Spermophilus_tridecemlineatus Locus C1orf79
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus C1orf79
Spermophilus_tridecemlineatus
C1orf79
GeneScaffold_5007
SNORA44, SNORD99
1069..1198, 2126..2205
3324
GGGTGCTGGAAACGAGTTGGGTATGTAATTAGGCACTTGGGGTTGAAGTTTTGGGCCTC
AGATCACCTAATTTAGGTAATAACATCAATCGGTGAGCCTGAGAACTGCTGCGTGACATT
GGACAATTGACTTAACTATAGAGTTTTCTAGAAGGTATCTTGGTGTGAATATAAGGACAA
GATTTCAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCACATGCT
AGGCAAGCACTCTGCCACGAGCACATCTCAACCCTTTAAAATGATTCTGTGAGATTGAGA
TAATGCATACAAAAAGACTGGTACCCAGTACAGCCCTTAGGGCCTACTGGATGACTAGTG
TCCTTTGGTAGCCAATGATGCACAGGATTTAGATGAATTAGGAAGGATAAGTGTGGTTTG
GCTTTGAGGTTCTGTGGTCTCCATTGCCCCCTGGCCCTTATCGAAGCTGCAGCTGCTTCC
ACATAGCTTCTGTGGTCAAAAAGGAGCCCAGAGCAGCAGTTTTCCTTGACGGTCGCCGTT
CTGTTTGCTGTAACTGATCTGCAACATTTTGGGAAAAGACAACTTCATTGTTCTTGCTAT
TTCTTAGGGATAGCTGGAGACCTTTATTAATATTGAACGTAGAGTTATCAGGATGAGGTG
TTGAAAAATAACTAGTTGAGCCCAGGAACCAGAATGAAGGGGCATTTGGGGGTGTGTGGG
ATACCTGTACTGGAAAGATCAGTGGCACAGAGAATGCAAGCGCTTTGGTCTCTGTCCTGA
AAAGCTATGTCATCAGTATCAGGATTAAAAGCCAGGCAGACCTTTATGATTGGATGAAGG
AAATGCTAAGATCAATCAGGACAGTTGTGCTGTCTTTCATCTTAGCCATGCCAGATCAAG
ATGCTATGAAGATGGTGGCGAGTGAGGGTCATGGTGATGAAATGCAACAACTTCAGGACT
TGGTAAGTTACTTTTGGAGCTACATGGGGAGCTCCCTGGTGGAACAGTACAGCATGTTTC
CAAGGGCTGTGGCTGGTTGTGGCCATGGGATCTCCAACTGCATGCAAGAACAACTGGAGA
GACTTTGACAGCTCAGGTCAGCACAATACCTGCAGCTGCCACTCACCTTTCCTATAAAGT
CATCAGGACCTGGGTTGGAAGCCTGCCACACCAGGTCCAGGTGTGTTCCGTCAACCACCA
TGTAGGTGGTTGTACTGGATCAACTGATTTAGAGCCTTCACAATAAGCTTTGATTCTGCA
GGTTGCCCCCAGGTTTCCAGGAAGTGTGTGATATTGAAGAGTGAAAATACCAGCTTGTTT
CTGGAGTTGTGCTTTAGATTAAGGTAAAGTTACCATGATAAAGTTACACTTGACCTTCGT
CCCTTTCCCATCGGATCTGATACTGGTCTGGTGTCGTAAAGAGGAAAGTATACTGAGCTG
ACTACCGTGTCTAGTCTGTTTTCTAACACATGGGCTAATTTCAAACAGAAGTGAATTCTC
TTTGAAATTGTTTGCTCTTCCCCTGTACAATGGAGGATAGAGGATGAGTGTGATGCTGTG
TGCATTTGATTAGGAATTGCTGGATAATGTTGTAGTTGAGGGGTGTTTTATTCTCTCTTG
ATAGAGGGTGTCTTTTTTTTTTTTTAGGTCTTTGTAACCAGAAAGTTGTCTTCATCTTCG
ATAATTGGCTACAGAGTTGGTGAGTTAATGACTATTGCAAACCCTGTCCTTAAGCAGTGT
AACAGATATTACACTGCTATGGAAGTTTTAGCATTTAAAAACCATTTGTCAGTGTGATGC
TGAGGATCTAACCCAGGGCCTCACATGCCCTACAAGTGCTCTACACTGAGCCCCAGCCCC
TCAAGTTATCTGAATTTGCCATAAACACAGCTACTGGAAGCAGCAGAGGGAACAGCTCCT
TGGGCAAGAAGGACTGAGCTGCAAATACCCTGTAGTGACTGGAGCTAATGCCATAATTTT
TTGTGTGAGCTCATCTCTACCCCTGGGAGAGTGGGAGGTAGACTAGTGGTTAAAAAGGAG
TAGTTAAGATATTTTTAGGGTCACTCACTGGTCCAGGATGAAACCTAATCTGAATGGACA
TCTATGGATGAGAAATGCGGATATGGGACTGAGACCAGCTCTTAGGAAAGTGCCTGGGTG
GGAACTACCCAGGGCTGTGGTAACACATGGGCTTATACTTCCTTTTCAGGAAAACACCGT
GGGAAAGAAGATGCACACAAAAAGGTGACCAGTTATTAAAGAAGAAAATGGTAGCTTTGT
AAGCAGATTTTTTTTCTTTGCAAATGCTGTAATATGTAGCTATCCATACACAATAAAAGG
CTTTGGAAATGTTTGTCCCTCAGGTTGTTGCTTATTCCTCACTTATATCCCATATATGCA
ACTGAATTATAATCTAATTCCTTCATAAGATTGACCATTGTTTTTCTTTTGCTGGGCCTG
AGACTGTTTAGATCATTTTTGCCTAAAGCAGCAACTGTACACACCACCCCAGTTCCTCTG
GTATAAAATTAATTGGAAGAGACCTTTCAGAAGTGTCTGGTACTGGATATACTTGATCAG
GGATGGGTATGAATCTGGCATGGATTCTGGCTCACACCAAGTCACTTTAATCACATTACC
TCTTGTGAACCACCATATAGAATACCTACTTAGTTTAGGCAATTAAGGCCAAGAAATGGG
AAGGGGGGCTTGGGGCACATGACAGTGTAATGACTGAATCCAGGGGCACTGAGTCACATC
TCCAGCTCTATTGTATTTTATTTAGAGATAGTGCCTCACTGAGTTGCTTAGCTGTGGCTG
AGGCTGGCTTGGAAGTTATGATTTCTAACGTCTCAGTCTCTCAAGTCACTGGGATCACAC
TGTATCTGGCTCCCTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1006, 1014..1021, 1321..1360, 1368..1392, 1398..1402, 1707..1718, 1721..1747, 1750..1755, 1758..1758, 2269..2273, 2276..2293, 2301..2315, 2319..2324
1001..1006, 1014..1021, 1321..1360, 1368..1392, 1398..1402, 1707..1718, 1721..1747, 1750..1755, 1758..1758, 2269..2273, 2276..2293, 2301..2315, 2319..2324
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved