAGCCCTCATAAGTAATCACAGGAAGTCCCCAGTTACTCGTCCCACACCCAAGCT
GCTGTCTTTCCACATTCAGAGAAGATGCAAAATAAATGTTTTATTATATGAATTTCAGGA
AAAAGTATCCATAGTCTCTGACACATGAGTTAGGGTCTTGTGGCATGTCTAGCTTTAAAA
CTGCCTGTCTCTATCTGCAATAGTGGGTCATTCAGTCCAGGATAGTAACTGCTCTCATAG
CCTACAGTTCCCCTGGCCACATAAATGTTCTCAACTTTATTCTCTTTAACCCACCCACAA
CCCTGAGACGCCTTGTTATACATTAGCAAGTGGGCTGAGTAGGGTCCTCATGGATTTTTC
TTCTCCTGTTTTACCTCCTTTTAGATAAGACCATCATTATGTGGAAGCTGACCAGAGATG
AGACCAACTATGGTATCCCACAGCGTGCTCTGCGGGGTCACTCCCACTTTGTTAGTGATG
TGGTCATCTCCTCAGATGGCCAGTTTGCCCTCTCAGGCTCCTGGGATGGAACCCTGCGCC
TCTGGGATCTGACAACGCAAGTAGCTACTCTGGGGCCTTGGGGGAAATATGCACAGAAAT
GAATAGATGCCATCAGAATATGGTTTCCCAAGGGAAAATGGTCCATCTGGGAAGGATGAG
GGTAAAATACCTACAGAAGATAGTTGCAGTTGTTTGGCCTCCTTCCTTGATTTAATTGAG
TTAGCTACTTGAAGTTGCTGAGGACTGATCTAATTGAAAAGTTTTGCTGGGTACATTAGT
TTGGAGTTGGCAACCATTTAAATATGTTTGAAAGGTGGTTAGGCACTTGACAGGTATAAT
GGAGGATCCTGGTGATGACAGATGACATTGTCACCCAATCCCCACAAGGAAATGAGGACA
TGTCCTGCAATTCTGAGTGGATTCTCTAGCATATATGCAGCCAAGAACTTGCTGTAATCC
AAGCCACATCTAGGTTATGTGAATAACATAACCACTGGGTCAGGAACAAAGCAAGTAAAA
AGATTTGGCTATGGAAGGAAAAAGTTTGCAAAGTCTGTCTAGAGAGTGACCAAGTTCTTC
CTCCCAGGGGCACCACCACAAGACGATTTGTAGGCCATACTAAGGATGTGCTGAGTGTGG
CCTTTTCTTCTGACAACCGGCAGATTGTCTCTGGATCCCGAGACAAAACCATAAAGTTAT
GGAATACTCTGGGTGTTTGCAAATACACTGTCCAGGTAAAGTGAGGGCAACATCAGAGAG
CACGTGTTCAAGACTCCTACCCTTACTCTTAACCTTTCTATCTGTGGTGATTTTAACTCC
TGTCTGGAGTCTGTAAAGGTTCAGTTTCTGGGGATGTGAATGCAGTGCTGCCAACATTGA
TCCTACTGATGAGGGGTGGTATATAGCATTTCTTGGGACAGGACTGTTTCCTCTTATTTC
TTTCCTTCCTCTGTAGGATGAGAGTCACTCGGAGTGGGTATCTTGTGTCCGCTTCTCACC
CAACAGCAGCAACCCTATTATTGTCTCCTGTGGCTGGGATAAGCTGGTCAAGGTGAGCTC
CCAAACAGGGTGCAGGACCTTTACAGGCCAAAATATGCTTTGCCTCCCACATAGTCATAG
GCTTTAACTTTGAACATTTTTATAGATTACCTCAGTTGACTTTTTGCTCTTCTTGATATT
TTTTCAGTACAGAACATTAATTTTTGACATTCGATCTGAAGTAGCTAATTATCTCACAGC
ATTTGCCACCTGTTTTGGTCCCAGTTGATCTTAATTCACTTTGTCCCATAGTCCTAATAG
ATGGGGTTGTGTGGCTTAGTGGTAGAGTGCTTGCCTGGCACGTGTGAGGCACTGGGTTCA
GTCCTCAGCATCACATTAAAAAATAATTATTAATAAATAATACTCATACGTAAGTAATGT
ATAAACTCAGGTTATGGTTTTCAAACTATTTTAATGCACTTGTGTCACTTTGTGAAATAT
TTGCAGAATTGAAAATTTGGAACTTAATGAGTTAAGTGACTGAGACAAGTTTGTGTTGGT
TTGCATTTTCATTTTTATTACTGGTAGAATGATAAATGGCTGTTATGCCAAGGAATGCTT
TTAAATAATGTCTCCTTACTCTGCCCAATCTTGAACTAGATTGTTCATCCATGAGCCCTT
GTCTTTGTAGGTGTGGAATTTGGCTAATTGCAAGCTGAAGACGAACCACATTGGCCACAC
TGGCTATCTGAATACTGTGACTGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGAGGCAA
GGTATTTTGGGACTAGGCATCTTCTACTTGTTGAGGAAAGGTGTCTCAGAAAGAACACTT
TGTCTTTGACATAAATTGACAGCTGAAAGATTAGCTAGGTTTTTCAATATATGTTCCTGA
GGACAATATTTTCCAGAAATATACTGTTTGTCTCCTCAAAGCAGTACATGAGATTAAGTT
GTCAGAGGCTCTTGATACAGTTGGTGAAGTGTCATTCAATAAAGGAAAGATTTAAAGAAA
TAATGAAATTTTGCCAGGCACAGTGGCATACACCTTGTAATCTCAGCACTTCAGGAGGCT
GAGGCAGGAGGATCTCAACTTCAAAGCCATCCTCAGCAACTTAGTGAGATCCTGTCTCAA
AAGGACTGGGGATGTGGTTCAGTGGTTAAGCATACTCCTGGGTTAAGTCCCTGGTGACAA
TAATAGTAATAATGGTATTTGAGCTTTCAGGAAGTCAGGGTCCTAGGGGAATTGAGTCTG
ACAAAATCTTGAGATGAAAGGGGCTGACATCTGGAAGAGGTCACATTGCCCTAACTCATC
TTTCCTGTCTGCCCAGGATGGCCAAGCCATGCTGTGGGATCTCAACGAAGGCAAGCACCT
TTATACACTAGATGGTGGGGACATCATCAATGCCCTGTGCTTCAGTCCCAACCGTTACTG
GCTCTGTGCTGCTACAGGCCCCAGCATTAAGATCTGGGTGAGTATGGGCTACATTACATA
CTGAGTTCTTGGATGCACTGTCTCCACCTCCTTGCTTCCTCCCCAGCAATTCTGTGATTT
ACTGTGTGCCATTTTCAGATCAGAATTTTCTGACAGCAGGAAGACATTTGTTGCCTACCA
AAAGGGATGACCATGTGTACCAGCTTTCTCAACTTCAGCATAATTGCTATTGTAGTCGAG
ATATTGGGGGAGGGCTGTTCTGAGCATTTTATCATGTTATCCTTTGTATTTACCCACTAG
ATAGTATTAGCAAAACAAAATGTCATGGATTAAAAAAAAAATGCAGTGGTGTAAGTGTTC
TCTATACTCTGGTTTTGACGTGTTCCCCAGGACTTGGAGGGCAAGATCATTGTAGATGAA
CTGAAGCAAGAAGTTATCAGTACCAGCAGCAAGGCAGAGCCACCCCAGTGCACCTCTCTG
GCCTGGTCCGCTGATGGCCAGGTAAGTGGGTCTGTCCTGGCTTTGAAGANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGCTGGTTTTTGCTCTAGGAAGTACTTAA
TTGAATATCAGCACCTGTACTTATGATAATTGAAAGAAGGGGTTTAATGTGGTACTGAAG
GATCAAACCCCAAGGGCCTTGCACATGGTAGGCAAGCACTCTACCACACCACAGCCTTTC
TTAAAAGAAAGGCTATCTTTGGGACTGTAGTTTGTGGCTAGACCTTGACCTGTCTGTTTT
TTCCCCTTATAGACCCTGTTTGCTGGCTACACAGACAACCTTGTACGAGTATGGCAGGTG
ACCATTGGCACTCGCTAGAAATTTTATGAGCTTCACAAATAAAAAGAGTGGCTTTCTACA
ACTGACTTCAGTTCTTTTAGGAAGTATTTTTCTCTAATAAAGTGAAAAGAGCTACTTACA
GGTTAAAATAGATTTAGTTAATAGTAATGTAAAACTGGAAGCAGAATCATGAAACTTTTG
AACCAAGTAAACATAACTATGGGAAAGAGGTATATCAGTTTTTAAGTTCCCTTGAGTATT
GGGTTGGCATTAGATGTAACATATGGGATAGTACATAGGGTAGCTTCCCAAATATTCCCC
CAATAAGGCTTACCTTAGGCCTAGAGAAACTTGAAAGGAACAGATTACTTCAAAACAGTT
GCAGTTGATTTAGGAATACCAAGTTTCCTTATGCCTTCTCTCATTTCCTCCAAAGATATA
TTGAAGAAACTTTGAAATTTCAGATTATTGTATCTCCATTAATTTGGGTCCTTGGTTAAA
TTGGAGGAATGGGTTGTACTGAGGATTGAACTCAGAGGCACTCAACCACTGAGCCACATT
CCCCAACTCTATTTTTGTATTTATTTAGAGACATACACGTTTTCTTAGTGCCTCACTGTT
AGGCTGGCTTTGAACCCACGATCGTCCTATTACAGCCTCCCCAGCCACTGGGATTATAGG
CATATGCCACTGTGCCTACATTTTTTTTTAAACTAGGCAGCATCAGAAGTTTTTTANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 2124..2295, 2827..2974, 3196..3291, 3910..4020, 4576..4716, 5070..5180, 5532..5597
1001..1109, 2124..2295, 2827..2974, 3196..3291, 3910..4020, 4576..4716, 5070..5180, 5532..5594
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved