Spermophilus_tridecemlineatus Locus ENSSTOG00000007788
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ENSSTOG00000007788
Spermophilus_tridecemlineatus
ENSSTOG00000007788
GeneScaffold_1186
SNORA68
3372..3504
4940
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCCCACCCCCGCTCGGAAAATAGGTACTTATCCTCTTTT
TTCTTCTTTGCTTTATTTTATTAACCTGTTATCAGTAAGTTGTTTGTATTTTTTCCTTTT
TGCCAAAGAGACTTCTTTTCTGCCTGAGCAAACTGCTAACCCAGAAACCCCTCAAAGGAT
GGGGGCTGGGATCTTTGATTTGGGGTTCTTTTCCCACCTTCTGTGCTGGGGATCACACCC
AGGGACTCGTGCATGCTAGGCAGGTGTTCTACCACCCAGATACACCCTCATCCCCTAAGG
GTTGAATCTTGACCAGTCCCAAAGTCCTCCACCACCATCCTCGGGTCTCCCAGGATCTGT
GAGAACCAGGGAGCAAAGAGGTGGGGTTTGAATCCCAGTTACTACAAAACACGAATCAGA
CCTCCAAAAAACAGTAACTAGCATTTCAGCGCTTCATCAACGTTCGTGTGGAACATCTAC
AGGAGAAAAACATCTTTATTCCCATTTTACAGATGAGAACTCTTAGGCACGTGACTCAAG
ACCTCCGTAACGCACTTCCGGGGAGAAGAGGCGCCAGGTTGGAAGAATCCCCACGAGTGC
ATCGTAGGCTCTGCGGCCTCCGGGCTCTGTGGGGAAAGGAACGCTGGAGTCCACACGGGA
CCCTACGAGTGCCTCTGGCGCCGACGCTGGGTCACGGCCCCGGAACAGGTGACGCTCGCT
GCACCTGGGAAATGTAGTCTCGCGGTGAGGCGAGGCCGGGCTGGGACTGGTGGATGGATT
CGAAGCCAATGAGGAAGCGGACCTCCTTGAGCGCCGAGACAAGAAGCCAATGAGCGCATA
GCTTTTAGAGGGCGGGACTTCCTGCCGTGGACTCATGGTGAGCGGCTGCGCGAAGGAGAC
AACTTCCTTTTGTGGGTGGCGGCGATCGCAGAGAGAGCGCTATGAAGGCCTCGGGCACGG
TAAGGCGGGTGCTGTGTGGCCTGGGGTTGGGGGAAGCGGCGCGGACCTCACCAGGGGCCC
GGGTCGGTGGCGCAGGCCGAGTCGGCGGTGCGTGCTCCCGTCTGGGTCCTCCTAGGCCGC
GCGCCGACGCCCCGAGGTGTTGCCAACATGGCGGCCGTGCGGGCGCCGCGTGGGGAGGCC
TGCGCGTGGCCTGGGCCGGCGCAAGGGCCCAGGGAGGCCGAGTCCGCTTCCCAGGGGAAG
GGACATGTCGCACAGCGTGGTGGGCTGTGCCGCGACCTTTCCTGTAGTCTCTGAGCGTTA
GTTTGCCCGTCTGCGAAGTTAACCTGGTGGGGGATAGCAATCGCTTCTGCCCTGGAGTGG
CTGGGAGGAGACGTGGCAAACATCGAGCGCATACAAGGAGCGCGGGCCATAGGACTGTGC
ACGCGCCGGGCAAAGTCGGGGCACTGTAGCACACAGGGGAAAACGTACTGCCAGCCCGGC
GCGATGGCGCACGCCTGCAGTCCCAGCTGCTCGGAGGGCTGAGGTGGGAGAATCGCGAGT
TCGGGGTCAGCCTGGGCGATTTAGCAAGACTCTGCCTCCGGGAAAAAAAGAACGGGTGAG
GTACAGACCTCCAACCTCGTTTTTCTCCCTGGATCAGTTGTGGGCCAGCTCCATTGTTCC
CTTCCTGGGTGGGTGATCACAAGGCCAGTGGATCTGCCCAGAGCAGGAAGTAGGAGCAGA
GTCTTGGAAAGTTGTGGCTACTTTTCATTGATGTCAGTAAAGGCTGCGTTGCCATTTGTG
GACTTGGCAGACCTCCTCACCTTTACACCTGTAGAGAGGGTTCTGCAGGGAACCCACAGT
TGCAGAGGGCCCCGGGTTCTTGTCCTGGTTCGTTCTTGAGTTGTCTGGAGATCTCAAGGC
CCCAGGATAGAAGAGGGTGGTCGCTAAACCGAAGAGTGACTCACAGAGCAGTTAGGGATG
ACAGCTTGAGAAAGGAGGTGCCAATCTAGGTCTCAGTTTTCCCACTTGTAAAAAGAAAGG
GAGGGACAGCAGATTTGAAATGTACATCAGAAATTTTGAAATGCACCCAGAATCCTCACT
GCTCCAACTCCGGTTTGTGGATGAAGGTCGGGTTGGGAATATGATCCCACAACATCTGAA
TTCCCGCTGGAGATCCTAGGAGAACCCTGTGTCCATTTCCTGTATCTGGCTATTGCCAGG
CTTGGTTCTGGCTGCTAACTTGGCCTTACTGCTATTTTCTTTCAGCTTCGAGAATACAAG
GTGGTGGGCCGCTGCCTGCCCACCCCCAAATGCCACACCCCACCTCTCTACCGAATGCGA
ATCTTTGCACCCAATCACGTTGTTGCCAAGTCCCGCTTCTGGTATTTTGTATCTCAGCTA
AAGAAGATGAAGAAGTCTTCAGGGGAAATTGTCTACTGTGGGCAGGTATGGAAAGTCTGA
GACACTGGATCTGGAGTGGATCTCTGCCTTCCAGCCGGCACTGAGCATAGCTACAGGCTT
AGCAGTCTTCAGAGACCTGGAGCCATGGTGTGGGATGGGCTTCCCTGTGCAGGCAGATCC
ATGGTTATATAGCCTGGGACCCTGGGAGGAGGGTAGTTGGCGTGGCAATCCTTGGTGAAG
ACTCTTAGCCATGTCTGTGAAGTAGGGAGAGGTCCTGTAACTGGGCAGGTGCACTGTAGT
GGACATTGGGCAGTGGCTAGTTTGGCCTGCTTGTCTTTGGAGATTGGCGTCTGTGTGTGC
TGGGAGGCAGCTCTGCCTGAACCCTTTCTACACTGGGCTTTGGGGGTATTTCCCTTACTT
AGCATGCCCCCTGAGGGTGCCTAGAGGAGCAAGACTTGGAAACTGCTGCTTCAGGGTCTG
ACCCTAGGTGAGGCCTGCTTGCCATCTGCACTCATACTGACCACCCCTTGCCTTGGCAGG
TGTTTGAGAAGTCCCCGCTGCGGGTGAAGAACTTTGGTATCTGGCTGCGCTATGACTCCC
GTAGTGGCACCCACAATATGTACCGGGAATATCGCGATCTGACCACCGCGGGCGCTGTCA
CCCAGTGTTGTGAGTTGCTGGTGTCGCCTCCTACCTCAGGCTAATAGTACAGGCATCTCC
AGTTCCACCTGACTCTCAGAGCAAATGAGAGGTGCTCAGGCCCCAGGGGGCTTTTTGTCT
GAACCCTGGTAGCAGGTGTACCTTAGCTCAGAGGGAAGAACCCCTGGCCTTGTGGATCAT
GCGCCATCTTTCATTAAACCCATGCCAACCTCCCCAGTTTAGAGAGTCCTCCCCACGTCT
TTCCAGACCCACCAAGAACCTGGCCCAGCCCTGCCCATTGTTGGTGGCTGGCTCCATTCC
CCGTGCCTCCCACCTGCACCTCAACCCAAGAATTGCTGTTTCTCGTAGCAGTGGTTTAAA
CAGAGGTGCTCACAGCAAGTGGATCTCGTCGCCTTTGAGAGGCTGTGGCTGTGCCCCTCA
AAGTGAATTTGGAGGTTCTACACTCCTTTGACCAGGCCTGCTGGGGCCAGAGCCTGTGAC
CTCTAGTCATCCCCCAGGTGGAGCCCCCAGGCTACTACCTGGCTGACTGCCCCTTCCCCC
TGTGCAGACCGAGACATGGGTGCCCGGCACCGTGCCCGGGCCCACTCCATCCAGATCATG
AAGGTGGAGGAGATTGCGGCCAGCAAGTGCCGGCGGCCGGCTGTCAAGCAGTTCCACGTG
AGTGCCCTAAGGGCCCTGCTGGGCAGGCTGCACCTAGGGGGTCCTGCACAGGGGGCTTGT
CACACCTGGGTGACCCCCAGAAGATGCAGGTAAGAGGCCTCCATCCCCTCACTACCTTCT
CCCCACAGGACTCCAAGATCAAGTTCCCGCTGCCCCATCGGGTCCTGCGTCGCCAGCACA
AGCCACGCTTCACCACCAAGAGGCCCAACACCTTCTTCTAGGTTCAAAGCCCCCCCAGGC
GTTAGCCAAATAAACTTGATTCTTAGGCTCAGACCTGTGTTTTCTTTTGCACGCTCTGCA
GAACTCAAGACTGAGCAGTGAGAGGAATCCAGCCCAGGTCACCTCCCTGGGGGACAACTG
AGCTGAGCCTTGCATACTAAAGTCCTTGGTGCAAAACCAACCCACATCTCCCCAGTCCTC
TGAGCTCCCTCCTGCTTGTTCAGCCAGTCCAGGGTTGTGAGCTGCAGGTCATAGTCCCCT
GGATCTGTCCCCACACTGTTTGAGACACAGGCCTCAGCCCTGTCCATCTCCTGCCCCTGG
CCAGAGTCCTCTGAGGTGGTGGGATAGCATTCCCTGTTGCCTCCTGAGGCTTCACCCTCT
ACGCTGACCCTGGCTTAGAACTAACTGGGTTTGCAGTTCCCCACATTCTCTGCAGGTACG
TGGGGGCACCTGCTTGCCATCCTGGGGACCTGCTCTCTTGGATGAGGTAGCGCTAATCTT
GCCTAAGAAGATTAAGGTCTCCCCTTAGGTGCTTGTCTCCAGGGAACAAGTTCAGGCCTG
GAAAATACCAGGCACAAGCTAATCCCACCCTGGAGGTCGCCACCCTGGCTGAGCCCCCAA
CCACAGGAAGCTAGGCCTGCAGAGATGGAGCAGAGACTCAGCCAAGAACTTGGTTTGGGG
AGCCTCCTTCCCCTGGCCTGTGACCTTGGGCAGCCCTGGCTTTCTGGTGCTTGCTATTTT
CATCTGAAGGTCAGCATGACATTTACTGTTTTGTCAATAGTCGGGAAATGACCACCATGT
GAGCACTGGGGACAGGCTATGGGGCCTACCTTAATATCCCAGAGACCCACAGGTTGAGAG
GAGACCTAGGCCCTAGATCTGCAGTGTCCAGACACCCCACTCCTCTGCACAGTGGGCCTG
CAGAGGCCCAGGAGTGGGGCCTGCTGAGCTGTGTCCATGGAGTCACAGGAAATAGAGGTC
TGGGGGTGGGACCCTGCAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 2265..2444, 2939..3068, 3607..3716, 3848..3940
1001..1018, 2265..2444, 2939..3068, 3607..3716, 3848..3937
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved