Spermophilus_tridecemlineatus Locus ENSSTOG00000010828
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ENSSTOG00000010828
Spermophilus_tridecemlineatus
ENSSTOG00000010828
GeneScaffold_2277
SNORD105
1796..1881
5789
GGCACACAGCAACGCCCAGATGCCCATCTGCCAAACCATGAATGTTTGTCCCTCATTCA
CTGGGTCACATTTTCACAAAAGTCAAATCACACAGGGACAGAACAGGAGGAAATAACCAT
GCAGTCATTTCTCAGAGGTAGAAAGAGATTCATGCAGAGCCCCCCCGGAAGCGGGCCGGG
GCCCCTGACCTGTATGAAGGCCCTGCCGGCCAGCAGCCCAGCACGGGGGGAGCAGCCTCC
TTCCCCACTTCCAACAGTCCTGAACTCCTGCAGTAACCCGAGTGGACTCCGGGGCTGCAA
GAGGAAATGGTTGTCCCAGATCTGAGCGAGGCTGCCAGGCTGGGCTCTGGGCCGGGGCTG
GGCCCCCCACCCTCAGCCCCTGCCGGCTTCCCCATTGGCAGCAGAGAGAGGAGAAACCTC
CTAAGTCACAGACAGACTGAGGGAGGGAGAGAGGCCACCGAGTGGAGAGACCTGGGGAGA
AGGGAGAGACAGGGAAGCGATGGAGAGGAGAGGGGAAGGCTGGAAACCGACTGATGTTGG
AGGAAAGGGAGGCCGAGATGGGAGGACAAAGGATGGGGAAGGGGCAGGGGCTGGGGGAGC
CGAGAGAGGGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGCACCGGTGTCTC
CATAGCAACCCCTCCAAAGATTTCCTACTCCCCGCCCCCGCTCCCCTCGAGGCCACTTAG
TGCGCAGCCTGCCCGATGACGCCATCGGCTCCGGCGCCGGAAGTGAGCAGCGCGGCGCCG
GAAGTGGCCGGCAGAGACGGCCTCGTGGAATAGACGGCAGCATGGGGCAATCGGGGAGGG
TATGGCGCGGCGGCCGAGGGTGCGGGGAGTACCGGCGGGGTCCCGGCGGAGGCCGAGGCG
CTCACCGTTCGTCTGTCGCCCCCTCAGTCCCGGCACCAGAAGCGCGCGCGCGCCCAGGCG
CGGCTCCGCAACCTCGAGGCTTACGCCGCGCAACCGCACTCGTTCGTGTTCACGCGGGGC
AGTGCGGGTCGCAGCGTCCGGCAGCTCAGCCTGGACGTGCGTCGGGTCATGGAGCCGCTC
ACCGCCACCCGTCTGCAGGTCTGCCCAGCCAGCCCGCCTCTACCCACCCTGGGCCGTCAT
CGCGGCTGAGGGCCGGCTCTGAAACCTCGGGAGGCCTCTGTGTCCCGACTGGAGAACGGG
ACCTACCTGAGGACAGGGTCTCTGCATCTAGCTTGGGGCTTAGTTGGACAGTGGGGACAG
CAAACCGTAGCTTCTCTGAAAGACCTGGGGCAAGGCTTCACTGGGCTTCTGATTGCTCAT
CTGTTAACGAAAGGTGCATAGGAGGCAAGGAGCAGAGATGGCACTTAACTAAACCCTGGC
TCTAGCGATCGGGACCCTCAGCTGAAGGTAAAGGGTCTTGGTCAGTGAAGAAGAACACTA
CTCGTTTCTTTTCCTTTTTGTAATTTCTAGATCCGTAAGAAGAACTCGCTGAAGGACTGT
GTGGCAGTGGCTGGGCCCCTTGGGGTCACACACTTCCTGATCCTAAGCAAAACAGAGACC
AGTGTCTACTTTGTGAGTGGGCATCCACACCTTTCATCTCCCCTAAGCCCTCTCCTTCCT
TGTCTCTCATGATGAAACCCTGTGCCTCTGAGCTGCCATGATTCTGGCTTCAAAGTAAAC
GCTCTGAAGAGACAGGCAGAGGTTCCCACTTGCCCTGCCCCTGCTGAATACCTGCATCCG
CACTGATCCTCTTTTTCTCCTGCAGAAACTGATGCGGCTCCCAGGAGGCCCCACTTTGAC
CTTCCAGATCAACAAGGTGAGGGGTGGAGGTGGTACAGGGGCCATGTTAGGTAGGAGCTG
GGCTTGGGGATGGCCCCTGCCACATGTGAGTGATAATCATCCACTCCCGTCCTGCCTTGC
AGTACACACTGGTGCGAGATGTGGTCTCCTCGCTGCGCCGGCACCGCATGCATGAGCAGC
AGTTTGCCCACCCTCCCCTCCTCGTACTCAACAACTTTGGACCTCACGGCATGCATGTGA
AGCTTATGGCCACCATGTTCCAGAACCTGTTCCCCTCCATCAACGTGCACAAGGTAGGCT
GGGCCTCTTGTCTTGGCAGGTGTGGGTGGATGGGTCATGGAATGGGTACCACCAGCCCTT
TCTTAATGACCTTATTTGATAGAGGGGAAACAGGTTTACAGAGATGTCATTAGCCTGAGG
TTAGAATCAAGAGTGTGCGACTAGTTGGGCACAGTAGTGCGTGTCTGTAATCTCTGCACC
TCAGAGAGCTGAAGCAGAATTGCAAGTTCAGAGCCAGCCTCAGCAACTTAGTAAGGCCCC
GAACAACTTAGACCCTGTCTGAAAATAAAAAAGGTGAGGGGGAGGGGTTGAAAGAGTGCA
GGTCTGGAGTTTTGTTTGGGGCTCATTATCCCCACTCCACCACCTTCAGAGTTGGGGATT
AAACCCAGGCCCTTGTGCATGCTAGGCCAAGGACTATAGGGTTTGGTTTGGTTTGGCACC
AGGGATTGAACCACCCAGGGGCACTTAACCACAGAGCCACATTCCCAGCCCTTTTTTATT
TTGATGCAGGGCCTTGCTAAATTGCTGAGGCTGGCTTTGAATTTGGGATTCTCTTGCCTC
AGTCTCCTGAGCTGCTGGGATTACAGTCATGTGCCACCGTGCCCAGTAGGACGCAGTTTT
TTTTCAGAGCCCCAGCCCCTAGTCCATGTTGGCAGCAGTTCTCCTGCTCAATAGGGAATC
TGATGTGGGCACCACTTGCAGCACCAGCAACTGCATGGCATCACCAGTGCTCCCCACCAA
ACATGAGGTTCCTGGAGCATGGCCAGTGGTGTGGGGCCTGCTTGGCCAGGGTTGTGCAGG
CTGCAGGCAGCTCACTGGGTCCCTTCTCTTCCCTCAGGTGAACCTGAACACCATCAAGCG
CTGCCTTCTCATCAATTACAACGCTGACTCCCAGGAGCTGGACTTCCGCCATTAGTGAGT
GCTCTGAGAGGGAGTGAGGGGTGCAGGGCCAGGCCTCCTTGTGCGACTGATGACAGCACA
GCTGCTGAGACTCCGTGATTGCTCATCTCAAAGTAAACGCTCTGATGCACTGCCCGGAGG
CAAGGGGCACAGAATGGGTTCTGACGCTGTGACCTAACGTCACTCGTACCCCACCCCGCT
TCTGCCGTGCAGTAGCATCAAAGTGGTTCCCGTGGGTGCAAGTCGGGGGATGAAGAAGCT
CCTGCAGGAGAAGTTCCCCAACATGAGTCGCCTGCAGGACATCAGTGAGCTGCTGGCCAC
GTGAGGAGGGCTCAGGGTGGGAGGTCACTGCAATCCAAGGGCCCTAGAACTGTCCCTGGA
GTCTGATCACCTGCTAATTCCCATGTGTCCCCACAGGGGTGCAGGGCTGTCAGAAAGTGA
GGCGGAGCCTGATGGCGAACACAACATTACTGAGCTACCCCAGGCCATTGCAGGACGTGG
CAACATGCGGGCCCAGCAGAGCGCAGTGCGGCTCACAGAGGTGATGCTCAGTGGCAGGGG
TGACCTTCTCTGGCAGCCCCCAGTCCCAAAGAAGAACTGACTCTTCCTCATCCCCCATCC
CCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGATGCTGAGACCCAGGGGTGCCCCAGAGCCGAGGGGCTGCAGCAGAGA
AGAAGATGAAGCAGAGTATTTCCGCCAGGCAGTGGGCGAGGAACCTGATGAGGGTGCGTG
GCAGGGTCCTGCAGCTGGGCACCCAGGACATGTTTTTGGTCCTTGGGGGCCCTGACGACT
GTCTTCCCACAGACATGTTCCCCAGGGTGACCAAGCGGAGACTGCACACCGGGCCTCCAG
GCAAGAAGCAGCGGGTGAAGGAGCGGAGGCCTAACCGAGACAGGGGTCAGGACGGTGGCC
GGAGGCCTCTGAAGCCCAAGAGTAGACCCACGGGAGTCCAGGGCAAGCAGGGGCACAGAG
GGACTGCCCGAGAGCGCAGCCGGGGGAGGCCACTGAAGAGAAGGGCTTGAGTCTGAGCCC
AGTGATGCATGGAATGCCCCAGATTGGGGCCCAAAAGAGCTGCCCCTGTGCAGCCCTGGT
TTCCTTTCATAAAGGAGTGGTAGTCTAACCCCCAGCCCCCCACCCCCACCCTCGCACATC
AATAAAGACTGAACTTGGCGGGTGTCTGAAGTCTGCTTTCTGGATGGATCAGGGGCACCT
GGTGCCCAACATGACAGCCTAGGAACCAGGGCCAACCTGGTTTCTGCCCCAGATCCTGGT
GCATGTCCCCCCCTCTGGCAGTGAGGAGACCAGTGGTTGACCATGGTGTCCTGTGCTGAG
GCACTGGGCCCCTCCTGGTCTCCCCTCCCCCAGGTCCCTGAGCAGACTACCTTCTGCTGT
GGTGCAATGAGGAAGGAAGCTGGGCGTCTGACCAGCTCTGCAGGCTGAGGGAGGGGCTGC
TGGTGACTGAGGTGGAGCCTCAGCCGGGCTTGGCGTGGGTGGCGGGCCACAGGCTGGCTG
ATCAGGCCATGGCGGCCACCATCTCAGGTAAGGAGCAAGTGCTGGACTAATTAAGGGTCG
AGTGGACACATGGCAGGAGTTAGGCTGCTCAACCCAGGTGGTGACAGAGGGGCTGGCCAG
GGATCTTCAGGAAGAGGGGAGAGGGTTAAAAGGTGCTTGGCAGGAGGCTTCAGAACCTTC
TGAGGGACAGGCTGGGCTGGAGCGGGGCTTGCGCATCCCCAAGAACTAGGGGCCAGCCTG
CCACACAGAACAGGCCAAGTTTTCAGATCACAAAGCTAAGGCTGAGGGAGGGGCACACAA
GGGGATGGGAACCAGCTCTGCGGCACTTATTGGGGACAATGACAGTGGCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGACTGCATGACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1107..1277, 1650..1751, 1945..1995, 2102..2272, 3097..3173, 3372..3479, 3576..3699, 3934..4012, 4113..4240, 4438..4492, 4572..4762, 4767..4772, 4775..4789
1001..1018, 1107..1277, 1650..1751, 1945..1995, 2102..2272, 3097..3173, 3372..3479, 3576..3699, 3934..4012, 4113..4240, 4438..4492, 4572..4762, 4767..4772, 4775..4786
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved