Spermophilus_tridecemlineatus Locus GTF2A1
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus GTF2A1
Spermophilus_tridecemlineatus
GTF2A1
GeneScaffold_134
SNORA79
46565..46711
59790
TGAGAGCAAATCCTTGGTTTTATTGATAGCCAGTAGCTTTAACCTTAAGCAAGGTATCA
AACACAAATAATGACAAAGGATTAAATGAAAAAATATTTGTTAACATTAACATTTTGATA
ACGTCTAAGAGTTATAAAGAGACATATCTAGTTTATCATTTGGAATGCAAACTTCTTTTT
TTTTTTAACCCCCCATAGGATAAGGTTTAGGCTGATTGTTCTAACTCCTTTTGGTTTTTA
GAAACCTTGTAAAGTGCTCTCACATTTGTTTTCATTTTAGTCATTCTTCTGTTAGTCTTC
TGGAAACTAACTCCTCCACCCAACTCCCCCCCTCCAAATAATACCAGCAATAATAATAGT
AATAATTACATTGAACATGCAGGGATGTTCATGATTTTATTCTGTAGTGTCACCTAGGCA
GGAGAAGGAAGAGAGAAATCATGAGAAAAGAATCAGTGTATCTGTTCCTCTGGGACCTTG
AGATCTGTAATTGTGGTTATATGAATAGTTTCATGGTATAGCTTGGCATTACAAATTGGG
TCACAAAAAATAGAAGTGAGACGATTTTTAAACTTGAATGTCCATTATTACCAGATGAGT
GGACATGAGGTTCTCTAAAGTCTCAAGACTTAGTGGCAAGGTTATATGGTATAACAGGGT
ATAAAACACAGAATGGAATAAAAGGAACCAGATATAAGCAACCATAAAGCCATTTTAAAA
TATCATGTTAAGTATTTTTTCTACAAAATAGGAAATTATAACTGAAAATGTATGGATCTT
ATATGTGTAAGGACCTTCTGTTTATAAATTGTATTACAGGTCTTAATACTTCTCTAATGT
GCAGTCATCAAGTACAGTACAAATGTGTTTATAGAATGGCCATTACATTATTCTAAAATA
AATTTTAGATAGTTGACAAGATGACTTTTTAATTTTTTTGAATTTGAATCTTTTAACCTG
TTGAAAACAATCTTTTTCAAGAGTCTTATTTTCCTTTAAAGCCTAAATTATATAGATCTG
TGATTGAAGATGTTATTAATGATGTGAGAGACATCTTTTTGGATGATGGAGTGGATGAAC
AAGTCCTGATGGAACTAAAAACTGTGAGTTTGTCTCTTTTTTTAATATTTATACTTTCCC
CCACTAAGGACATGTTCTTCAACCACAAATGAATGTGTTTCCATAGGATGAACATTTGAC
TCTGCTTAAGGATGCAGTATAGTTTAGTGAATGGGTGGTGGTTTTAAATCCCAACTCTAC
TATCCAGTCTTCCTCTGAACTCAGGCAAGCTACTTTTATTTCAGTTTCCTTACACGAAGA
TAAGAATTGGTAGTATTTAACCTTAAACAGTTTTGAGGATTAGATGTACTAGCTACATAA
AATACTTATCACAATGCCTACCCAATAGCACTAGCTATTGTTATCGAGTGGCTAACATTC
TACATTTTATAGTCCAATTACTTAAAATGCCTGCAACTTTTTAAAATCATTTTTGGTCTT
AATATACTTGGTTGTAAAATTGAATTTGTAAGATTGAAGTATTTAATTAAAAGAACTTTA
GGTTCTTTGCTCAGATTTTTTTATGTGGTCCAGATGTTATATTTAAAATATGTTTTATGT
TGGGAGCTGGTTTTCTGTTTATTGGATTTAAACAGAAATTTTTTTTATGATGATTGGTGA
AATTGTGGAATATTTTTGCCCTCTTGATTAGAATAGGGTTCTCAAATTATATAGTGTATG
GATTTCTGAGTTTTCTTCACAGGTGAACTAAACACCTAAGTCTGAAAAATCATAGACTTT
CTTTCATTCTTTTCAAGTAAAATTGGTGTTCTATGAGAAAAGTGACTAGCTAACTCATAG
CTAAAATGCTCCTTTGCTTTTCCTTGAAACAGTTGTTCATATGCAGCAGAAATGATTTAT
ACATACTTCCAAGTCTGATGAAATTTATTCATGTATTGTGCTGATGTTAGAAAATTTGAT
TGCCTGTTGTTCTGTAATGAAATGTGTCAACATTTGAAAGATCTGTATAATTCATTCAAC
TTTTATTTTCCAAAAGTTCATTGATATACAGTTTCAGATTTTACATTGCTGAACTTTTTT
TTTTTTTTATTGTTGGTCGTTCAAAACATTACACAGTTCTTAATACATCATCTTTCACAG
TTTGATTCAAGTGGGTTATGAACTCCCAACTTTACCCCGTATACAGATTGCTGTATCACA
TGTTACCCTTCCATTGATTGACATATTGCTTTTCTAGTGTCTGATGTATTCTGCTGTCAG
TCCTATTCTCTACTATCCCCCCTCCCCTCCCCTACATTGCTGAACTTTTAAGAAAACATT
TTTCAAAATACCTTTCCTATCCCACCTATTTAACTTTAGGCCATATTTTCTTCTTTAACC
AAAACAAAGCAAATGTAGAGGCAGATTTGAGAATACAGCTATTTTTCTTTAAGTCATTTC
TCACCCTCAGTTTTTATGTGGAAAATGTGATTATTTTGAGAAAGAATATTATTTGTGTTA
ACATGTGGTGAATGTATTTTATTTCTTTTTAAAAATTATTTATTCATTCATTTATTTTTA
TGTGGTGCTAAGGCTTGAACTGAGTGCCTCACATACGTTGGGCAAGCACTCTGCCTCTGA
ACTACAGTGCCATCCCATGATGATTTTATTTCTAAGTAAATTAATAAGTAAAACACAAAC
AAAAGGTCTTTGAGGTTCTTGTTAATTTTTGAAAGAGATACCGAGTCCAGAGATCAAAAA
GTGTTAATATTGCTGGTTTATAAATTGAATATTGAGCTCTTTTAAAGCTATGTCTAAATA
TATAATCACAGTAAGCAAATAGGAAGATTTGTTTTGCTCTTATTTATTCATTCATCTGAG
GTGTAGAGGCTGAAAGTTAGTAACTCATTAAGTAAAACAAATATCTTTACTGTAGTGTTG
AAATATGTCTTAAAAGTGTTTCAGTGTCTGAGCAACTTCTCTATATTCAGTAAGAATCCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNCTTTGAATCCTCAGCTTCAACCACAGTGCTTAGCATATGCAATT
GGCATTCAGTAAATATTTAGCTGAGTTGATTAAAAACAAATGGGGCTCCAGAAAATAACT
GAACAAAGTAGTTTGATATTTTTGTTTTTAAATGGGGTATATTCTAATATGCTCAGTTAT
ATAGGAGTTAAAAATAAAACTCTTAGCCTAAACTGGAGCTGGGGTTGTGGCTCAGTGGTA
GAGCGCTCACCTAGCATGTGTGAGGCGCCAAGTTTGATCCTCATCACCACATAAAAATAA
AAATATTGTGTCCAACTATAAAAAATAAAACTCTTAGGCTAAACCAAGTTTGTTATTTTA
ATTCTCTGCACTAAATTTCTTTAGGATTTCCTTAGAATTTCCAGAGTGTGTGCTAGATTT
AACAGCCAGCCAGCACTGTCCAATACAACTTTCTATAATGATGGGAAATATATATATATG
TATATGTATATATGTATGTATACATACACACACATATATGTTTTATATATTTATTTATTT
ATTTTAGTTGTAGGTGGACACAATATATTTTATTTTATTTTATTATGTGATCCTGGGGAT
TTAACCCAATGCCTCACACATGCTAGGCAAGTGCTCTACCCCTGAGCCACATCCCCATCA
TAAGATTCTATATTTATGTTCTATATGGTGTCACTAGCTGCAGGTGACTATCATGGACTT
AAAATATAATTAAAGGAACTGAAGAATAGAATTTTTATTTATTTTGGTTAATTTAAATTT
AAATCACTGCATGTGGCCAGTGACTACCATATCGGATTGTGCAGGTTTAGATGTTCTTGT
TAGTAAAACTAACATTAATTTTATACTTTATGACTCAAAAAGACATTGTAATTTAGTTCT
AGTCCCTTCTGTCCTTTTTGTTTTTTTGGCCATTTCACAAATTCTTATCAGAAGCTGCAT
AAAGCTACAAAGGAAATCATGGAGAATTACATTATGATTTAGTATATGTAATGAGAGTCC
ATGTAATTTAAGGGTCCCATAGTTAATGCAGAAAAAGTGATGATATACACACAAAAAAAT
TTAGCCCAATTCTTAAGGTTTTTGTTGAACCACTATGGGCCTACTTTTTTTAATGTGTGG
ATTATTAGAAATAGAGAAGGTATTGAAAATAGGTCTGTTGGTAAATTCATATTTGAATGG
AAATGTGTTTAGGATTTGTAAGTGACTAGATGGTAATGACAGTTTAGAAATTCTCTTCAA
AGTGAATGATAAAATTATCTCGATTCAAACTTGTCAGAGACTTACCCAATCCAACATAAG
TATCATGTGAACATGCTGTTTTTATGAACAACAAGAAAGAGTTCTTCAGTTGAAAGAAGT
TTGCCTGTTTCTAGTTCAGGTTTCTCAGCCTTGGCACTGTTGACATTTTGGACTGTTTGT
TACAGGGCTGTCCTTTCATTGTAGGATGTTAGCAGCATAATTGTCTTCTGCCCACTAGAT
GCCAGTAGCACCTTTCAGTTGTGACCAAAAATGTCACCAGACATTGCCAAATCTCTCTAG
GGGAGTGGGGGCAAAATCACCTCCAGGTGAGAAATACTTCTCCAAATGTATTCTAGTTAT
ATATAGATACTTGATTTACTCTGGGTATATAGAATTTTGGACCATAAATTGAATAATAAT
CTACTTTCTACTTCATTTGCTCTTCGGGAAAGCTGTGTGTCCCTGACATTTCTTGGTAGG
AAAAATTAGTCTTTAGGAGCTAGATAAAAATGTGAAAAATAGGAGAATTCTTCAGAATTT
CTAGCCTAGCATACTGTGAGGAAGCAGTAAGTAGGTTCATCGTATTTTATAAGACAGGAA
AGCAGACTCGGACTCTGATTTGATAAGAACTTAAAAGGGGTAGAGATGTGAAACTTTTTT
TTATCTCCTGTGATGTGTATAGTAGAATGAAGGTACCAAGGCTGTGATTTAACAGTTTAT
AGTTTAACAGTTGATATTCTGTTAACAAACAGGATGTTTTGCTAAATAAAATTATGTAAG
AACATGGTTTGGTGATGGGTGGTCAGAGTTGCTTTTATGAGTCATTTATTACTTGCTTTG
AGTGCAGCAATGTAGCTAAGAGGTTAGGAGTTTGGATTAGAGCTGGAATTAGAGTGAGAC
AGACAAGGTACCTAGGTTGTAAAATTTTTAAAGAGATGGGGTTCAGATCTGACTATGATA
CTAGAGTCAGGCTGACTGGATTATATACTAGTTCTGTCTACTATTTGTGCTCTTGGACAA
ATTACCTAACTTCTTGTTTTTCAGTTTTTTTCTTCTGTAAAAAGGATATGATAATGTCTA
TTTTATAGGATTTTATAAAAAACCATTCTGTACATGTCAGACTTATTACACAGAATTCAG
TAAATCTTAGTTACTAAAATGTCTAGTCAACATTTATACAAATGTATATCTCAAATCATT
TTAGGAACAGAAAATGAATTTTCTGCATGTCAATTTTTAGAGACCTAGGCAAGGATTGCT
GAAGTGTAGGGCTCCCAGAAATAATAGCTATTTGTTGAGGGAAATGGAGTACTGTAAAAA
TGCAAGATGGAGGCAGTTTTTCCTATATTGTTAGTAAAAAGAAATAGATAAATAACTCTG
TATTCCTGGATGTCTTCAATAGTATGATTACTAATGTCAAAACAGTGTTAACGCTGGGCG
CAGTGGTGCACACCTGTAGTACAAGTGGCTCGGGAGGCTGAGGCAGGAGGATAACAAGTC
AGAGCCAGCCTCAGCAACAGCAAGGCACTAAGCAATTCAGTGAGACCCTGTCTCTAAATA
AAATACAAAATAGGGCTGGGAATGTGCCTCAGTGGTAGAGTGCCTCTGGGTTCAATCCTC
TGTACAAAAAAAACACGTCCTATTTGTTAACAGTTGATAACCTGTTAACAAATAGGATGT
TTTGCTAAATAAAATTATATAAAAATGAAATTGAAGAGAAACTAAACATTCAATCCATTC
AAACTTCACATTATTTGATGTTTAGGCTTAATACTTGTATTTACATGGCATTGTTTTTAT
TTTTTTCATATCAAAACAGTATTTTGGTACTTGGTAAGTACTGATTCTCAATGAACTATC
CCAACTAGTCACTATAAAGCTTTTGGAAATTTGTGGGACNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTATAATACAGATAGGAAA
GCAGGGGAACATTAAGAAGCCAGAATTTCCAGGCCTTGAGAGTTAAGGAGGAGTGAATCA
ATGCACTTTTCCAGGTTTTCTGGTGTGAGTAGATGGAGGATAATACAGTTGGGTGAGATG
AGGAGAAAGATATAGGTCTGGGATGTGAAAATGATCTCGCTTTGAGCCATCTGCAAAAGG
TCAGATGGAAAATTCCAGAATGTTTGAAACTGTGGATCTGAATATCAGGAGTTAATGCTT
GCTCAGAGATCTAAAACTGAGAGTTGTCAGTATTCAAGTGGCTGTTGAAATTGAGGAAGA
ATAAATGCATTTGGCTCTTACACTGAGAGAGAAGAGGAGGGCAGAGACAGCCCATAAAGA
TGACTAGGGAGAAGAGATAAATCAGACAGAGCAAAACCAAACAGGAATTCAACTTCTACT
GTCAGGGTAAAGGGATATGTGCTCCTCTTGATTAGTTTTATTCTGTGCCCCTTGAATCAA
GCTAAAATAGGTTCTAGCTACAGGAATAAAAGTTTAACAAAACCTTTCCTCTATTCTAAG
CATGCTCAGCAAACAAGAGAAGAATCATTTTTTATTTCAACCACACTGGCAATCGGAAGC
AGTAGAGAGAAGATATAAAAGCAGAATATCACATTTGTTTCTTAAATTCTACCTGAGGAG
CACAGTTAAGTAATATGAAGGAAGGCCATCTGGAGATTTTATTAAAATAACCCAATAATT
AATACATTTACCCAACATTTCTAGTAATTGTTATTAGTTGTTATAAAATATCATCTGTGA
GGTGAAACATATATGTAAACCTTATAACAGACAGCGATCAGGAGACAGTTAAGGTTCTGT
TGTACGGGTAGTCATATTCTGTGTGATCTTCCTGTTACTCCCTTTCCTTGTTTCAGAGCT
TTCTCTCAAAGCACACATCTTATTCAACATCACTCTTGATCACACTGTGGGTGTTAGTCA
CCCTTTTGTCACTATGACCAAAATACCTGACAAGAACAACTAAGAAGAGGAAAACTTATT
TGGGGCTGATAGTTTCCAAGGTCTCATCCTTGATCATCGGGCTCCAGGGCAGAAACCTCA
GGGTGGAAGGGTGTGGCAGAGGAAAATTTCTCAGCTCCTGGCACCTCTAGCAAAGAGAAA
GAGGAAAGGACCAAGGACAAAAAGAACCCCAAGGCCATACCCCTAGTGCCCTACTTCCTC
CATTCACTTGCTTCTTGCCAACAATTACTACCAAATAGTCCATTTAAATTATTAATCCAA
CAGATAGACTAATCCACTGATGAGGTCAGAGACCTAAGCATAATCTTTTCACCTCTGCAC
AATGCTACATTGACTAACATGAGATTTGGGGGATATATGCCAAAAAACAAATATACCTAT
CACCTCCATTTATCTAATTTTAAATGTTCACTTTGACTGAATTGGGGGGGGATGGATAAC
AGAGCCAAAATGGGAATTATTTAATACCAAATGTCATTAATAACTTTAAAGCACGCTTAT
AAAAATCTAGAAATCATACCCACATTATGCTTCCATATGCATAACATATATATTATTTAT
GAGGGAAATCCCTGGTTTTTTCTTGAATTTTTCCATATTTATGTTAGTATCCTAGTTCTA
TTCTTTGGTAGATTGAAGGAAGGACCACTATTCATGATTATCCTTTCACCTTTACCCTAA
AACAGGTAATGGCTAATTCATCTTTGCCTTTTTCACAAACTTGACTATAAATGGATGATT
AGCGAATGTTTAAAGAGGATGAATAAAAAGCTAAATAGTTGAGTGAACAGGCTCATAACT
TTGTTACTGCTGAAGAATAAAAGCATACAACTATTAATAATAATAGAAAAACTCATAGCT
ATACTGTGGATAACTATTATATGCCAGGTATTTTGTTAAGAGCCTTAAAATAAAGATTTA
AAAAATTGTCCTAATTTGAAAAATGAAAAAAAAAATAAGCTCATAAAATATCACTAGCAT
AGAAGATACTAAGACAAGATTCAAATAATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTCTACAAAGTCATAGACAAAGAGCACGCACATAGGAAGGGGGAAAGAACTGGCCA
TTAATTCAATCTATCACATATTTAGTCTTCATAAGCATCAAATAAGTATCATTAGTATTC
CCATTTTTCTTATAAATAATTCATCCAAGAGCACAGCACCCTCTCCCACCTCTTCCCTAG
TCCCCAGAACATTTTCTGTGTCTGTCTCAGACACTTGTGATCTGTTTTCAATACTCTTTT
TCTATAAGATTCTCTAAGCTTGCCTTTCACTCATTGCCCTGACTGAATCCAGTTGTCCCC
TAAGAATCCTGCTTGCCCTGCAGCCCCCTCAAAGGGATGCCCTTTTTTTATTATATGATA
TCTTTCTGGATTTAAAGAGAAGAGATAAGATCGGTATCCTCCCCATTTCCTGTTATAGCT
ACATAAATTTTTCTCCTTCCTTCAAATTGTAGATCCAGGTTTACATTACCAGACACTTCA
GCACCAAATATTGTCGTCCCATTGACCTCCAAGTCTTCCCTCATTTGATGAAGATTTTAG
CAGCTGGCTCTCTGTTTTCCCTTCATCCCCACCCTGTCAGCCTTTCTGATGTGTAATCAA
ACTAATAATGAGTGTGGGAAGGTGGTGATGTGGATCAAGGTGTTTGATTGACTCCTGGAT
TGTGGTGGGCTTGAGTGGGAACCCCCTGTGCAAGGTAGCCCAGTTGCTAGGGTGATGCCA
ACCTGAGAAAACTGTGCAAAGGCTGAGTTAAGACACTAGGTCTCATGGATAGAGGATTCT
GAGGATAGCAAGATAACCATAATGCCTCGTCAGCACGGTGACCTTCAAGCCTGCCTGCTT
TGCAGAAATTTTCCCACAAATAACCTTCTGATTATAAAACCTATCTAATAAACAAGTGGA
TCTAGCTCTGAGTCACTGTTCTCAACCAGAGATCAGTTTCCCACTTGATCCCACTCTTCT
CTCTTAAGGTTTGTGTGTCTTTCTTAATTGCTCATCACCCCTCAATGGTATCTGAACTCA
CAGTGGTGCCGGTTGCCCCAAATGAGGACACTGAGTTCCTTGGCCTCCTCAACTCTGATG
ATTTTTTCTTTCTCTCACTTCAGCTGCCCATTCCTGTGGTCATACCTTGACCAATAATTA
TAGTACTTGTTCCAAGAACCCCACTTTCTGACCACCATCCCTTTCAAGTGGTCTCCTCTA
ACACCTCAATTTTTTTATTATTTCATAACAATTTCCGATTCAATTAGTCTCTTCTTCATT
ATCACCCATGGGAAGTTAAAAGAAATTCCCATTTATCCCCTGAGGTTCAACAGTCTATTA
TCATGGTACCTCCTTTAGGTCGGGGAACAGTGACCCAGGAGCTGCTCACATCACATCTCA
CAACACATTGGATCAAACTAAATCACAGATGCAGAGAGGTCCAAAAAGTCTTTTTACTAG
TTAAGATCAGTGCTGTGGTCTGAACATATCCCCTGAAATTCACACTTTGGAAACTTAATC
CCCAGTGCAACAGTGTTAGTAAACGGCAAGTTCTGGGAGGTTTTTATGTCATGAGGGTTC
TGGTCTCAAGAACAGATGACCGTAATAAAGGGGCTTACGGGAAGCAATTCACCTTTTCTG
TCCCTTCTACTATGTGAGGGCACAGCCTTGCTCCCTGCTGGAGAATGTGATAAAAAGGTG
CCAACCTGAAAGTAAAGACCAGGCTCTTACCAGGTACTGAACTTTCTGGTGCGTTGATCT
TGGACTATCAGCCTCCACAACTAGAAGAAATAAGATTCTATTCTTGATAAATCACCCAGA
CTCAAGTATTTTGTTATAGCAGCACAAATGGACTAAAAAAACCAGCTAAAATCTGGGGCA
GTCTATTATTAAAGAAAAAGGAAATATGAATGTTTTGGAGGATGTTTAACCACATTAGTT
AAGCTCAAAATACCACATATTCTATATCTCCCCACAAATATCTGAGACCAAGAAAAGCAG
GTGACCATGATATGCATCCTAATATAAAATGAATAATTTCTGTATGTCTTATTTGTACTC
TCTTTTCTCAAAACTCCCAACAGCCTCCTTACCATTCCTTCCTACTAAACTCTCACATAT
TAATTGTCCTTTGTGCTTTTCATTTAAAAAAAAAATGAAAACAATCATAGGAACTTTCTT
CTCCTGACACCGCAAAATTTGCTAACCTAGCTACTTATTCCCAGCATGAAGTCTAACTTT
CTTTGCATTCTTCTCTCCTTTTACAGTACACAGAAGCCCCCTATTCCTAGCAAAGGCAAA
CATCTTGTCCTAGGCTTGGGACTTTGAGTCTTTCTCAAAGAAAAATACAAAAATAAGCAA
TGTATCCTGTACCACGTGTTTTGCTTTTCTGTTGGATTATTCTCATCAGCTTGGAAATGG
TCTCTAATAAATCCTACCTTCACAAAAGCACTTGAGAAGAGGGCAGAGTAGGAAGCACCT
GGAATCTGTCTCCCAGCGTTGACAACAACTGCACTGGCAGAATCTGTATTATGTAACTAC
TTTGGAACTCTGGGGCCTATTGAAGGCTTGAGATTTCAGGGAAAGGCTTAGATGGTAAAT
TGCAGTTGATTTTGGTCATTTTCAGCTCCTAGTGCAGTAAGTTTTCCACCCCCACCCCCT
CCCTGGGCCCTTTGGCAGGCAGCCATGCACTTCCAGGAGCAGCTCATAGGAGCTCATAGG
AGTAAGGGTATGGGAAAAAGGACACTGTCCTCCAAATATCAGGGATATGTGCTCCCATCA
CTGACTGCTGTCTCTGCAAGGGTTCAAACAGGCAATGGCCATATTGTTGCAACGTCACCC
TCCTGTGAGCTCTTCCCCCTCAGCTGAAGTAACTTCCAGAGGATTAAAAGAACCTGTGCC
TTCCTTGGCTGCCTTCATTTCTCTTTTTCCCCTTTTGGGAGCTAGACGTTAAAGACTAAG
GCATTCAAAATCAATCGCATATATAGAGGAAATTAGAAAGTCATTATGCATGCCCAGGGA
AAGGCACAGGCTCAGAAAAGACCTGAAAGGACTTTTTTTTTTTTTTAATACCTTGCTCAG
ACAGCAAACTCCAGGAAGAAAGAGACTCTGATTTCTAGAGTAAATATATTCATAGATTCA
AATGTCCAGTTTCAACAAAAGAAATCCACAGGCATACAAAGAAACAGGAGAGTANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATTAAAAAAAAAAAT
TGAAAATAAGACTATCTTATTTTTTTTTATTACTTTGTTTTCTTCCCCTATTTTGAATGG
GTTTGAGTTTATACATGTTTGTATAAAATGTATATAGTAATGATAATCCCCATATTTGAA
AGCCTAATTTCATGTTCAGGTAAAGTTTATTATTTTCTTTTGAGAAACTTAGACAGTGGT
GTATTTCCTAGAAGTTTATTTACTAACAGGTTAATTATTTTATGTGGTAAAATATTTATC
TGTATTTTGTATGGAACCTGTTCCTTTAAAAACATGCTTTGAGTTTAGCTTTTATCCATG
TATCTTTTTTTTTTTTTTTAAATTAGCAGTCTTATCCATGTATCTTAAACATAGGAGGGA
TTGTATAACTTGGGAAATCTGAAAATTCAGTCTCATAGTGATTTATGTTTATAACAGCTT
ACTTTATATTACTTGGTTTAAAACAAAGAAACAATTATTTATAGACTAAGTTCGTAGTGC
TTTGCAATATGCAAGTCATAGTACTGTTTTTGAAATGCCTTTTGGGGCTTTTGTGAAATA
GTTCTTAGCTCCATTTCACAGTTGAGGAAAATCTGGGCCCTGGGAAGTCTAAGAAGCATG
ATCCATTACATACAGAAAATATTTTTTTTTCTTAATGATATCATCTGTTTAGTTGTAAAA
TTTCCTAAGTATTCTAATTCAATTTCTTGTTATTGGAGAGGAGAATAAAAGTAAATTAAG
TAACCATTTAGCTACCTCTTTGTTTCATCTGAGAGACTGTATATAAGACGTGACATTGAT
AATAATATATAGTAGATAGGTCTGTTTGGGTTATTTTACGTAATTTTTATCCTTTTCGTT
TTATTTGATGACTGTTCCTCCTATTGCTTATAGGCTGGGCACTAGGATTTTATGTCATCA
TAAAATTAATTTGATTTTCTTCACTCAGAGAATATTAGGATAATGGGATTTATTATCTGT
CTATTCTCTGAAATTTGCGGGATCTAACACTTAGGGTAACGTTGCCATTATTTCTGACTT
GTACTTTTTAAACAGTTGATGAAAGTGCCATGATTATGGTAACTGTCAAGATGGGAGAAG
AGCAACTGTGTAGATTTAAAAAACAAACAAAACCCTAATATTAGCTTTTTGACCTTATTT
TTAATGAGTTAGTAAGTCACTGTAACACTGGCATATTACATTATGTCAGTTAAACAGTTA
GTGTAGAGTTAATAAAGCAAGATTAAATTAAGTTTTAAAATTCCCAGCTTGTTTAGGAAT
GCACAGAAATGTATATGTTTAGGTGTTAGGTATTTTTTGTATTTCTAAATTCTTTTGCAT
TTTTATGTGTTTCATTTAAGTAATTTTTATTAATCTTTTCCAATATAGAGTGGGTATATC
ACAGCTTCTGTTTTTCATAGAAATTTAAAACCTTCTGAGATAAATGGTTGAAAGAATTTG
AATACAAAAATGTCGAAAAAATTCATAGACATTTAATATTATAGACATTTCTTGTGATTA
TGAAATAGCCTGATGGTTCCTTGTTTGCATGTGTTCTTGATTTTTTTGTAGCCACAGCAC
CACAAGTTATTGTTCCTGATTCAAAGCTTATACAGCATATGAATGCATCAAACATGGTAA
GATTCAGAACATTTACATTTGCTTTTCTTATTTTAATCCAAATTGTGATTATTCCTAGGC
ATATTGTAAGTTAACAACTTATAGATAGAGCAAAACAGTTTTGTTTTTTAAAAGATTGCT
GCGTTTGTGTTTACACATGTTTGTATAAAATGTATATAGTATGATAAATTTGAAGTTTAG
ATTGGTACTAAGAATCATAAAATTAGGCCTGGGGATGTAGCTCAGAGGTGAGGTGTTTGC
CTAGCACGCTCAGCATCCTGGACTCAAATCTCCAGTAATACCCCCAGACACATACAAACA
CAAACACTCTCCATACATAAAGAGATGCACAAAATTAAGAATTTTCTGTTTTAAAACATC
AAAAGAATGATGCTTTGTGGGCATTATTTCATCACCTATTTTTGAACAACAGTTCTAGGA
ATTGACCAAATCTATTATACCACATATAGTTCTGTTTCAGAAGATCTGTTAATCACAAGA
GGTCAGGAATGCTAAGAATTGTAAATTTTTAAAAAATTAAAACAATCTGTTTGGATAATT
CAAGGTACCGTTTTTAAAATAACAAATTTAAAAATATTTGCTCCTGTTTAACCATAATAT
GGTTTATGTTATTATGATCTGTAAATTGTTATCTTAAAATGCATTTGAAACAGTTGTTAT
ATTAGAATTTTGATAGTTCTATCAAATGTGGTATAATATACAACTGTAAAATTGAAAGGA
TTCCTTCAGATCCTTAGGAAATCTTTATCTATATTCTTTACTCTTTTTTTTTTAACATTA
AAACACAGTCTGATTATTTGTTCAGTACTTTCTTGTAAATTGCCTTTGTTTATTTTGTTT
AAAATAATCAGACTGTTAATATCCCAGAAGTGTCTCAGCTTTGACATTTCATTATTAAAT
TCAGCCAAAACTTCAAAAGTAAAAATCCTTGTTTGTAATCTTCTCTCAGTGTATGTAAGT
AATGCTAGAAATGAGATCTCTATATTTTTTTGAAAAAAAAATAATGTTTATATGAGTTTT
TTGTTTTGTTTTGGGTTTGTTATTTTGGTACCCAGGATTGAACCAAGGAGTTACATCCCC
AGTCCTTTTTATTTTTGATTTTGAGCAGGATCTTGCTAAGTGGCTGAGGCTGGCCTCAAA
GTTTTGATTCTCCTTCCTCAGCCTCCTGAGTTGCTGGGATTACAGGTGTGTGCTACCATG
CCCTCAAAAAGCAGTTTTAAAAAAATCACTTCCACTTTGTGAGTGGTAAGTTATGAACCA
CAAAGCTCTTTTGTGGTTTATAAGTCAAATAGACAGCACGACTTACCAGACAAATAAGGT
GCTACTCCTGCACCTTACCAGCTTCACAGATTTATACACTGGAGTGACTGCCGATTTCTG
AGATAGTAAAAATTGTATTTTTGAATTCACAAATATCAAGGATCTGTTTTATGGGCTGGG
AGTGGTGGCACATGCTTTAATCTTAGCAATTTGGGGGGCTCAGGGAGGAGGATTGCAAGG
TCGAGGCCAGCCCCTGCAACTTAGCCAGATCCTAAGTGAGAGAGACCCTGTTGCAAAATA
AAAAGTTAAAAGGGCCGAATATATAGCTGAGTGGTAAAATTCCCTTGGGTTCAATTCCCA
ATACTCAAACAACAACAACAAAATTAAGATTAAAAAAAAAAAAGGATCTGTTTATATTTC
AGTTCAAGTTAATAGAATCATTTTTTTTTGCATGTAAATCTTAAAATTCCTTGCCTCAGA
AGTATTATCTCATTTTAACAGTTTTATTATTTCCTAGGGAATTACTTATGTAAATTTTAA
CAAATTTTGGCAGAATCACCTGGAGTAGATGCTTCTAATTTTGAAGAGTTTTAAATGTTG
TGGGAGAGAATTTCAAATTTAATAGTGTTTTAAGAGATGAATCAAATTAGTAGTTGATTT
CTTACGTGTACTGCTTAGGTCTCTGATGTTGGAGAATATGTATTAAACAGATTATAGTTT
AGAAATTAAATCAGTAAAATAGGTTAGCATTTACATTTTTCTTTGATATTTTTAGTTAGT
GTATTATGCATGTTCTGAAAGATACTCCATAAAGGCTCTTCACCAGTAAAAGTGTTCTGG
GATTTTGTTTTGCATTATTATTCCCAATTCATATATATTCAGTAAGTAAAAATACTTCTG
ATTTTTCTCATGGCTTTGTGTACTTTAGAAATGAACATACTAAAATTATGTAATTTCATA
AAAATAATAGGTAATATTACATAATAACTTAACAGGTAGAAGGCTATTTCAGGGAAGTTA
GAGCAAACCAGTTTTCCAGGTTTTTGATACAAAATGATTGGTCTAATGCTGCATTTGTGT
TAGGGCTGTTTCATAAAATACAAGAAAAAAATTTCAGGTCATTAAATAAAAGGTGATTAT
GTATGGTGTATCACTCAGCAAATACCTATTGATTAACTTGAATGTATAGAAAGTGTATCA
GGTGGTTATTGTGTTATATATGCTGTAAAGAATGGTTTATTGCTGTAGCAAGATCTGTTA
TCTTAGAAGATATGAATTAAGGCACTATAATATTCCTAAATATCAGTAGCAGTGGGTTGC
TTACTATGTTTTCTTAAATTAACTTACCTTTTATTTGGCCTATAATTTATTTAAGTTGAG
TGGGTTAAGTATCCTAACTTTAAAGAGAGAACTGGTGAGCTCTAGCTGTCCATCCTGGAA
GAAAATTCATGGATTTTTACACTGTAAGAGTAAAAAGTTATATTATGGCCCAAATTTTCG
TTTCTTTAGAAAGTAGACCTGTAAAACCGCAAACCAGATAGAGGGAATAGTAACTGAGCG
TAAAGATTGTTTCTAAGATTGGCAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTTTATTATATTTATATCCCTAAGCTTATCCAAATATAGGTGTTGTAAAAATGT
GTAGGTTAAATTAAGTATATGAAAGTTTCATACCTTAAGATTGAAAGGGGATGGAAAAAT
AAAATACCCTAAATTACAGTGAGATACATGAATAAAATGTGTAAAACATATAGAGAATGG
TGTAATTCTTTTGCAGGAAAGCTAAAGGAGAAACAATTTCTGGAAGCAATAAATTATTTT
TTTAATTTTAAAAATGTCAGAATAGGGCTGGGGCTGGGGCTCAGCGGTAGCATACTTGCC
TGGCATGTGTGAGGCACTGGGTTCAAGTCTCAGCACCACATATAAATAAATAAAGGTCTA
TAAACAAGTTTAAAAAAATTAAATTTTTTTTTAAAAAGTCAGGATATAATCCCATCCATA
TTTTTATAACTTGAATGTTACATAGTAACTATTTTAAATAATGGAAATTAAAGTTGATGA
CTTAAGATTTTGAGGATTTTTTTGGTATTAATCTGTACTTCAAGGGAAGTAATGCTATAC
TTCAAGAGAAGTCTTCAGATACAGTGTCTTCTGTGGGTACTTGTTGATTATAGTACACAT
TTTAAAAATTCAGAAACAAAGACACTTATACTTTCCCCCAACTGTATTAATTAAAAACAA
GCAATTGGGTGTAAGGAAGCAAAGACTAGGAAAGGAAATGATCATGGAATGGTTATTTCA
TATATTGTATTTATGTATTTATTGCATTGTTAATGTGGGTTTCCCAAAACGTATAGAATG
AATATATAAAGGATCTGTACCTTAAATCTTAAAAGATTGACAAGGTAGGAAAAAAAAATA
CCGGAGAGACAAACAATTACACTGTTCTATTTAATTGCTTGAAATAATTAAGTAGGTTAT
GTAAGCTAAGGTCTTTTTTATTTGCATCATTTTATCAAATGGGGTTTGGTCTTGTTAAAA
TTTCTATTTAGTGTGTACTAAACAAAATTACATATACTACTAAAACATGCTAGTGATAAG
CTGAAATGCTTTTATGTATAATGTAGTTTTGATATTTTCCTTTTGTTTTTATTTTTTTCA
GAGTGCTGCTGCTACAGCTGCTACCTTGGCACTCCCTGCAGGTGTGACTCCTGTTCAACA
GATATTAACAAATTCAGGTAATGAGGAACAACAGAACCATTGTTAAATATAATTCAGAAA
ATTGCACCATCTAACCCTTGTATTTTGATTTCATTGAAAGACAGTACTAATACTTCTTTT
ATCATTTGGTTTAGGTTGTTAAAATAATTTTGAGGGCTGTAACATACAACTGTAATCATT
GTTGAGGATGCAATAGAGAAGATGAAAATTGCTCTTGAGCTTTTGATCGTGAATGAGAAC
CAACCCTATTATTGAAGAAGTATGGTTATATAGAAATGCTCGTTTACTGTATTACTAAGC
GTATTTATCTTGTCAAAGGAGATAAACTTGACTCATTTGAACTAATTTGTGTTTTCAAAG
TAAATCCTATGGTGCCTTAAGAGCAAATTCATTGCATGCTATTAGGCATAGTCTCTCCTA
TTGATTGACTAAAGACCAATGTTTAGCATACGATTTTTGGTGATATTAGTGTTTGAAAAC
TTACCACATTTATTTTTTAGTTGTTGATGGACCTATATTTTATTTTTTTATATGTGGTGC
TGAGAATCGAAGCTAGTGCCTCACACATGCTAGGCACGTGTTCTACCACTGAGCTACAAC
CCAGCCCCTATCCACAAGATTTTAAGTATTATGTCCCTAATCTTCATTTTATTGCCTTTT
GGGAGGAGTGGTGGAGACTGGGGAAGTTGATTTACCATTGTGCCAAATCCCCAGTCCTTT
TTAATTTTTGAGACAGGGTCTTGCTAAGTTCCTGAGGGCCTCACTGAACTACTGAGGCTG
TCCTCAAACTTAAGATCCTCCTGCTCAACCACCAGGAATTCAGGTGTGCACCACTATGCC
TGTCTGACCCAACCTTATTTTATTTGTATTTGTTGTTTTTGTTACTTTGTTAATTTTCTA
AATTTGTGAAGAACAAATTAGGGACTTGTCTTATTACATATTTTATTAACATATGTTTGT
TATTTCATTCAAGATCCTGGGTCATCTAAAGCAACCTATTAGGAGTGTTTGGTTCTGTAT
ATATATATGCCAGTCACATAATTAGTTTTATGTGACAGTGATGACTGGTTCAGCAAACTT
TTGTTTTTGTTTCTTCAAAGCTTTAAAAATGAATAGCCCATAAAATGTCTTATTTTCTTA
TTGCTTTCTTGACTGTTAGCATATGAACAAAGATAATTTAAGCTTAGTTCAAGTCTTATA
TTCTGTTTTTAAAATCTTACTGAAAAACAGCTGAATGAGGATAATAAATTTGGAAAATGT
ATCATTTTAAGCAATGTGTCTGAACATGGAGGGAAGTTAGGGAAGGTATTAATTATAGTT
TACTGTGTATAGATATTAGACCTTAAAAAAACTGTTAGACTTCTGACTTGATAATTCCTG
GGTTTTTCAGTGGTTTGACATTTCTTTCTTTCTTTTATTTTTTTATTTGAGACGGTCACT
GCTAAAGTGGTAACTTAGAATACATGCTTTTTTTTGCTTTAGGCCAGCTTCTTCAGGTGG
TCAGAGCAGCCAATGGTGCCCAATATATCTTTCAGCCTCAGCAGTCAGTGGTTCTACAAC
AGCAGGTTATTCCACAAATGCAGCCTGGTGGAGTACAAGCTCCTGTTATACAACAGGTAA
AAGAATTTTAGTTAAGATTCCTTTTTCAACTTCTGTATGGATTCCTTGAGTGGGTCCCTT
CTCTTTGCCCATGGTTTTATATATACAAATACTTAGAATCAAGCAAATAAATGAATAACT
TGGATAGCTCTCCTTGGTCAGTGACTGGTATATACACAATTAATGCTCACTAAATGAAGC
AATTACCTTTAGCAGATATTTTTCTTTCAGAAATTTAAATGGCAAAATAGAAATTTAGTG
GCTCAGTACTAGTTAAACATTGCTTTTTTACTTAGGTAGTGTTAACTGTGTATGAGATAT
GGACTATTTCTGGTGATTCTAATATTTGAACCAATTTCTTCCCTGTAACTAGTTCCTAAT
AATGTGGTTTTCTTTTGCTGTAGGTTCTTGCCCCTCTTCCTGGAGGGATTACACCACAGA
CTGGTGTTATCATCCAGCCTCAGCAAATATTATTTACAGGAAATAAGACTCAAGTTATAC
CTACAACAGTGGCAGCGCCCACACCAGCACAAGCACAGATAACTGCAGCTGGCCAGCAGC
AACCACAGGCCCAGCCTGCTCAACAGCAAGCTCCATTGGTATTACAAGTTGATGGAACTG
GGGATACCTCATCTGAAGAAGATGAAGACGAAGAAGAAGACTATGATGATGATGAAGAGG
AGGATAAAGAGAAAGATGGAGCTGAAGATGGACAGGTAGAAGAAGTAAGTCTCTAGTAAA
AGACTTGGAAAGAGAGTTCAGTCCAATGATTTCGTTTTACAAAGGCCAGATGTTTTTTCT
GATATGTGGATGCTGATCCATAATGGGGGGCAGGGACAAAGGAAGAATGGAGGAACTTTG
GATTGGACAGAGGGAAAGGGGTATGGAGGTGGGGAAGGATGGTAGAATGAAACAGACGTT
ATTACTCTATGTACATGTATGATTGCATGAATGGTGTGACTTATGCATTGTGTACAACCA
GAGAAATGAAAAGTTGTGCTCATTTGTGTGTAATGAGTTAAAATGCATTCTGCTGTCATA
ATAATTAGAACAAATAATTTAAAAAATAATAATTTTGTTTTATTTGGTGCCAAACTGACA
AATTAGATCCTATTTTTCCAGAGGTTGTTAGGTGCTGTAAACCTAAAGACTTTAAAAATA
TAGTGAGTCTTCTTTTTTTTCTTTTTTTTAAGGGAGAGAGAGAGAGATAAATGTTTTTTA
ATATTTATTTTTTATTTTTCGGTGGACACAACCTCTTTATTTTATTTTTATGTGGGACTG
AGGATCGAATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTGGCGATTGAACTCAAGGGCACTCAAACACTGAG
CCACCTCCCCAACCCTATTTTTGTATTTTATTTAGAGACAGGGTCTCACTGAGTTGCTTA
GTGCCTCCTTTTGCTAAGGGCTTTAAATATACAATTCTACCTCAGCTTCCTGAGCTGCTG
GGATTACAGGCGTGTGCCACTGTGCCTGGCTCTGCGCATTTTTTATTCCCTATAATTTTG
GGAATTTTTTGTATTGCTGGGGATCAAACCCAGGACCTCTCTTGCATTCTAGGCAAGCAC
TGTACCACTGAACTATACCCCTAGCTCTTCTTTATAATCTTGATGTCCCCTAACTGATAT
GTTCTTAGGTTTTCTTCTATTTGCTGATAGTATGGAAATATATAGAGCTTTTAATATTCA
TCATTGATGTACCCACCTTCCTAATGTTTTTGTTAATTCTAATAATGTCTGTGTAGATTT
TTTTGTATTTCCTTAAGGATGATCACAGTATTTGTCAAAATGGCTGTTTTTCTTGCCTTA
TTGGCTAAGCCTTCCAGAACAATATTGATGAGAATTGGTGACAGTTCTTTTTTTTTTTTA
TTAATATTTATTTTTTAGTTGTAGTTGGACAAAATTTCTTTCTTTATTTATTTATATGTG
GTGCTGAGGATCGAACCCAGGGCCTCGTATGTGATAGGCGAACACTGTACTGGTGAGCCA
CAATGCCAGCCCACTCTTGTCATGTTCTTAAACTTAAAAATAATCTTTCTTATGATTCAC
TAGTAAGTATATTTTGTTTTGTTTTTTGGATACCCTATATCAGATTAAGGATCTTCCTTT
CTAAATTAAGAACTTTGCTTATCTTTTGTTGTATTTTGTTAAATGTTTTCGTAAGCTGTT
AATCATATAACTTCTCTCCCTTAGTCTTTCGTTATTAATGATTTTCATTAATTGGTTTGT
TTGCAAACCATTATTGGATTCCTGGGATAGCAAAACTTGATCATTAAATATTACCCTTTT
TATTTGAATTGTTGAATTGACTTTGTTCAGGACTTTTGCATGTGTATTCATGATAACTGT
GATTCTCCATTCTCATATTCTTCTCACCAGGTCTTCAGGTTAGTGGTTGGTAGTCTCATT
AAATAAATCTTGAAAGTTTTTTCAATATTCAACTTTGAATATTTTTTTTCTTTAAAACGG
TATCTAATTCTTCTGTGAATATTTCTTAAAACATACTGCTAAAAATGTGTGGGCCTATTA
TCTTCTTAGTTGTTTTTTATTTTAATTAAAAAAAATTTTGTAGTGGTAGGTGGACAGAAT
GCCTTTATTTTATTTATTCATTTTTATGTGGTGCTGAGGATTGAACCCAACGCCTCACAT
GTGCTAGGCAAGAGCTCTTCCACTGAGCTACAGCCCCAGCCCAGTCTCCTTAGTTTTGAT
CAAGTATTCTGTTTCTTTTTAGACAATCTTGATAAATTCTATTTTTTTAGGATTTTCTAT
ATATTTATATGAATTTCCAAATTGACAAGAATAAAATTAATCGTATTATCTTTGTAATAC
CAGAATCATTTGTAGTCATTTTTTTCTTACTGCTAATATATTTGTTCCTTCTCTTTTCTT
ATTCAGTCTTGACAGAGTGTGTGGATTTCATTAGTGTTTTCAAAGAATTGGCTTTTAGCT
TTATTTTTTTTCTAAATTTTTTTTCCTACTTCATAAGTTTCTATTCTGATTTAACTTTTG
TAGAGAACATGATGTGTGCGATTTATGAATCCTTAGATATGTTGATTGAGACTTGTTTGT
GGTCAGTTTTTAAGTATGCCATGTATTTGAAAAGTGTATATTTATTGCAGTTATTTGCAA
CTGTGTTCTCTGTATGTCTATTAGATTTAGATTGTCACTAGGTTTGTTCAGATATTCTGT
ATCCTCATTAGTATTTATTGTATGTTTGATCCATTATTGATTTACTGAATGAAATATGTT
CTGCTCTTCTACTATGATAATGGGTTTATTTCTCCCTTGTTGTTCTGTCACTTATTATGT
TTTGAGCCTAAAAATAGGTACATATAAACTCAAATTATATTTTCCCAGTGAATTGAATAA
TTACATAGCATCCTTATCACTAGTGATTTTTATTTATTTTATGCTAAAGTCTGTGTGATA
TTAATAGTCATACCAGCTTCAGATTTGATTAGAATTTACCTTATACAACTTTTTTGTTCT
TTCTCTTCCAAACTTTTTGGTTCTGCACACTTTTTAGGTGTCTTTTATTAGTGGAATATT
GATATTTATGCTATTAGAGTACATGAACAAAGTGCTATTCGGTAAAGGGACAAATAGTCT
TTATAATAAATGATGCTGGGACAACAGTTTGCCCCCTGCCTCATATCCTACACAGAAATT
AACTCAAAATGGACCACAGACCTAAATCTAAGGGCTAAAATTATTTTTTATATTGATTTT
ACTTTTTAAATATATGACAGCGGAATGCATCACTATACTTATTACACATATGAACACAAT
TTTTCATATCTCTGTATATAAAGTATGTTCACACCTATTCATTTCTTCATACATTTACTT
TGGATAATGGTGTCCATCACATTCCACCAGCATTGCTAACCCCCTGCCCCTTCCTTTCCC
CTCCCACCCCTCTAAGGGCTAAAATTATAAAACTGTCAGTAGAAAACATAGGGATAAATC
TTCATAACCTTAGATTTGGTTATAATGGCTTATTAGACATGACACTAAAAGTAAAAGTGA
TTAAAGACAAAATGGACTTTCGGAGATTAAAATCTTGCATAGCAAAGGACAGTATCAAGA
AGGAAAAAAGACAGTTCGCCAAAAGAAAGAAAATATTTGCAAAATCATATAACTGATAAG
CGTCTAATATTCAGTATACAAAGAACTCTTAGTTCAACAACAAAAAACAACCCAATTAAA
AAATGGCAAAGTTGTTTAAACAGACATTTCTCCATTATGATATATATATAGCCCATGAGC
ACATGTAAAAGATGCTCAACATCATTAGTCATTAGATAAATGCAAATCACAGTAGACACC
ATTTTGCACATATAGGATGGTTATAATCTAAAAGGAAAGTAAATAAATGTCAATGAAGAT
GTGCAGAAATTGGGAAGCTTTCTCTGTTGCTGGTAGGAATGTAAGATCATGTAGTTTCCA
TGGAAAACAGTTTGGTTGATTCTTCTAAAAGTTAAGCATAGAATTAACCATATGTCCTAG
CAGTTTTGACTTCTAAGTATTATGCCGGAAGAGTATTAAAGGGCATTCAAACAAAACCTT
TACATGAATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGCATTTGATTCTTGAAACATCGACGTC
ATATTTCTTTTCATTGAATATCAGAGAGGCCTTTTATAGTAATACATGGGATGTATTTAT
AAATTCTCTTTTTATTTATAGGAACCCCTCAATAGTGAAGATGATGTGAGTGATGAGGAA
GGACAGGAACTCTTTGACACAGAAAATGTTGTTGTATGCCAATACGATAAGGTAAAGATT
CATCTTCATATCAGTGACATTTTTACTTGCTTTTCAAACCATCTTGTCTGCCTCATGGGA
ATATTGGGACTGCTGATTAGTACCTCTTTTTTTTTTTTTTTTAATACTTTTATTTTATTT
ATTTTTATGGGGTGCCAGGGTTCGAATCCAGTGCCTCACGCATGCTAGCAAGCACTCTAC
TACTAAGCCACAACCCTGGCCCTATAAACTTAATTCTTAATTGTTCCAGAAACAGGAAAC
ATTTTTTTTTTTTAAAGAGAGAGAGACAATTTTTTTAATATTTATTTTTTAGTTTTCGGC
GGACACAGCATCTTTGTTTGTATGTGGTGCTGAGGATAGAACCCGGGCCACAAGCATGCC
AGGCGAGTGCGCTACCGCTTGAGCCACATCCCCAGCCCCTGATTAGTACCTCTTTTATTC
TTTTTAAAAAAATTTTTTTTAGTTATACATGAACAGAATATCTTTATTTTGTTTGTTTAT
TTTTATGTGGTGCTGAGGATCAAACCCAGTGCCTCACATGTGAGAGGCAAGCTCTCTGCC
ACTGAACCACAACCCCAGCCCCCCTTTTTTGTATTTTATAAGCAAGAATAAGAGAACAAA
TTTTTTAGCTTTGAAAAAATAATGAAATGGAGGAGAGGCATGATCTTTTTCTATTAAGAC
CATTTTTCCTTTAACAACATTGACTAACTTAATGAGATAATCTAGTTTTTCATTAGCATT
GAGTACCTCAAAACTAAAAGGAGTTAATTGAATCTCTATAACTTTTTTTTTTTTTTTTTC
CTTTAAGATGACTCAGGGGCTGGGGTTGTGGCTCAGTGATAGAGCGCTCACCTAGCACGT
ACGAAGTGCTGGATTTGATCCTTAGTACACATAAAAATAAATAAATAAAATAAAGGTATT
GTCCAAATATAACTAAAAAATATTTTTAAAAGAAGACGACTCAGATAATAAACAGGATGG
CATAATTAGATAAGTTTTGCTGAAAATAATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1102, 8711..8915, 47271..47335, 51361..51436, 52902..53035, 53423..53743, 58701..58790
1001..1102, 8711..8915, 47271..47335, 51361..51436, 52902..53035, 53423..53743, 58701..58790
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved