Spermophilus_tridecemlineatus Locus ENSSTOG00000006322
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ENSSTOG00000006322
Spermophilus_tridecemlineatus
ENSSTOG00000006322
GeneScaffold_4919
SNORD55, SNORD46, SNORD38, SNORD38
1237..1316, 1792..1896, 2676..2746, 3180..3248
4472
ATCATAAAAAAATAATTGATTGGTTAACATCAGGTTATTTTTTGGTAAGGATTAAACCA
AAGGGAACTTCACTGGGCCTATTTGAAACTGGCCTGTTCGGAAAACTTGGCTATTATCTA
TCTTCCTATGTCTCTGGAGGTCAGATTAGATTCAATTGGTGATATAGAATTTTAGTGTAA
TTAAGTGGCACCAGAAATAACACCTTCTGTCTATATCTCTTCTATAAGGATGACCAGACA
TGAATATTCAGCTTACCTGTCATTGCCATTTATATGATTCTTTCAGATCTCAAAAATGAA
CACGTCCAGAACAGCTAACTTAGCCTACCCTGTGTTGTTAAATGACACCAATATTCATCA
AATTGAACAAAAGAGATACTAAAAGAATTTTTTGCTGACTCCCTCTCCTTCACCCACATG
TACCTATCACCAAACCCTTGGAAACAAAACCGAAGTCCACCGTCTCCACTGCCTTCCAGC
CTTTCCCAACGCCGCCTCATCAGTATCATCGATTCTAGACCACTGGAGTGACCTTCTGAA
ACTAATCTTTCAAAACGTAAATACAGCGTCCGCCTGTAATCGAAGCGGCTCGGAAAGCTA
AGGCAGGGGGATCGCGAGTTCAAAGCCATCAGCCTCAGCAACTGAGTTAGGCCCTAAGCA
ACTTAACGATCTGTCTTACGTTTTTAAAAATAAAATGTAAAAAGGGCTGAGAAGTGGTTC
AGTGGTTCTAAATTAAATCCCTGGCACCAAAGAAAATAAAACAGAATTAGAATCATGCTC
AGTAGTGCCCTAAACTCCATATCTCCCGAAACTGCCCCGGGAACGTTCCCCGAGTCTGCC
TACAGGCGGCCAAGAGCACTGGGTCGACGGAGTTAAGCCATTGGCTAGACTCGCACAGGC
GTAAGTCACGTCGCCCGGAAGCGACGTAAAGGAGGCGGGGCAGGGTCTCACAAACTGGAC
CGTGAAGCTTTGCGTTTCCTCTTTCCAGCCGGCGCCGAGCCATGGGTGAGTGTTTCTCTG
AGTTGGGGCTGAGGACCGGGTTGACCTCAATCCAGCGCCATCCTGCCCCACGGCGAGTTT
AGAACTGGAGGCGCCCCGATCTCCGGTCACAATCGGCCGTGAAGGGGGTGGCCTGTTGGT
TTTAGAGTCCCGGGGGCTTGGTGGGGGTACTACGGAGGAGCCAGAGTGCAAGCGGCATCA
AATGGCTGCCGCGGGAAAGAGCAATGGCTGGGCCGCACGTGTATGATGACACTTTGGTAA
TGCTGCATATTGCCGACTAAGCAGTGGGGAAGCCAACCTTGGAGAGCTGAGCGTGCGGCC
CGCCGGGCGCGGGAGGTCTGGAGCGTGCGAGTCACCGGCACCGAGCCCCAGCCGTTCAAG
CTTCCGTCCCCGTTTCCACATACAGGCATCTCTCGGGATAACTGGCACAAGCGCCGCAAG
ACTGGGGGCAAGAGAAAGCCCTACCACAAGAAGCGGAAGTATGAGTTGGGACGCCCTGCT
GCCAACACTAAGGTAGGTGCGTGCTTGGGCCTTATTGCCTGAAAGGTCCCTTCTCCCTAC
TGTGTTATGTACTCAGGTCTGTGTGGTGGTGGGTTTTCTTGGGTTCTGATGTTAGGGACT
GCGCGGCCTCCCTACCTTTATATGTTGAATAAATGCTAAATTAACGCATGGTCTATGGAC
TTGGTCCCCCGAGTGTACTGTCTGATAGAGACAGTTGCCTGCAGCGACTTGATCATTTCT
TGGAAGTGTGGGCATTTCTTGTGTTGGGTCTCAGGTTTTTTTCTTAGGAGGTAACTAGAA
TGATGAAAAAAGTATCCTTAGGCGTGGTTGTGGCCGTATTGGTCACCTGTGTGCCACTTG
CCAGTGGAAGGACTTGTCATAGTTACACTGACAGTTACCTCCTTTGAGCCCAGGTTCCCC
TCCCTTGCTTGTCTTTCTTTCCTTGGTAACCTAGTTCTTGTCTCCTTGTATTCTGCAGAT
TGGACCGCGACGGATACACACTGTCAGAGTTCGAGGAGGCAACAAGAAGTATCGTGCTTT
GAGACTGGATGTGGGGAACTTCTCCTGGGGCTCTGAGTGTGAGTGGGGCCCTTCAGAAGT
GGGTGGAAACTTAACACCTAAGCCTGGCTAAGCTTTTGTAAGTGTTTTTAGAAGAGAACT
GCATACTCTGGAGCAAAGCACTTGGAAGTTCCTCTTTGCTGAAAGACCTTGAGGTAGCAA
GAGAGTTTTTTCTATCTCGATTATTCTGCCTATATCCTGAGGGATTGGAGCTGATCTTTA
GAGGGTGGTTGTCAAACATCTCTAGGAAAAGATGGGATTGTGGAAAAGGAGCTGATGACC
ATGGCTGAGTGAAGTAGAGTTCCCTCCTTCTGTGCCTACTTGGGAAAGGAAGGGAAGGCC
AATTGGCCCTTGGTATATGGCTTGATTCTGAATTTCTCTTGTGAGCAGGTTGTACTCGGA
AAACAAGGATCATTGATGTTGTCTACAATGCATCCAATAATGAGCTAGTCCGCACCAAGA
CCCTGGTGAAGAACTGCATTGTGCTCATTGATAGCACACCATACCGACAGTGGTATGAGT
CCCACTATGCATTGCCCCTGGGCCGCAAGAAGGGGGCCAAGCTGGTACGTGCTACTCCCT
GTGTGGGTTAGGGGGAGGGCTGCCTGACTTGAGCCTTCTTGTGATGAAAACTCTGTCCAG
TTCTGCTGCTGAAGGGAAAGAGATGAATGCCTTTAATGCTGAGGAGGGCAGGTATTGGGC
TGAAGAAGGTTCTGATGACTTCCCTGAGCTAATCCATGTGTCCTTTTTATTCAGACTCCA
GAGGAGGAAGAAATATTAAACAAAAAGCGGTCTAAGAAAATTCAAAAGAAGTATGATGAA
AGGAAGAAGAATGCTAAAATCAGCACTCTTCTGGAGGAGCAGTTCCAGCAGGGCAAGCTT
CTTGGTGAGATGGCTGTTGTATTGGGGAAATGGGAGTCACAAAGATGCAGTGTGCCCTCT
GTTGATTTGACTGCCAGGCATGTTTATCTGAAAGGTTCATCAGGGGAGTTTAATGATAAT
TAGACCTTAGTGTGAAGGTGAAATGTAAAATTGTGGGTAGGAAGGTTATATCCACATATC
CTTGCAGCTTGGCTTCAAGTTTCAGGAGTATTTTGGGAAGCCCAGGCATTGAGGGGGCTG
TCTCAGTGATGAAAACTTTGTCCAGTTCTGCTACTGACTTGAAGTGATGATAAAATGTAT
CTGAGGAGACAGTGGGCTTCATGCCTGCCCCCAGGATTCCAGACAACGTGGATCTTTTCA
GAGGATATATGTAGGTGGGTGGGGTTTCTTGTCATTCACTAAGGGCCACATAATCTCTTA
CAGCTTGCATTGCATCAAGACCAGGACAGTGTGGCCGAGCAGATGGCTATGTTCTAGAAG
GCAAGGAGTTGGAGTTCTATCTGAGGAAAATCAAAGCCCGGAAGGGCAAATAAGTCCTCC
TCCCTTCTGTCTTAGCTCATGTAATAAAGGTGTTTATTGTTCTATGTCCTATGTTCATGT
TGTCTGAAATTTGGCTTTTTTCCTATTGATAATGTGGAGCCCCTCATCTCACCTTCTATC
CTGACCCAGGTTCATCCCACTGTGGAGTTCCCTTTGGCCTCATATCTCCCTGAAGGCCCA
GCCTATTAAGCTGTGTGGACTGTACATTTCTATAGTAGGGCTATTGTTTCTTACTGGGTC
TCAGTGGACATAGAGATATCATGTGCAGGCCCAATGGAAGCTGTATTGGGGAATTTTAAA
GATACTGTACCCTTTCCTGTTTGGACCTGTGTTGTAAGGGTTTGATTATGATCATGCTGA
GGATCATAGTTAGGCCCTTATGCATGCTGAGCACATAAGCTGAGCTTACTTACAGTCAGG
TTTACAACTTGGATGAATGGATGATCTAGAAACCTTAAAGTTGTATTCATAGAGGTTTCT
GAGAGCAGATTATAAAAGAATAGGTTAGTGGGCTGGGGTTGTGACTCAGTGGTAGAACAC
TTGCCTAACGTGTGAGTCACTGGGTTCAATTCTCAGCACCACATATAAACAAAGTCCATT
GACAACTAAAAATTTTCAAAAATACATATAATCGGTTAATATGTCTTTGTCATCTTTTGA
ACTGTAATAATCGCTTACCCCCTTTGCAAAATTTTAAGATTTTGATTCCATGTAATTTCT
GCATTGCTGGAGGTTTGTTATTTCTTATCCTCATCCTGCCTTTTTTTTTTTTTTTGTAGT
TGGACACAATACCTTTATTCTGTTCATTTATGTGGTACTGAGGATCGAATTCAGGGCCCC
TGCACATGCTAGGCTAGTGCTCTACTGCTGAGCCACAATCCCAGCCCCTGAAACCATTTA
TTTTGAGAGAGGGTCTCAAACCCTGTGATCCTCCTGCCTCTGCATCCCTTTGTAGAGATT
ATAGGCACCAGCTAAAGTACTTATTTTGGTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1004, 1405..1511, 1978..2077, 2448..2623, 2814..2943, 3363..3472
1001..1004, 1405..1511, 1978..2077, 2448..2623, 2814..2943, 3363..3469
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved