Spermophilus_tridecemlineatus Locus MCM4
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus MCM4
Spermophilus_tridecemlineatus
MCM4
GeneScaffold_1920
SNORA71
15538..15671
18598
AGGGGAGAGAAGCTGGGCTGTCTAGCTCCAACACTACTCGGAAAGCCGTGTCCGGAACT
GTACGCACCCACGACCGAAGGGCTGGTACTCAGGACGCACTCTTGCCCCAGGCCGCGGAT
CAGCTGATAACTGGCCGACGCAGCATTGCAGCGGTCCGCAGTGATAAGGACTCCTGCAGC
CGAAACAGGTAACCCTGCAAAACCGCTCCGGAATCCGCCATGACGAGGGCGCTAACGCTG
CGCAAGCGCGCACTTTGCCGGGGCCCCGGCTGCCGCGCGGCGGCGCAGGAGCAGGACTCC
AGACTAGGGGCGGGGCAACAGAGGCGGGGTCCTTCCACGAGACTCTCTCTCGGGAGGGTG
CTCTGGGTAGAAACTTCTCGTTTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTAAAAAAAAATAAGAAATGCGTTTGAAAGGCTTCTAGAAATTTTTTAAAAACTA
TAGGGATTAAAAAGCTTCTACACTATAGGGGAGACCCCCCTCCGAAACTTGGCTTGTAGA
CGTCCCGGATTTCCGCGGAAATGCGGTTCCGCAGCCAGGTCAATCCATCTGCCTGCGGGT
AGGGCCCAGGCGGGTTCTTAGTCAGCTTTCGGCTGGGGTGCCCAAAAGGCCGTCAGTCCT
CCCCCTATAGTGGCGCAGTGGCGCCCCAGAGGAGGAACCATTAGGAGCGCTCTGTGATTG
GTGAGGCGCCGAGGGCGGCGTCGATCGTGCTGCCGGCGGGAACGCTTGGCCCTGCTCGTG
CTGTCGAGAAGAGCACTCTCCAGGTAGAACTTGACCTCTTAGGTGTGTGCCGCGGCAGCC
CTTCCCTGGTAATCGCGGGACTACCAGGGAGGACTCCGCTCAGATCCCGGTGGAGGCGTC
TCGACGCGAGCTTGTCCTTGTCGTGCAGTTATCCTGGCACCATGTCGTCTCCAGCATCTA
CCCCGAGCCGCCGCAGCAGCCGGCGCGGACGGGCCACCCCCGCGCATACGGGTAAGTTTC
GGTTCCCACCCCCCCCCCCACACACACACACACACACAACTCGGGCACTAGTCCATACGG
ATTCCCATCGGCCCCCACGCCTTCCGCCCTGCGACTTCCCTTTGGCGGGAGAGCCCTGCG
CCGCGGGCCCTGCCGCGTCGATGCGAAGATGCCGACGGTGGGGGGCGCTCAACTCGACTT
TAGCGGGTTGGGTTCTTCGTTTCTATTGGTTAAGCATGTCCGTTCCCACTTGCCATCATT
TGTGTTAAAGTAATGAATCTAATCCTATCAAGAGGCAAATCCTGGAAGACCAAACATGAA
AGTTGAGAGCCGTGTTTGTTGTTTTCCATGAAGAGGCCAGGTCATCTCCCTCTCAGAGAC
GTAGAGGCGAGGATTCCACCTCCACCGGTGAGCTGCAGCCCATGCCCACCTCGCCCGGAG
CAGACCTGCAGAGCCCTGCAGCGCAGGATGCATTGTTTTCCAGTCCTCCTCAGATGCATT
CTTCAAGTGAGTTTCTGAAGATCTAGGTTATACTGGGATTGATAGTACAAAGGGTCAGGT
TGGTTATTTGGTGGCAGTAGTTCTTAATGCCTAAGCATTCCCTCTGTGCATAAGCTAATT
TGTTCTTCATTAAAAGAGCTGGAGAACGAAGAAGAGCTGGTACATGTTAGGGCTTAGTGA
GCAAAGAAAGCAGCTATTCTTTTGCCTTTTTAAGTTAGAACCTTTAGTGGTCCTCAAAAC
TTCAACCACCAAACGTATCAATAGATACTCAGTTCGTGTTGTTTTGAAGGCAGAGCAGAC
ATGCTCATAGTTTCAGGTTTGTTGTACTACTAGAATTCTGTTGTAAACTTCTGCGTTTAT
CTTGGTAGCTATTCCTCTGGACTTTGATGTTAGCTCACCACTGACCTATGGCACTCCTAG
CTCTCGGGTGGAAGGAACCCCAAGGAGTGGGGTTAGGGGTACACCTGTGAGGCAGAGACC
TGACCTGGGCTCTGCACGGAAGGGTCTTCAGGTGGATCTGCAATCTGATGGGGTGAGTAC
ACAACAGTCTCCTGATAGCACTGTCTTGGGAACAAAAATGGATAATTCCATTGGTATGGC
TCTGTAATACTTTTCTTTGTAGGCAGCAGCAGAGGATGTAGTGGCAAGTGAGCAGTCACT
GGGCCAAAAACTTGTCATCTGGGGAACAGATGTAAATGTGGCAACATGCAAGGAAAATTT
TCAGGTGAGTTGTATGTGTTAAAATACAGACTTAAGGGGCTAGGGCTGTGTAGCTCAGTG
GCAGAGCACTTGCCTAGCACATGTTAGGCACTGGGTTCAATCCTTAGCACTGCATTAAAA
AAAAAAGTCATTCTGTCCACATACAACTACAAAAAAATTGTAAAGATAAATAAAATACAT
ACTTAAGGGCTCTAAAAAGATTTTATAATTTAAATGGAACTAACCATAAAGCATAGGGGA
AGATTATAAGTTGATGCATTTCAAAAAATACTTGTTTTATCTTCTCAAAGTGAAATACAC
ATTACTTTTTGTATTCTGAATAGTTGCATATTTCCTATTGCATTAAGCTTAAATATTTTT
CCTCTTCACCCTCACAAAGATTTCTTCAGCGGTTTATGACCCTATGGCTAAAGAAGAAGA
AAATGTTGGCATAGATATTACTGAGCCTGTGTATTATGCACGACCTTGGAGAAGTAATCA
AATTTTCTTTGTTAAAGAGTTGTGCATTGGGCTGAGGATGTGGCTCATGCAGTAGCGTGC
TCGCCTGGCATGCACGGGGTTTGATCCTCAACACTACATAAAAATAAAACATATTGTGTC
CACCTAAAGCTATGTAATTTTTTTTTTTTTTTTTTTAAGGTTGTGCATTCTGGGGCTGGG
GTTGTGGCTCAGCAATAGGGTGATCGCCTAGCACGTGTGAGACCCTGGGTTCGATACTCA
GCACCATATAAAAATAAGTTAATTTTTTAAAAAAACGTATTGTGTCCAACTGCGATTAAA
AAAAAATAAGTATTTTAAAAAATTTTTTTAAAAAAAAGTGTGCATTATACCTCGTATGGT
GATGCACACCTGTAATCCCAGCAACTTGAGAGACTGAGGCAAGAGGATCAAAAGTTCAAG
GGCAGCCTCAGCAACTTACCAAGGCCCTAAGCAACTTAGAAGTTATACATTATATAATAA
TAAAATTAGCAAAGTATAACTTATTTGTTTTATCTTACAGATTAATGTTATTGGAGAGCC
ATTTTTAAATGTAAACTCTGAACACATAAAATCATTTGACAAGAATTTGTACAGACAGCT
CATCTCCTACCCACAGGTAAGAATTTGGCTTTGACCTTGATGAAATACTGTAAATATCTA
GAGGGATGTTTTTAGATAGCAAGATTTCCATAACAAAAAGATCCCTCCAAAACATATATG
TTTTTTTTTTTTAAAAACACATTCTTTCAAAGTCATTGTTTTTACATTTTAATGTTTTTC
CAATTGGCATGTGTGTTACTATCATAGTTCTCATAGTTGAGTGTCAGGGTTGAATTGGTT
ATTTTTCTAACAAAATAATCATGAATCTTAAATAGTTTCTTGGCTTCATGAAACAAATTA
TCTTAAATTGAAATGTTTTGTAAATGTGTTATATACTTTCTGCCATTTTTAATGGACTAT
ATTAGCCATAATGTGTTGCTTCTAGCCTGTAATGAACATCAGCTTTATTGACAGGTGTAA
GCTTTGGAGGTGTGTAAGCTTTGGAGGTACATAGGCTTGGATTTGGAATCACGCCTTTGT
TGCTTACTGGCTGTATAACCTTGGTCAAGTTCCTTGGCCTCCCAAAAGTTGATTCTCCAT
CTATAGTTGGAGAATCGTGTTAAATTGGAGTAAAATAGGGCTGGAGATATAGCTCAGTTG
GGGTGGAATGCTTGCCTCACATGCACAAGGCCATGGGTTCAATCCCCAGCACCACAAAAA
AAAAAAAAAAAAATTGAGTAAAATAAGTACAATTTAACCTATGTGGTATCATTACATTAT
GGAAGACACATAAGACAGACATGAAAATATGAGCGCAAATCTTTCCCTTACAAATCAAAA
GCATAACACATGCCAGCAAGTTGAGAAGGCACTTTCATTTAACCCAAATGAGAATATGCC
AGAAGTAAGATAGTTCAGTATACCTAAGGTTTGAAAGTATCATGTATATAAATCTGTAGG
GTAATGGGGTTATGTCGTGTTTTTCTGCTTTTATACTTTCCTGCCATGAAGTATTTTGTA
TCTTAGATTTAACTCCAAGATAGGAATGGAAACATAGTTTGGAATCTTTATATTGGTTTT
TACAGGAAGTTATCCCTACTTTTGACATGGCTGTCAATGAGATCTTCTTTGATCGTTACC
CTGACTCCATCTTAGAACATCAGATTCAAGTAAGACCATTTAATGCATTGAAGACAAAGA
ACATGAGAAACCTAAATCCAGAAGGTAATGTATTTGATAGCAAGAAAACGAACAAAGTGG
TAGCATACGCCTATAATCTCAGGAGGTTGAGACACCAGGATTGCAAGTTCAAATCCAGCC
TCAGCTAAAGGCAGGTGCTAAGCGATTCAGATCATGTCTCTAAATAAAATACAAACTAGG
GCTGGAAATATGGCTCAGTGGGTGAGTGCCCCTGAATTCAATCCCCAGTACCTCCCACAC
CCAAGGAAGAAAAAAAAAGTGGTTGTAATGAATTATAAATTGACCAAATAATGCAGATTC
ATATACTTAATGTGAACCCCAATTATGTCTTTTTCTAACTTAACTGTAATATTTGTTATA
AAAGATGTGGCTACTAGCAATTCTCTACTTTAATGCAAACCTAATAAAATACAATAAACC
TACAGTTATTAGGTAGATGTTTTTTTAGCTACTGTAGAAAATAAATACAGAACATGGTCC
CCACCCTTAAGCTTAAGAAAGAAATCTACTTTGGCAAGTAAATAAAAGATGGGGCAGAAT
AACAGAAGAGTAGTGTAGGAAATTACGTGGTCAAGGAGGAGGAGCAGAATGCCCAGTTTT
CTGGGGGATATGTTAATGGTAAATGATAAATTGGATTGTTAGGTTTGGAAAGCAAACATG
AAGAAATTTTTTCTAGACAATTGTCAGAAGAAACACAGAAACAAAAAAGCAGACAGAGCT
TTGTGTGGATACTAAATGATATGGGTTGCCAAAGCAGGGGATTTGGGAGGCAATGGTTGC
GTGTGACTGTGAAGCCTAGATACTAGAAACCTTTCTGCATCAACTTGAGAAAGAATTTAG
ATTTTATTACAGCATAAATAGGGAAACATTTGATGCTTTTTGACAAAAAAAAATTGCCAT
TCTTGAAGTATACAATGAGTGGTTCTGTTTTGCAAGGTGTATTGTAGTTCAGTGAGTAGA
TTTTGAAAGTAGCTCACCCATGTGAGGCAAGTGTTCTATTACTGAGCCATAGCCTCACAA
GATACTCTGATGCCCCTTAATTGAGCTACTGTGTCCATCTACAACTAAAAAAAAAAAGGT
TATCCTGTGCTGAGGACACGAAAAAATTCAGTAAGAGAATATGATATAGCAATGAACTCG
AAGTCTCTTGTAGCTTTACTAAAGAGTTGTGTTTTGTTTCTTGTTTTTATCTCTTACAAA
ATTGTCTCCTGACATTTTTATGAGGGGACAGTCTGGTGGGAAGTCAGGTATTATAACCCA
TGCTTATCAATTTTCAAAGGCAAAGAAAGATGAGCAGTGAGGAAACAAGGATGATTTGTT
CATTAGTACAGGAAAGACTGGATCAAACAAATATTAAAGACTTTGACTCCCCAGTAAGTG
CTGTCACGATGGGACAGTCTTCAAGACCAGCAATGACTGACCACAGCCACATTTTGTTTA
CTGCCCAGAGGAGTGAAACTCATGTGAACCACCAGTGGGAGTGGGGTTGAATGACCAACA
GAGGGATTAAATTGGTCTATTGGAAAGATTCAAACAGGAAGCTTGAGCAAGGGTTAAAAA
TGAAACTGTAAAAGAGGCTCTCTTGTGTTGACAATGATGGTTGCCTCAGGTGTCTCCCAA
AGTTGTACATACTCAGTCCAGGTCATCTGACTATAGAGCACACACTTTTCATACGAGACC
ATAGGACGTCAGGAGGCATCTTGAGTGAGATCAGAGACCATGGGACAAAATACGCAAAAG
CATCACGTTTCTAATCCATCAAGGATAATGGAGGGGATGGAATGTCTACTAGACAGAGGA
AGAAGGAGATAAGAGTGGACTAAGGTTGAGAGGAAAGTAAACTAGACACAGGGAGGGCAT
CCTAGGCCAGTCTTAAAGGTACCTAGCCTGCTCTGACCCCATCTGTCCCCAGCACCTTTG
CACATCAGTAAGATTCTGCTGCTTGATGGCAGGTCCAGGCCTGGCTGGGCCATGGGCAGT
GGCTGACTGACAAACCAGCCTCTCTCCACTTATAGACATTGATCAGCTCATCACCATCAG
TGGCATGGTCATCAGGACATCCCAGCTGATCCCTGAGATGCAGGAGGCCTTCTTCCAGTG
CCAAGTATGTGCCCACACGACCCGGGTGGAAATGGACCGTGGCCGCATTGCCGAGCCCTC
TGCTTGCGGGCACTGCCACACTACACACAGCATGGCTCTCATCCACAACCGCTCCCTTTT
CTCCGACAAGCAGATGGTAGGTGGCCATTCTACCCCGAGGATGGGGTTCCCATACNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGAAGGGAAAAAATTAAAAATGATGACAAGATTACACATATGAAAGAAAACATG
ATACTTGTATTTATGAGTCTGGGTTATTTTGCTTGAAAGGGTGGTTTCATTCTTTGTGAC
TGGATGATGTTCCATTGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTTCTTTGTCCG
TTTATCCATTGATAGGCATCTAGGCTATTTCATGGCTTGGCTGTTGTGAATGGTGCCACA
AAAAAACATGGGTATGATGGTAAAGGAAAAAAGCCAGGAATGATGTGGCACATCTATAAT
ACCAGGAACTCTATAGACGGAGGTAGAAAAATTACAAGCAAAGTCAGCTTCAGCAATTTA
GCTGAATTTAGCTAGGCAAACGCTCTAACCCAGTCCAATTGGCACTGCTTGTAAATAAAA
AGAGCTGGGAATATAGCTTAGTAGAAGAGTGCCCTGGGTTCAATGTCCAGTATTCATTTC
ATATAGAAATAAATGGAGGAAAAGCAGTCATTCACTGTGGTATGGAAGTTGTGCAAAAAC
AAGGACTTTGGGGCTGGGGCTTAGCGGTAACACACTTGCCTGGCATGTGTGAGGCACTGG
GTTCAATTCTCAGCACTACATATAAATACATAAAATAAACATCTATCAACAATTTTTTAA
AAAGGACTTATGAAGTTTTCTTTGTTCAAATAGTTTAATTCAGAGTGTTGAACAGGACTG
AGAGCTAGAGATACTAAGGGAGAGTCCCTGCTACCATGTACTTGTAGGATGGTATTCTTA
GAATCCTTCAAAGATTCCCAGTAACTTAGAATAAAACCCCAACATCCTCAGATAGCACTC
AGGTCCTGGTTTTACCTCAGCATCACCATTCCCACCACCTAACCTATAGCCTTGCCCTGT
TTTGTTTCTGCTCATTGCAATTGGTACTGTGAGATCTCTTGCATGTTCACTTGTCTGTGT
ATTGTCTGTCCCCTTCACTTCATGAAGAAGGAACTTCTTACTGTGAGTCCCCAGTACCTA
CAATAGGATCCAGAATGGGGCAAGTGCTCAGTAGGTGCCTATTTTATAACTGGACATAGA
CAGGGACATGGGCAAGTCCCTGGGGATGTGCAGAAGTGCCTAAATGGTGAGCCTTAAAAG
CATGTACTTCTGCACCCAGGAAATACGTCACTAACTTTTTGTGTGTGTGCTGTACTGCTC
AATTGCACCCTTAGCCCCTACTAGAAGGAATAATTAGAAATAGCGAACATTTATGCAAGG
AGATACAGAATGCACTACAACCTTACAGTGGCAAGTAAGCAGATTTTTTTGTTGTTGTAG
ATGGATACAGTACCTTTATTTTATTTATTTTTATGTGGTGCTGAGTATTGAACCCAGTAC
CTCACACGTGCTAGGCAAATGCTCTAACCCAGTCCAAATAAAAAGAAGATGCCAGGTATC
AAATTTGTCTAAGCAATACAAAGACACAGCTGGGTTTTTGTCTCCACGGTGCTTTTTTGT
TTCCCAAGCTTATTCTGTTCACTGCTTACCCTTCAGATCAAACTTCAAGAGTCCCCTGAA
GACATGCCTGCTGGGCAGACACCTCATACTGTTGTCCTTTTTGCTCACAATGATCTCGTG
GACAAGGTTCAGCCTGGGGACAGAGTGAATGTCACAGGTAAGATGTAGTTTTCTACCAGT
ATGACAGAATGTCCTACTTTTCATGCCACTTTCAGTGTTGGGTAATGCAGATCTTTCAAG
GGTGTGGGGGTACTCCCGCTTTACTCACCTCACCATAGTACCATAGTCCAGCACTGAAAT
CCTGTAGTTCTTTCCGTACTCAAATTTCGGGACATATGGGTTCTTGTGGTCACTTGCACC
TTGTTGTATCAGTCTTCCAATACTATATGTGTGTCTCAAATTGCTAGTATGGTCCGGCAC
AGTGGCACATACCTATACCCCCTGTGGCTCCAGAGGTTGAGGCAGAAGATCATGACTCAG
CAGCTTCAGCATAGCAAGGTGCTAGCATCCAGTGGATCCTGTCTCTAATAAAATCAGAAA
GACTGGGATGTGGTCAGTGTCCCCTGAGTCATCCACTGTATCCAAAAAAAAAAAAATGCT
AGTGTGCATCACAAGAGAACACCTGCTGCTAAGTAGGATATTGATAGGATTTGAACTGCA
CCAGCAACACAGAGAAATCACACTAATTCAAGCTGTAAGTAATTTCCTACTTATTTCCCA
AATGTACAGTTTTTTCATGTCTTTTACAGGACAGGTCCGTGCTCCTTTTTTTGGTTCTAG
GGATTGAACTTAGGGGTGCTTAACCACTGAGAAACATGCCCAGCCCTTTTTTTGTATTTT
TATTTAGAGACAGGGTCTCATTAAGTTGCTTAGGGCCTCACTAAGTTACTGAGGCTGACT
TTGAACTCATGATCCTCCAGACAGCCTCTCAAGCTACATTAGAATTACAGGCATGCACCA
CTGTGCCTGGCCAGAGTGCTTTTTATTTTCATGCTGAGAGACTGACACAAAGGCGAGTAG
GTAGATACAACTCGGTGCCGCTGTAAATTATGGTTCCAGGCTCCAGATCCTGTCTCCTCC
TACCAAGAGCACACTTTCCTTAGTACCAAATGAGCAGCAGTATTTCATACATTTTGGAGG
CATGTAGGTACTTGGTCTCTCAAGATTGTCTAGCACATTGTTTTTCATGTGGGGAATGAG
TCCAGGGACACTGGCTCTGGGCCTGAGGCCCACAGTTTCTCTGTTCTCTCAATAAGTTAA
GATTTCTCATCCTGTTTCTTCCTTGGCTTAAAAGCTAAGCAGTGATCACTAACAACCTTA
GGTTATAAAAATATGTGTAATAGGTGAAAATTCAAAAGCATGTGTAGTCACTACAGAAAG
AGATATAATCCCAATTCTGCCATCCAACTTCTCTGAACCTTTGATAAAGGGTTTAATCCA
ATATGTGGATCAATGTGATGATACATGTGAAAGAATTAGGGTAATCACAACAAATGTGTA
CAGGAAGATAACCAAGCCAATTCAAATGTCATCAGCATAATAACCCTCACCCATCTTGGT
GTGAACAACCATCTAGTGTGTATTTTAAGAATATTATGTTTAAACTACTTTTTATATTTA
AATGAGAATTGCATTGGCCTGTTAAGTACATAAAGGACAATTGTTATAAGAAAGACAAAT
ATCAGACTTTATCCTCAAAAAGTAGCCAGAAATGGAATCAACTTGGAGCTTAAGGCTTGT
AGTTTGAAATCCAAAGAAGGTAAGCATCAGACATATCGCTCTGGGAAACATTCCTTTTTT
GAGAAAGTGGGTACATAATTGGTGCACTTGATGTGTTATTGTTTTGTAATTTCTCAATTA
TATTCTTTATTTTGGGGGATTTTTGTTTTTTGCAGTGCTGCAGCTGGAACCTTGCACAGG
CGAGGCAAATGCTTTAGTCCTGATCTACATTCCCAGCCCTCGAATTGTATTCTCAGGAAA
ATACTCAGAAACACCTTTGATTACTAACCAAAAATAGTCCTTTTTCTTTCACCTTTGACC
CAGTAGTCTGTCTTATTCATGAAAACTTACTTTCTAGTTTGAGCTTTTAGAATTTTCTTT
CTTTCCAAGTTTTTGGTATGGGATTTCAGCATATGTTCCTGTCAAAATTGTTAGCAGGTC
TTGAGCACTGAGCCCTATGGAAATACAAGTACTATATATTGAACATAATCATGAGCCAGG
CCTTGTGCTGGAAGCAGTGTAATGTCATTTCATCCCCAGAATGATTTTATGCCATGCAGT
TATATCTAGATAGATACCCAAGGTCATAGCTATTGGGAAAACAGATGAATATGATTTTAG
GTCCACCATCCTCAGAAACCTATGTTCTTCCCAGCGTGGCCTTTTCCTGTTGCCATTACC
CGACTTGATCAAAAAAGGACAGGAGCTTAATAGTAAACGCCCAAGTCCTCAGCCCAGGAG
GCCCACTGAGGTTATGTCTTAGGAGCTCAGCATGGAGCATCTCACCTTGGCCATTGCTAC
CTACTTAGCCCTTCAGAAGAACAAGCCTGAGGGTAAAAGTGTGTCTCCTGGTTGTAATTT
TCAGGCATCTATCGAGCAGTACCTATTCGAGTTAATCCAAGAGTGAGTAATGTGAAGTCT
GTCTACAAAACCCACATTGATGTCATCCATTATCGGAAGACGGATGCAAAGCGCTTGCAT
GGTCTTGATGAAGAAGCAGAACAGAAACTTTTTTCAGAGAAACGTGTGGAATTGCTTAAG
GAACTTTCTAGGAAACCAGACATTTATGAGAGACTTGCTTCAGCCTTGGCTCCCAGCATT
TATGAACACGAAGATATAAAAAAGGTAACAGGGCTGGGATTGTGGCTCAGGGGTAGAGCA
GGAGAGCCTAGCATGGGTGGGACCTGGGTTTGATCCTCAGCACCACCTAAAAATAAATAA
ATATTAAAAAGGTAACAAAGGATTTATAACTCAGAGTTGGAATCTACAGTTCTTTGAGAT
CCAGTATAAACACTCATCTTCCATTTACTGCCATCCTCTTGAGGATAATAGTTACTGCTT
GATAGAGCAGGGTGTTGGTGTGTTGCCTTGATCATTGGTTGGGAATCATAGAATTATTGT
CTGTTTACTCATCTATGCACTGAACTCATTCGTGTTTCTAAACATATTTGGCCACATGGG
GTCAGAATAGAGATTTATGTGAGTAGTGTTCTGGCATGATTTAAATTTTTCAGAAAGTGG
GTAAATAATTGATGCACTTGATCTGTTATTGTTTTGTAATATTAGTGATAGTTTAAAGTA
ATCAAAGCACTTTCATGTGCTTTTTTTGTTAACACCTTCAATTAAGAATAGATAGGTACC
TCTAAAATTTAAGCTAAATCTGTTATGCAGTAAGTGAACATTCATCATTATGTGTTATTT
GTTTGGGGTTTTTTTGTTTTTGATTTTTAGGGAATCTTGCTTCAGCTATTTGGTGGAACA
AGGAAGGATTTTAGTCACACAGGAAGGGGCAAATTTCGTGCTGAGATCAATATTCTGCTG
TGTGGTGACCCTGGTACCAGCAAGTCCCAATTGCTACAGTATGTGTATAACTTGGTCCCC
AGAGGCCAGTACACATCTGGGAAGGGCTCCAGTGCAGTTGGCCTCACTGCATATGTGATG
AAGGACCCTGAGACCAGGCAGCTGGTCCTGCAGACAGGTGCCCTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTGGGGGCGTTTTTTTGTTTTC
CTGAGAAAACCATTGTGACTGAGGCACACATTCATCTAAAATGAGGCATGAAGAATGGGA
CATTTCCACATGTAACTATGGAAGTCAATAAAGGTGATAAGGCCCTTGGGTAGCAGAAAT
TTAGAGTGAAGTTTAGCAGGATTCTGAGCAGACACTACTCTTTCCTGCTGCCAGCATCGG
GGTGAGGCTTCTAACTGTACAGTTTTTTCTTATAGGCTGGGATCATCTGTCAGCTCAATG
CACGCACTTCTATCCTGGCAGCTGCAAACCCCATTGAATCTCAATGGAATCCTAAAAAAA
CAACCATTGAGAACATCCAGCTACCCCATACGTTATTGTCAAGGTATTGAAACTTTTTTT
GGGGGGGAAGTAAGGGTGTACTGGGGATTAAACTTAGGGGCACTTAACTACTGAGCCACA
TCCCAGCCCCATTTTGTATTTTATTTAGAGACAGGGTCTCACTGAGTTGCTTTAGCACCT
TCCTTTTTTGCTGAGGCTAGCAATCCTCCTGTCTCAGACTCCCAAGCCGCTGGGATTACA
GGTGTGCACCACCTCACCCAGTTTAGAAAGGGTTTTAAAGAGTGAGATTTATTAAAGCTA
TCATATGAGCCATACTTTTTCTTAGTCTTACTCTCCAAATGTGGATATATATGGATTTTA
GATCTTAATTACCTTTTCTAACCAAATAGTGTTTTGTTTTGTTTTCCTGTGTCTGAAAAC
AATCAAAGGTATTTTCCTTTGAATCTTTAGATCTTCAGAATTGTAGTAACATTTTCCTAA
GGGAAGTCTTACTTCAATGACTTAGCCATTACCTGGACAGACCTAAGGATGAAACTGCAT
AGGTTTAACCCACGGGCTCTTTCAGGGATAGAAAGCTGTTTTTTCCTGTGATGGCCCTCA
CTGGGTGCTTGTTCACTACACAGTCTGCAGTGGCTCAAGTAACCGTTAAATTCTGTTTGT
AGATATGTTTTCTCCCATACAGAAAGACAGTGTTTATTTCCTACTGTTCCTCAGGTTTGA
TCTGATCTTCCTCATGCTGGACCCTCAGGATGAGGCATATGACAGGCGTCTGGCTCACCA
CCTGGTTGCATTGTACTACCAGAGCGAGGAGCAAGCAGAGGAGGAATTCTTGGACATGGC
AGTGCTAAAGGACTACATTGCGTATGCTCACAGCACTATCATGCCCCGGCTGAGTGAGGA
GGCTAGCCAGGCTCTCATTGAGGTAACCTGATAGAGTATTTGTAAGCCCAGTGAATTTAT
GATCAGAAGACCTATGTTCAGATACGGGCAATGCCACTTAATAACTTTAGACAAGTAATC
TAGTTTCTTTAAACTCCATTCTCTTGTCTGAATGAATTAAAATGAGTGTTAAAGAGGTAT
GTTACCTTCACTTTTCAGTATCCTTGTATAAGGACACAGTACACTGACACATCCAAAGTT
ACTCAGGTATTCTAATATCAAGGTTCTTGGTACCTTGATGGGCTTTCCATCCTCGCTGAG
CTACAAAAATGCTAAGTGAACGTTACAATTTTCCATCTGAATCAAATTCTTGAGGTTTAT
GTCATATATGAAATTAATACAACTTAATCTTTGTAATATTATCCCACTGATCCTTTCTGT
GCCTTATCACACAGATCCTTGCTAGGTATACATCAAAATCAGTATTCAAGAGCTTTTGTC
AGATTCCTCATCTGCTCTAATCATACCTACTTCTCACCCCATGAGCCATGTCCCCTTCTC
TGCCACATAATGCAATTCTCTGTTCTTCAAAGGTACATCAGATATTACCTTCTTCAAGAA
ATCTTTCCCAGTTGGAATATTTGGGGTTTTTTGTTGTTGTGTTGTTTTTGTTTTTTGTGG
TACCGAGGATTGAACCCCAGAGCACCTAACCACTAAGCCAAATCCCCTCAGCCCTTTTTT
TATATTTTATTTAGAGACAGGGTCTCACTCAGTTGCTTAGAGTCTCGCTAAATTGCTAAA
GCTGCTTTTGAACTTCTGCCTCAGCCTTCTGAGCCACTGGGATTACCTGCCTGGCCTCAG
TCAGAATATTTCTCACCATCGCTGCAAGGTGTTGTTATGGTCTTCCTCCAGAACTCCCAT
GTTCTATGTGTCAGTCTCCACCACTTGATGAGCTCCAAGGCTAGAAACTAGATTTGACTT
GTGATTTCCCTCTATTACCTGTACAAGACAGTCAAGCAGGATTTCAGTTTATTTAATGGC
CCCCTAACTTCAAAATTCAGCCACAAAATTTTCTTATGAGCAAGGGGTTTTGCTTTTGTT
TTTTCTGCTTTCACTAGGCTTACGTAGACATGAGGAAGATTGGTAGTAGCCGAGGCATGG
TTTCTGCATACCCTCGACAGCTGGAGTCATTGATTCGCTTAGCAGAAGCCCATGCTAAAG
TACGATTTTCAAGCAAAGTTGAAGCAATTGATGTAGAAGAGGCAAACGTCTCCACGGGAA
GCTCTAAAACAATCTGCAACTGACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNAGCACTATTAATGATTGAAGCAGATGTTCTCTCAACCATTTTGGGATTAGAGC
CCCTTTGAGACTGATCAAAGTTGCTGCCACCACCTCCCATCTTCTGATAAAACTAAGACA
AAAAAATTTTGTCTACAATTTTAAGGGAAGTCTATCTCCTTTGCTGTTTCTGCCTATGAT
AACCCATTTAAAAGAAGCAGAGCCAGTTGCACATACCTGTAGTCCCAGCTACCAAGGAGG
CTGAGACGGGATGATCACTTAAGCCCAGGAGTTGGAGCCAATCTGGGCAGCATGACCTAG
TTTTTTAAAAAAGCAGTTCATCTCTCAATTTATGGCTGTATTTACTATACAGATTACATA
GACTGTCTTTCAGTATAAAGTAGCAGCTACTGGCATATACAAAGTTTAAAAGAACAGCCC
CTGTATTCGAAAGTGATCATGGGCTACCTGTGCCCTGGTCATTGATAGTGCAGGGAGAGG
AATTGCTGAAAGCATTTCCCCGTGTTTGGAGGGTCTGCTTTTGTCCCTTTCGAATTCTGG
AGCTTTTGTACATATATTGTGTCTCACTCTCTTTCTTACCTCCTGATACCTGGTGCTGAG
GCCCCTGCAGTGCACCTTCTAGCATGGTGTGGGCACTGGGGACTTTCAGAAAGGGAGTCA
AAGCAGGGCTCTGCCGTGGGGGACTTTGTTCATAGGCTGATTTTGCAATCACAATAGAGA
TCATTTCTCATCTTTATGTTTTTGAATTGTAGGCCACAGTCTCCTTACCCTTCTTGGTGA
TGCTACTAAAGGAATGTTTATAGGAATTTGAAACATTTTAATTCCTAATTGCAGAAATAT
TATTTTTCTTTTTTAAATTAGGAATGAGTGCCACTTCTCGTAAACGGAAAGAAGAATTAG
CTGAAGCATTGAAAAAACTTATTTTATCAAAGGGCAAAACCCCAGCTCTAAAATATCAGC
AACTTTTCGAAGATATTCGAGGACAATCTGACATAGTAAGTTTTAATATGTATTTTTTGT
TTAGTAGAGTTTTCCTCTTAATATTGCTTTTAGAGTTTCCCCCCTTCTTTATTTATTAAG
TAATAAATGTAGATGAGAATGAAGAGGTAAGATGATCCATAAACCCATAATCAAGATATA
ATCAAAATTAAAGTTCTGTTATATCTACTGGGCATAGTGGCACACACCCGTAATCCCAGC
AGCTCAGGAGGCTGAGACAAGAGAATCATGAGTTCAAAGCCAACCTCAGCAACTTAGTGA
GGTCCTGACCAACTTGGTGAGACCCTGTCTCAAAATAAAAAATAAATGGGCTTGGGATAT
GGCTCAGTGGTTAAGCACCCATGGGTTCAATCCCCAGTACCAAAAAACAAAAAAGTTTGT
TATGCCCTTTCATAGTATTTTTATGTGTATAAATTTGCTTTAAGGATGAAATATTTGGGT
GCCTTTTGCAAATAATTAAAGTTGAATTGTAAGTCAGGTGCGGTGTTATTCAGCAACAAG
GGAGGTTGGGCAGAAGAATTGAGCTTGAGGCCAGTTTCAGCAACCTAGTGAGGCACTAAG
TAACTTTTAAAGATCCTATCTCAAAAAATAAAAAGGTTGAGGATGTAACTCAGTAGTAAT
GTACCCAAGGGTTCAATCTCCAGGACCAATAAAAGGAGGGAAAGGTTGAATTCTTCAGTA
AAAAGAACTACATGGACTGGGCGGCACACACCTGTAATCCTAGAGACTGAGGCAGAAGGA
TTGGAAGTTCAAAGCCAGCTTAAGCAATTTATCAAGGCCCTAAGCAACTTAAAACCTGTC
TCAAAATTTAAAAATGAAAAGGGCTGGGGAAGTGCCTCAGTTGTTAAGCACCCTGGGGTT
TGATTCCTGTTACAAAAAAAAATGAAAGAACTACCTGGGTCAAATGTAGTCCTGGCTATT
TTTGTTTATTTGGGTTTTTTGGTGTTTTTGGGGGGGGGGTGTGTGTGTGTGTGTGTTGTA
GATTGACACGCAATATTTTTATGTATTTGTATGTGTGTTGAGGATCGAACCCAGTGCCTC
ACATAGGCAAAGCAAGCACTTTACCACTGAGCTATAGCCCCAGCCCTCCCTGTCTTCTTT
TTGATGTTTTTGTTTTACTTTGTTTTTATAAACACGCCTTTGCTTATTGCCCCTGGCTAT
ACTGGCACCAGGAAGGCAGAACTGGGTAGTAGACAGCAAAGACAGAAGGGATCCCAAACC
TAGTCCTTTAAGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATG
GGATTTGGGATGTGATTTTTTTTTTTATTTTTCTCTCTTGCCCAAAGGCGATTACCAAAG
ATATGTTTGAAGAAGCGCTGCGTGCCTTGGCTGATGATGACTTCTTGACAGTGACTGGGA
AACTGTTCGCTTGCTCTAATGCTCCCTGAGCTGTGCTCTTGCTTGCTCCTACCTAGTTGG
ACCTATTTGTATGCATGTGCAACCTGTAGACCAGTCACCTGTCCCTATTGCCATCAGTAT
AAATAGATTCTGAGAGGCATTATTTGGCTACATAAAATATTCTAAACTGGGTTCAATTTT
GTTAGTGTATATTTTCATTCTTTTAACTTTTTTTTTTTTTTTTTTTTTCCTGCTGAGGAT
TGAACCCAGGGCCTTGTACTTGCAAGACAAGCACTCTACCAACTGATCTATACCCTCACC
CCCACATTCTTTTTAACATTTTAAGTAAAAATAATATGGCAATTTATAAATGTAGAGACT
ATGTGCCATTTCATTAGCAGTGGGGCTTTTCATCTGTACATAGAGAACAACATGTCATCC
TTTGAAGGTGGCAATTTGAATTGTGGGTTTTGTGTGAAAACTAATGGTGGACATTTGTGG
GCCTGAGGATTTTTTTTCCTGTGCTGGGGATTGAACCTAGGGCCACATGTCCTAGTGCTC
TACCCCTAGGCCACAGTACCTTGAAGGATTTTGTAATAAGAGATTCTTGGAGACAGAGCT
TATTATTCAGTGTGAAGTGATGAAGGGCTAGAGCCTTCTTCTTTAATAGCACTCAAGTGT
GATACTTTTTAGAGACTTTTCTTCATGGCTACTGTTTTATCAGGAATGTGTGGTTGCAAA
TGATCAGATTCCAGGTTGACTTTGGCTTTATCCTAGTATTTTTCTAAATAAATGATAGAA
GAAATAATACTGGCATTATTAATGAATAATTAATATTGTTAAATATTAAAATATTAATAA
ATAATAATCTTGCATTATTTTTCATTAAGAAAAAGAAGCCTTGCTAAACACTACATTCAT
GGGAATGCATAATGGTAAGTGCTTTATATATCATAAAAAAACAAGATACAATGAATTTTA
TTTTATTCAAATTTTAATTAGCCCTAGCAATCAGTATTCTCAAAATTATAGCCTCAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1069, 1412..1565, 1928..2091, 2182..2283, 2657..2674, 2677..2732, 2734..2752, 3280..3375, 4385..4523, 6515..6735, 8436..8556, 10984..11243, 11850..12103, 12254..12365, 12755..12882, 13554..13761, 14837..14980, 14983..14991, 14994..15063, 15981..16114, 17507..17578, 17581..17598
1001..1069, 1412..1565, 1928..2091, 2182..2283, 2657..2674, 2677..2732, 2734..2752, 3280..3375, 4385..4523, 6515..6735, 8436..8556, 10984..11243, 11850..12103, 12254..12365, 12755..12882, 13554..13761, 14837..14980, 14983..14991, 14994..15063, 15981..16114, 17507..17578, 17581..17595
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved