Spermophilus_tridecemlineatus Locus RPL37
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus RPL37
Spermophilus_tridecemlineatus
RPL37
GeneScaffold_4575
SNORD72
2812..2891
4041
ATCTTCTTGTATTGTTTTTGCTTCTTTGTATTTGTTTTTCGGATAAGAGGTTACAAATG
CAATAGCACTTATTGGAATTGGTCATGGGACTATGGATTTCAAAACTAAATAGAATTTTA
TTTTTTTAAGTACAGGCTCTAGGGGCTCAGCAGTAGAGCGCTCGCCTAGCATGTACGAGG
CACTGGGTTCGATCCTCAGCACCATATAAAAATAAATATATAAAATAAAGGTGTAAAAAA
AAGACTGATTTAAAAAAAAAAAGTATAGGCTCTGCCCAAACCTGCTGCAACAGGATAGCT
TGACAGCAGGGTGCTGAAACCGTATTTAACAAGTTCCACGATAAGACTCTTCGGCATAAT
GAAATTTGGGATCAAATCATTTGCCTCTAAATAGCTACTGTTCAACAACCACTTTGACTT
TCCCTTTGGATGCTAAGCTCCAGTCCCTTCAAGGCCAGTTCCTGCCGGTGCGCTTTTAGC
GACCTCTCACAGCATGAGCCAGCGTCAGCCAAGAGCCTCCAGCCCGGAAAGCGGAGGAAT
CGGTGAAACTGGTCTCTCCCGAATCGAGATCTCAGTCCCAACCCGTCACTACAAGCGCGC
CGGCAGCGCTGAGTCGGTGCAGGTGCCCCGGGCCCGCCGGCCCACTCGGCAGATTCTCCA
GCCTACAACCGGAACCCACAGTGTGGCACCGGATCTGATAAGGACACGAGGCCGGCAGCA
GCTAAAATTCCAAGGCTTTCACTACAAACAGTCCCCAGCTCGGAGGCGGGTCCAACAGAG
ACACGCCCATCCCTTGCGAGTTAGCAGAGAGCCTCGCCGGTCTTACGGGCGCGGAAACCT
GATTGGCTCTGCCTGCTTCTGTGCATCCTCTTGAGCCCACCCACAGCGCGCCAACTGCGG
CGACGGAAGCTTGAAAGCAGTGCACTGCGTCCCGCAGGAAGTAGTTCCTTGGACGGAAGC
TTCTGAGGGCCATCTAGCGGAAGTGCCTTCTCTTCCGGTCTCTTTGGATTCGGCGGCCGA
CGCGAGATGGTGAGTTTGTAATGCTCTCCGAATCGTTTTCCATCCTCGTCCTCTGTGCTG
CACTAACTTTGTATTTATGGGGGATCGGTAAGGCTCTGAGTAAGGGGAGCTGGTGAGCAT
GAAAGAGGCATGCGATGGCTGACAAGAACCAGAAGAAGGGCTTTTGACAGAGGGACTGAC
ACCGCAGTTGTGGAGCTGGCGCTGCTTTATGTCTTTCCCTTCTCTTAGGCCTTTGGGGGA
GTTCACATAACGTTGCTGTTGGGTAGGAGCTAACGGAAGAAGTTTGGGAGCAGAGGAATT
TGTGGTGGTGGTACCTAGCAGGAGTTCTCAGGCTTTGGTCTGATAACATATAAATAAATG
AATAAAATAAATGTCTATCAACAACTAAAAAAATATTTTATTAAAAAAATGTTAAGTTTC
CTAGAAAACGTCGTAATGCATATAGAAATTGTCAGATTTCGGATTTGTTTATCCTTATAA
TCTCCAGACGAAGGGAACGTCATCCTTCGGGAAGCGTCGTAATAAGACGCACACATTGTG
CCGCCGCTGTGGCTCTAAGGCCTACCACCTTCAGAAGTCGACCTGTGGCAAATGTGGCTA
TCCTGCCAAGCGCAAGAGAAAGTGTAAGTCAAATGTTATTCAAGCTGTTTTGTTTTGCAC
TGCATCCAAGTAAGAGTGTAGCTTTAAGCTTTTATTTGGTGCACAATACAGAACTGTTGA
ATTCTGTATGTTGTTGAAATGGCATGAAACTCAAAAGTACTCTTAAAAAAATTGGTCGAC
AGTCAGGGGAAAACAATTTGCCGTTTTTTGTTTTAGATAACTGGAGTGCCAAGGCTAAAA
GACGAAATACCACCGGGACTGGTAGAATGAGGCACCTAAAAATTGTATACCGCAGATTCA
GGTACAGTTTTACCATTTCAATATAATTGGTACTGAGAGCTTGAATAAGAACCAACACGG
TTGCTTGTGTAAGATTATTCTACTCTGGTGTAAGAAAGAATAAGTTATTGGGAGCTTTTT
TTCCCCCTTTTTTTTTTTGCTATTCACTTGACATCAGTTGATCTAAATAGTGTTAATCCT
GCAGTAAAAAATATGGAGCGTTTTTCTAAGCTAGACTACCTGAAACGATGCTATTTATAA
GGCATACCTAGATTTTGTATAATTGGAATCAAAGTTTGTTCTGACAATACTGAAGGTGTG
GGGTCAGGCTTATTTGATTCAAACTTCATGTTTGTGGTGTTGGCCAGTTTGCTATGTAGA
AAGATGCCTTCGAGTCTTGTAACCAAAGTCTGGGCCTTAGAATTTCTTTAAAATGCAGAT
TACAGGCCCACCTGAGACTATAGCGTGAGAATCTGGATTTTATAACAATAATTTGTAAGG
CCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCTAAGGGGCATTTG
TAGTTTCTTTGCTTGGTTAGCGTATTAATGTGTATAAAGTTGAAATAGAAAACTGTTTTA
CAAAACTTCTACTGTTCAACCTGCTCATTATTTTTCTTTGACTAAGGGAAAGTTAAGATC
TATTCCTAGACATAAGGAACCGTTTTTTACAAATAACTTTGGATCCCTTAGTAGAAAAGT
ACTGACCAAGTGACCAGAATAGCCCAAAAAAAAAGTTATTGAGCCTTTATTAAAATTAAA
GTCAACTATAATCCAAAGTTGATACCTTAAGCAGAGTGAAATAAATAAAACAAGCTTATC
GGTGATGTTGTACAAATAAATGTCTGAACATATGAATGCAATAATGATTTCAGCATTTAA
CTGAGATAAGCTCATTAAAATTTGTTTAGCAAAAATTAGAAGGTATTTATTGAATTGTTG
AAGTAACTGTTCTTGTCTTTAACATGGTGCAGGCATGGATTCCGTGAAGGAACAACTCCT
AAACCCAAGAGGGCAGCTGTTGCAGCCTCCAGTTCATCTTGAGAGTTCCAACAATTAGCC
ACCCAATAAATGTACTGGTTTTTAAAAATGTGTCTGGTGTGCTAAAAATGTATCTGGTTT
CTAAGAACTAGGTTTGTAGGATTGAAGAATTACCTAGGCTTGGGGAATGGGGTGAACTTA
TCAGATTTACATGTTAAGAATGTTTTGGCAATCTAAATTGTGTGTAGTAGCATATAATTT
GGTAGATATGGGGTGTGGTTGACAGTCATAGAAGCCTTGGAGTTCCCATGTGGAGAAGGG
TAAGGTTGATTAATTCTGTTTGGGAGATGGTAATTATACTCCTAGCAACTGTAAAGATTG
CTTGGCGCCTAGCATGAAGCCCATGTAGGAACTGAGTGAAAAGTTAATGCAATTTGCTGG
GTGTGAGATAACTTGGAAAGAATGTTATAGGATTAATAGCATCTGTAAGGCTTTTTATGC
AAATGGATTAAGAGGTAATTCCTGAGATTTGAGGCCTTGTGCTGTGATGTGTGACTACCT
GGTAGATGTTGGTCCCACACCCCCTTGTGTAGGTCTTGAGATGATGTGCATAGGTTGTAT
AAAAACATGCTACTTTATATATGGGGACTTTAGTGCCCATTGGGACTTTCTAGTAAACAA
ATCCTCACAGATGAGGGACAACTGTACTAAGTCCTGCCTTTGTTTGCTTCCTAATTTATC
CCTTGGAACTCAGATTGGGGGGGGGCGGGGGAGTGCTAGGGATTGAGCCCGGGGCCTTGT
GCATGTGAGGCAAGCACTGTACCAACTGAGTGAGCTATGTCCCTAGCCCTGGAACTCTTC
TTTTTAACTCTGACTTGTACGGAGCCTTTGCTCAACTAAAATCACTGTTGGGCTTTCTCC
CAGTGTATGGTACTACTATAGAGTGGTTTTATTAACTATCAAAACAGCAATTTTTACTAC
ATTTTGGTTTGATAGAACTAAATTCAATCTTAGGATCTTTATATTATAATCAGTCTTTCA
GTATTACTAATCATTGGTTTCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1028, 1507..1535, 1540..1642, 1836..1920, 2972..3041
1001..1028, 1507..1535, 1540..1642, 1836..1920, 2972..3038
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved