Spermophilus_tridecemlineatus Locus ENSSTOG00000002512
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ENSSTOG00000002512
Spermophilus_tridecemlineatus
ENSSTOG00000002512
GeneScaffold_1300
SNORA19
17566..17698
28163
TTAGTTTTTGGTCTAGGATTGCATTTTCCAAATTTTCTTTCTTTATAGCAATAAATTTA
GTTAAATAATAATAAAAACACCTCTTTGAGGAGAAGGAATGAAAAATGCTTGTTATGTGT
ATTGTTTTCCTCATTTATTGATGTAGTTTCCCTTCACTAATTCACATATTCCGCCTATTA
TTACAAGATGTGCAATACTCTTGCAAAGATTATTCCACAGCTTTCTACATTTCCTTCTGA
ATTCATCTTAATTTCATACCAAGGGCTTGAGAATTTGATTCGGTTTAATCTGTGAGCATT
ATAATTTTTTTCCCCACTAACACACATTTCTCTCACGTTTGTTTGTGACGTGCCCCATAT
GTAAAAGCGACGACACTCATGTATTTTCAAACATGCAAGCCTGTTCTGCTCCAGGGCTTT
TGCTCTATGACAGGTTGCTCTGTCCCTGCTCGCCACCTCGGGGAGCCTCCATTTCCCAGG
CAATCCTTGTGACACCAACTTTATTTTACCAAGTTACGAAATAACTGCTCGTTTGTTCTT
CACCGCGCCCCCCCACCTCCCCAGGCTTGTTCGTTGAGGACGTGCCACCGCTATTTCCCG
GTGGGGAGCAGCACTGGGCTAACGAAGCCTGCTCAACACATTCCCCTTAAATAAACTCAG
CATTTTCACTTATCCTCGCTGATGGGGCCTGTTGGCAACTTAGCATGAGTCCGCACAAAT
TGTGTTGGAAATGAAATCGTGTGTACGCGCCTGCCTTGTGTCCTTGCAAAGCCTCTGGAC
CCAGACTCACCTTTCCCACCCTGACCCTCGCTCGAGTAGGGAAGGTCTGGGAATCATTTC
CCTAACGACCCATGCGCGCCTCCGTCCCAGCGCGCGCGGAAATCGCCACAGTCTCTGCCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGGCCGGAAAATGCCCTCA
AACGCGCCAACGTGAGTAGGGTGTCGGGGAGCGCCGGCGTGGGGCAGCCCGAGGCCTCGG
AGGTCGAGGGCCCAGGCCTGCTGCCTCCTGCCCGGGCTGCGCCCAGAGCCGAGGTCGCTT
CGGCCTCATTCGCCGTCCTGGCCCGGGTCTGGCAGGGTTTCCTTCTCCCTCCCAGCGACT
GGGGGTGGAGGCGTGGATCGGAACCCTCGTACGGGCCTTACTCCCTCTGCTGCCTGCTGG
TGCGACGCGGGGCGGCGGTCCAGTAGACAGTCCTGTCGGGGTCCAGCTCCTTCCTGGCGT
CCGTCTCCAGCTGGCTTTGCAGACCACCTGGCTCTGGTCCGCTTAGGCCCAGCGCCCCCG
ACCGCCATCTGGGAGTGCCCGGGAGGAGGAAACATGGCTTCCTCCCGGGGACAATGCACG
CGAGAACCTCGGCCCCACCTCCCCCAGAGGCCGGGAGTCCGGCAGGTCCACCTCCGCCCC
CCCTCCCCCCGCAAACACCTCTGCCCCCTAGACCCGCGAGGTGCTTTGCCAGGTCAGGGT
CCACTTACCCTTAATCCAGCCACTTAAGTGCACTTTGGGGCCTCTGACCCATTTAACCCG
TTTCCTGTTTTTTTTTTTTTTTTCCTCCTCCTCCGGCATTGATTGGGGCAGTCCGAGTGC
CTATTCCGAAACATGGGAAGTTGGAACAGAGTTAATATAAAGGTCCTTCCTAAACTGAGG
CCTGGAAGGAGAATGGTTTCCCCAAGGTCACTCCGGCAGTTAGTTGTTGAGCCGGGAGAC
TAAAACCAAGGTCTCTTGACTTCCAAATCGATTTTTTCCCCCCTCTTGTCCTAGCGCTCC
TGTTTGCTATTTCTATTTCCATGTGGGTAGTTAAACCCTCGCACTTGCAGGAAAAACTTG
TGCCCCCTGATGTGTTCCAGAGGCACTTACTACATGGACACTATGGGGGTGCAGATGTCT
TTTGCATATCTCTGTTCTTCAGAAACTTTCTTGTTCAGGTTTTTTTTTTTTTCCTACTTT
TAAACGAACACACAAGTATTTTGTAAGCACTCGTAGCTCTTATTTTCATCTTTCCTACAT
CCAAACAAGTTTTGGGTCTTACCCATGTTGTAGATGGACATACCGTGTCTGTTAATAGTT
TTATGTTTCAAGAGTTTGTTTTTTTTTTTTCTTCTTCAGTTTGAAACTTCATTTTGTGAA
AAGACCAGTGGGAGTCAACACATAAAATTAATGAAAATTATGTATTGTTGATAATGTCGG
GATCAAAAATGTGTTGTTTTCATACTTTAAAATAAAACTGAGTTTTTGTGGGGAGGGACT
AGTCTATGGATGGACTAACTGCATAATAATTGTGTTCAAAACATTAAAACTACAACATAG
ATTTGATCCCTACCCATCCTAAACAGTAATCTAATTGCTAGAAGAGACACTTTAAGGATT
TAAAACAAATTTTTTAGGAAAGAAAATATAATGGAATGGAAATTTATTGCTACAGACTAA
ACTGTAGCTAAATGACTTTTTTGATGTATTGAAACTTAGAATTTTATAATGGTATACAAA
ATAACTTGCATGAAATTTCTATTCTGCGCTGTTATTGTAGATGAATTTTGGTCAGTTGCA
TGCCTCACCCTCAGACCCTTGTCTATGCTAGCAGGATGAAGTACTGTGGTCTCCTTGGCC
TGAACATTGCTTACATTGTGTTCATAACTTGTTTCCTCATCACTCCATTTGGAATCTTCA
TATAAGCTTATTTCAGTAACTTTTTAAAAATAGAAAGGATGTAATGTGTTTCAAATCTTT
TTTCCACAATTTCCAAGTTGAAATAAACTTGATTCATGCAGGGCAAGTTGGAAAGAATTT
GAGAGCAAAGTAGTCAAACGAGAAATGGATATTATGGGGGAAAACTTGGATCGTATTTGT
GTAGTTTTTAAGTTCGTACTGACTCCTTGTAGTTTGGTGGCTTTTGTGGCTAGAGATGCT
TTAACTTCCATCTAATAGCTTATATACATTTGATCTTTTGAGTGAGGTATCTCTTAAAGT
GTCAAAGGGATAAGATTGTGAATGGCACATGGCACTGCTTACCAAACATTAAGTAGAATG
ATAAAAGGGTATTCCACTCATTGGAAATTAATTTTATCATTTTTTTATCTATAACATTGT
AACCTGAACATCCATTACATTATCTTAATAAAATAATATATTTTAGTAGGATAAACCTCC
AAGGGGCTGGGGATGTGGCTCAAGCGGTAGCGGGCTCGCCTGGCATGCTTGCGGCCCGGG
TTCAATCCTCAGCACCACATACAAACAAAGATGTTGTGTCCGCCGAAAAAACCAAAAAAT
AAAAAAATAAAAATAAATAAATAAACCTCCAAGTCACACTGAGTAATGCGTGTATCAGGG
CATTATTTTTGGAAAAAGTGACAGTAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGGGGCTGGG
GATGTGGCTCAAGCGGTAGCGCGCTGGCCTGGCATGCGTGCGGTCCGGGTTCGATCCTCA
GCACCACATACAAACCAAGATGTTGTGTCTGCCGAAAACTAAAAAATGAATATTAAAAAA
AAAATCCACTCTCTCCCTCTCTCTTTAAAAAAAAATAAAAAATCCTGGCAAGTTATTTTG
AAGATGATACCAACTAGTTGTAAAATTTGTATGGAAAGGCAAAGGACCTAGTTTAGTCTG
CACAAAACTAAAGGACAAAGATGGCACACTCTACTTGAATTCAAGACCTTATCTAAAGAC
TACAGTAATCAAGATAGTGTGGTATTGACTAAAGAGTAGGCACATTAATTAATAGAGAAT
GAATGGAACAAAAAGCCTAGAAATAGACCCTGAAAATTTCAGTGTTGTCAACTGATTTTA
AGTTTTAAAGGCAATCTGATATGTTTTTCTGCCTCAAGTGTTAGTGTAAATGAGCAAAAA
TTTCACCAGCTAGTTGAAAGTGACTTTGAAGTTGAACTTTTCTAAGTTGATAGAAATTTT
CTTTTTCTCATTGTTTCAATTTCTGGAACTTTTAAGTCATGGTGGAATTGGCTGAAGCTG
TTTTACCTGTACACTATTTTGACATAGTACCAGACTTTTAATTGTTCTCTTAGATAATTA
TGGCATAGCTTTTTTAGATGTCAAAAATACATGTGATTTAAAAAGTCTGTAATGAGAAGT
TACAGCAACCAGTTAAAAATGTAAGATTTAGACTTTTGTATATGTAACTGACTAATTCTC
CTGAATTATTATTATTATTATTATTTTCAGAATTTCTTGAGGTTGGCAAAAAGCAGCCTG
CTCTGGATGTTCTTTATGATGTTATGAAAAGTAAGAAACATAGAACATGGCAAAAGATAC
ACGAGCCGATTATGTTGAAATACTTGGAACTTTGCGTGGATCTTCGTAAGAGCCACTTGG
CTAAGGAAGGATTATATCAGTATAAGAACATTTGTCAGCAGGTACAGACAGAATTCAGTT
TTATATTTTAAAAGTGCTTTTAGTAATTTGCAGAAGAGTTTACCTTTTAGATATATTTTC
TATCATAATTTACTCTAAACATTTGGGAAAAAGTGGTTTAAATTCTTTTTCTTCCCCTCC
TGCTTAGGTGAACATTAAATCTTTAGAGGATGTTGTTAGGGCATATTTGAAACTGGCAGA
GGAAAAAACTGAAGCTGCTAAAGAAGAATCCCAACAGATGGTATTAGATATAGAAGATCT
GGGATAATATTCAGACTCCTGAGAGGTATGAATTAAACCTTTGATAATTTTGATAGTTAA
GTCAGTGTTTTTCTTTACATGGGTTCCATCATCCGCACTTGAAATAGATGTTTATCAGAA
GAAAAAAATTTTTATTTAAAGTTTTAAATGTGTAGTAACCCAAATAATTATTTAGGTAAT
ACTGGAAATTTGTAAAAGCAGAAAATTGAAGCATTTAGAAAGATAGCTGTAATACAGGTT
GGGAATTAGATGTAGACAATAAGTGTGTATGAAGTTATGGAAAAAATTTGTACTATTTTG
TTGGTTTTGATTTTTTTAATCATTGACACAGTAGGAAATATGTCTCATTGTTTTCAACAT
TTAAAACTTTTTTTTTTTTTTTAATTTTTTTGTAGTGTTCTCCTAAGTGCTGTAAGTGGG
GAGGACACTCAGGATCGGACTGACAGATTACTTTTAACTCCCTGGGTAAAGTTCCTGTGG
GAATCATACAGACAATGTTTGGACCTTCTTCGAAACAATTCTAGAGTAGAGCGCCTCTAT
CATGATATTGCACAGCAAGGTAAAATGACAATGTGAAATCCAAATAATTTGGTTTGAAAA
GTTGACTTTAGAATAGATTTTTTCAGGGCTGGGGTTGTGGCTTAGTGGTAGAGTGTTCTT
GTCTTTTCACATGTGAGGCGCGCTGGGTTTGATCTCTCAGCACCACATAAAAATATAACT
GAAAGAAATTAAAAAATATTTTTTCCAGAAGTTTAATCTCTTTTTCTCCAAGGTACTTCC
AGGAAACAAGCTACTTTTACCCTTTATTGAAATGGGATGACATTTGAGTATAAACAAATG
ACTTGATAAGAAATTCATTACTGGGCTGGGGATGTGGCTCAAGCGTAGCGCGCTCGCCTG
GCATGCGTGCGTCTGGGTTCGATCCTCAGCACCACATACAACAAGATGTGGGTCTGCGAA
ACTAAAAAATAATAATGAATTCTCTCTCTCTAAAAAAAAAAAAATNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCA
GTCTTAACAGGGATGATGGGCTTTTCTTTATTCAAATCCGTTAGTACTAAGTGATTTGCA
ACTAAGAATGTTTTACTGTGAATACTGGGAACTGTGCTTTTTTTGCTTTATGTTTTGGTA
CCTGGATGCTTAACCTCTGAGCCACATCCTCAGCCCTTTTTTATATTTTATTGATACAGG
GTTTCAGGGTTTCACTGAATCGCTTAGGGCCTTGCTAAATTGCTGAGGCTGGCTTTGAAC
TCATGAGCCTCCTCCACTGGGCTGTTTTGTTTACGTGGCTAGCAATGTCAATTTTCATTG
TCCGTAAGTGAACTTGTGTTTTTTTGCGGGTAATGTGATATAAATACTAACTTAAAGTTA
AATTGCCCCACTTTGTTTTAAAGAGCAAAGGAATACTAATACTGCATATACATAATAATG
TATAGGAAATTATTATATTTTAATTGTGGAGCAAGTGGTTTATATGGATATCTGTATACA
TAGTTGAAGTTAGTTTACTGTAAATACCCAGTATATATTTTGTAATTTTAGTATGAAAGC
ATGTTGCATTTGTGTCAGTGAGAAATATAAGTTAATTGTATTTTAGCCTAGAATATTTTA
CTTGTTTCAGTTTGAAGTCGTATGTCTTTGAAAGGTGAGTTTTTCTAAATGCCAATCATT
TACAATTTGTAACTCCCAGAACCATATTTTGGTCTTAGGCCAGGAATGATGACACTGTCC
TTTTTTGTTTTGTCAAGGTTCAAAATAGGGCCCTTGGAGGGAGTTGCCTCTCTTCATAAC
ACATTCAGATGCTCAAGATGAGTTTGGTGAATCTTGTTAACATGGCAAATCTTAATAAAA
CCTCAAGTACTCAAGCCAGTAGTGGAAAATGCCTAATATGTTTGTCAATTATGCTTGTAG
CATTTAAATTCTGCCTCCAGTACACCCGTAAGGCTGAATTCCGTAAGCTGTGTGACAATT
TGAGAATGCACTTATCACAGATTCAACGCCACCATAACCAAAGTACAGCAATCAATCTCA
ATAATCCAGAGAGCCAGTCCATGCATTTGGAAACCCGGCTTGTTCAGTTGGATAGTGCTA
TCAGCATGGAACTGTGGCAGGTATGTTGTGGAATATTAGCTTTTTCTTCTAGTAATAATC
GGCATTACTTTTTTCCCCTTAGTGAATATCTTCATCTTGGTATGATGGTTATCTGGAGCA
GGATGAGTTCTAGACAGGAAGTCTCAGTTTTCAGGCCTGTGAAATTTGAGCCTAGTCATG
TAATCTCTTTTAGAGTTAGTTTCTTTTCCTATAAATTGGTACATTTTCAGTGCTGCTCAA
AGTGTGTTTCTATGATTGGTGCCAGTCTAAACTGTTTAGTCTGGTGAAATAAGTGTAGAG
GAGAAAAGAACTTGCAAAGGTGTTTTGGTTTTGCTTTTTTAGGGGGTGGAGATACAAAGG
ATTGAACCATAGCCTTGAACAAGGTGAACACGTGCTCTACCACTGTGCTACATCCCCAGG
CTCTACAAAGGATTTCCCCCCCTAATTGGATAATGAAAAATGAGTTTATTTTCTTTCACT
TTTTTTTTAGAGAGAGAATTTTTTTAATATTTATTTTTCAGTGGACACAACATGTTTATT
TTTATGTGGTACTGAGGATCGAACCCAGCCCCCCGTGCATGCCAGCAAGCACGTACTGCT
TGAGCCACATCCCCAGCCCCTTTTTTTCACTTTTGTAGTAACATTATTTCATAGAAGTTT
TTGTGGCGACAGATTGGAAATTACTGTTACAGGTTAGAGATAGAGAAATGCTGCCCTGGA
CTTTTGCCTAAGCACTATGGCTTAGGAAGTATGCATGGTGAATACTATATATATAAAAGC
TTCTATATATTTGATGCAAAATATTTAATTGTAATTACAAAGGAACAAACTAAAAATTGG
GAGTTTTTCAGCCAAGTGAAAGTGTTATTCGATTTCCCATTCTTATTTCATAATGTTTTC
CCCTCTATAGAAACATCCATCTTAAAACACTACCTATAGAGGACAAATAAACATACTTAT
TATAGGAAAAAGGAGATAAGTTAAATGTTCTTCCATTGTCACATCACACAGAAATTACTT
GTATTTATGCTGCTGTTACACCTTTTTAGAGTTTTCCTTTATAAATTGCACTAAGTGGTA
TGATGATATGCGAATATTTGCTGCTTTTAGTCTATTCTATTGTATTTCCTAAAGAATTTT
GAAAAATTTGAAAAGTTAACGGTTGTAAATTGTAGTTAAATGAAAAGAACCATGTATGAA
GGCAGATTGATGCTTTTAATATTGTGTGTTCTGTGTTTTAGGTTTCATTCAGAGATTTGA
ACTAGAATTTTTTTTGTTTCCAAATGCAGTGACTAATTTATACTACTAATTCTAGGAAGC
ATTCAAAGCTGTGGAAGATATTCACGGACTATTCTCCTTGTCTAAAAAACCACCCAAGCC
TCAGTTGATGGCAAATTATTATAACAAAGTCTCAACTGTGTTTTGGAAGTCCGGAAATGC
TCTTTTTCATGCATCTACACTCCATCGTCTTTACCATCTATCTAGAGAAATGAGAAAGAA
TCTTACACAAGATGAGATGCAAAGGTAAGAATGTTGTACTTGAAGAGTAGTATTGAAATT
ATGTATCATATCTTCTAAATGAATGGTATAAATTAGGATTTCTCAGCTTCTGTACTACTG
ACATTTTGAGCTGAATAATTCTTTGTTGTAGGGCACTGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNAATACTCTTGGTTCTAGGAGGCATTCTTTATCTGATAGCCAA
CTCCATTAAAAACCCACATGAGAAAATTGAGTATTAGGGGAGAGAGAGAGAGAGAGAGAG
AGACAGTGAACGTTTTATCTGTGTAGATATGTGAGAGACATGAGCCTTCTATGTACAGGT
AGTCTATTCTTAGAAAAAAATTAGAGTTAAGATAATTATTGCATCAAGTTATTTTTTTCC
CTGATTATACAACCCTAACTGTAGAATACAGATGTTCCTTGACTTAGATGGGGTTATGAC
CTGAAGAGACTATTGTAAGTTGAAAAGATGATAGTTAAAAAAAAATCATTTAATAACCCT
AATCCACTCAGCATCATAGCTTGACAGCATAGTGCATTGCAGGATATCCGTAGTTGACTC
TCATGATTGTGTGGCTGACTGGAAGCTGTGGCTCCCTGCCATTTTGAGAACATCAAAGCC
TATACCACTAATTTGGGGAAGAAAATCAAAATTCAAAGTACTGTTTCTCTTGACCACACA
CTACTTTCACATGGTAAAGCCAAAAAATTGTTAAGTTGAAGCATTCTAAGTTAGGCACCG
TTTGTATTTGAGAGTTATATACAAACATGAAAATTTATACGAATACAAAAAGAAGTGTCT
ATAACCTAGCAATTTATAGATTAAATGATTCTTTTTAAAAACACATCATATACAGCTTAT
TTTCTTTCAGTTACTTCTTTTTTTTTCTTTCGGCAGAAAGAACTCTTTACCTGGGTTTTC
TTTTGGGGATTGAACCCTAGACTCTATCACAGAGCTACACAACTCCATACTTCAGTTAAT
ATTTAAAAAGTAATTGGGCACTTCATACGCCACTTATTTCCTTGAATTGGTTGACATTAT
TATTATTTTTATTATTAGGATTAAAACGAAGGGCTTTATGCATGCAAGACAAGCACTCTA
CCAATTGAGCTATATCCCTAGCCTGACCATATTATTTTGGTTTTCTGTAGAATTATATAT
GCCAAATTATTTTTCTTAGAGGTTTATTGCAATGTAAGGAACCAACTAAATCTGTTAGTA
CTTTGCTACTTTCTTTGAAAATCTTGAGGATAGTATCCATTGTCATTCATTGTTACATAA
TTCACTATATCAATAGTGAAAAAACATTTTTCCCTGTAAGATACTGATACTGTCCCTTCA
GGGAGTACTGTAATAGTAGCAAGCATCAAGTTATTTACTTCTGTGTATGTTATTTGGTTT
AATATTCACAAAGACCTTGTGACAAAGTTCAGTATTTTGCCTAAGATTACAATATTGGAA
ACAGTGAAGCTGAGGCCTCAGAGTCTGAATTCATTGACTTTTGTCTTAATGTTTTAGGGC
AAATTCAGCACCCTCCTCACCTGTTGTTTTGGTACTGAGGATTGAACCCAGGGATGCTTA
ACAACTGAACCACACCCCCAGCACTTAAAAAAAAATTATTTTACATATCTCTATATAGAC
ATAGATAAAGAGATGTATAGTGCTGAGAATAAAATCCAGTGCCTTACACATGCCAGGCAA
GTGTTCTACCATTGAGCTACAATCCCTGCGGGTCCCCTACTCCCATGTTATATTTATTTG
GAGACAGGGTCTTGCAGAATTGTGAAGGGCCTTGTTAAGTTGCTGAGGCGGGCTTTGAAC
TTGTGCTCCTCCTGCCTCAGCTTCCCAAGCGCTGTGATCACAGAAGTGTGTCATTGTACC
TGGCATTAATTTTTTTCTCCTTATTGCCATTTATTTATTGGGTTCACAAAATGTGTCTTT
TCTGCCTGTTGGCCGCAAAAAAGCAGCAGCAATAGTGAGTGGGTGGATTGAAATTGTGAT
TCCATGAGTATTAATTTAAGCAGGATCCATTTCTCTTTTTATTAATCCCATATGATGGGA
TAATGTGGGTGTAATGTACATCTTCTGACACTGGCATATCATACTATATGACTAAAGAAA
GGTGATTCTGATCTGCTTTTTCTGCTCATCAAGCAACATTTTGACTTAACAGATTTAATC
TCTTTACCACAGAATGTCTACCCGAGTCCTTTTGGCTACTCTGTCCATCCCTATAACCCC
TGAGCGTACTGACATTGCTCGACTTCTGGATATGGATGGCATTATAGTTGAAAAACAACG
TCGTCTTGCAACATTACTAGGTCTTCAAGCCCCACCAACACGAATTGGCCTTATTAATGA
TATGGTTAGTATCAGTCTGTTTTTACAGCTTTGGACAGAAAACTGATAAAGTTGAAAAAT
TTGTGATTAAGTACTGGGAATTCTGATTAATTGTCAAAAGGATTCTCATTTATGAATAGG
AAACCATTGGTATAAATGGGGTATTTCCAGATGATATTTCCAATAGGTTAAATTGGTGGG
AGCTCTGATATAAGAAGACTTGGACTGGTACTGAGGAATATTGTGGGACACTGAGTCCAA
GGAAATATAACAATGGGCAAGCATAGTCATATTTCAGGGGGCTATAGGAAAACAAAGCAA
GCTGACTCATGTAGCACTTCACATATGGATGATGGGGCCAGAGAAAGGGCAAGCTTTGGA
TCTTTTCTAGACACCTAGACACTTTTTCTATTAAGTTCATTTATATGGTTTGTTTTGGAC
AGCAATTGACTCAGAGCACTAACACTGAGCACATCCCAGCCATTATATTTTAGACAGGTC
TCTATAATCTAGGGCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATGGA
AAAAAAAAAAGTACATATATAGCAGAGATGCAGTTTCCCTCCTCCAGTGTTTCCTACATA
TGGTTGGGTGATGCTGAGGATGTAACTGCCAAATGAATGGAACACTGTCTTGTTGATGGA
CATTTGAGGTTTCTCTAATTTGGGCCTAATAGCAAGTGTTTCCCTAATTTTTGTGATAAT
TTGCACAGATTTTTTGTTGGTAATAAATTGTCTATGGTAGCCATATTTGTGCCAGTATCT
TACTAGGTTGGCTTAGAGTTATTTCCTTTTTAAGTTATTTTAAGTTATTTCACTATAGAC
AGATGTATAATGTGGGGCAAGAAAGTCCCCTGGGTTATAGTTTAGATAGATTTAGGTAAA
CTTTGGTAAATTTAAGGGGGTTCAGGCTTTACAATCTTCAAATCCATTTTACAGATTTCT
GACCCCATTGTTTTCTCTAAATTTATACCCCATTAGACTCCTAGTGGAAAATATGCTGCT
GTTAAACCTTTTGCTTTGTTTACTATAGGTCAGATTCAATGTACTACAATATGTTGTCCC
AGAAGTAAAAGACCTGTACAACTGGCTGGAAGTAGAATTTAACCCATTAAAACTCTGTGA
GAGAGTCACTAAAGTAAGCATTTGTCTTTACGTTTTGGTTTTGATGCCATGTAGCCGGCA
TTATTACAGTTTCGGGTTGTATTTATCTTTGTTAAAGATAAGTATTATGTTTGAATCAGT
GCACATTTCATTGTCTTTTTTCTTTTATATCAAGAGAAAAGATATTTCTGATGTGCTAAA
CAAACGTGGAGGTAAATTAGCAGCATGACTGTCTTAGTCATTGCTGTCAGTCACCTTCAG
ACAAGTATCAAAAACCTTCATGTTAAATTTTCTATTTCTTTGCATTTTATGATGTTTTTG
TGTATTGAAAAATTGAAAGCATTTCAGATATTTCAGTATTTGTTTCCTAAAAGTATAATT
CTTTCTAATTTAATGGATTTTGTAGGTTTTAAATTGGGTTAGGGAGCAACCTGAAAAGGA
ACCAGAGTTGCAACAGTATGTGCCTCAACTGCAGAACAACACCATACTCCGCCTTCTACA
GCAGGTAAAAATACAAATGCATGTTTTGTGGAGAAAGTGGAATTTCCTTTTTTGAGCATT
TCTAGCATTTACTGGAAAAATTTAGAATTGCCCAGGAAGTGAAAGCTTTCAACAGTCCTG
CCCCCATCCAAATTAGTCTGATTTGTTTTGAAAACAAAATGAAACAATGTTTACTTACTT
TCTTGTTGAACCCTATCATTTTGCATTTTTCTTATTACTAAAGTAGGGTTTGTTTGTTTT
TAGTACCAGGGATTGAACCCAGGGGTGCTTAACCACAGAGCTATATCTCTAGTCCTTTTT
TATTTTGAGACAGGGTCTCATTAAGTTGCTTAGGGCCTTGTTTAGTCTCTGAGCCTGGCT
TGGAACTCTCAATCCTCATAATTCAGCTTCCTGGTTGCTGGGATTACAGGCCTGCACAAC
CATACCTGGCTAATGTAGGGCTTTCTTATTTCTTTCATACCTATGTGTTTTTTTTCATAG
CCAGGCGGTATCATGGTGTACTTATTAGTGAAAACCTGTTTTTATAGGTTTTTTCCTGTT
AGAAAATGTCACAGCATTGTGCTTCTTACATATACCTGTCTTTCCATGTGCATGGGATTT
TCTTTAGCATAAGTAGTGGAATTGTCTTACACAGTGACACAAATTTTCAACCAATTCTTA
ACAAGAAGAGAGAATGTGACAACCTTTCTCTTTGTTAACACTTGTTATAGTACAGTTTAA
GTCCAACATCTTGAGTAAGTTGAAATGTTACTTTTAGTAATAGCTAAATGTTCTTTTTGG
TTTTCATTTGGTGAAGGATTCTTTAATTATATATCCCCTTAAGTATATGCACATTTCATT
GACCTGCTTTCCTTTGTATATGTGAGCAGTGTTATTTCTTATGTGCTACACAAATAGTTG
AAGGTTAATTAGCAGAATAACTATAAATAGTAATGCTGCCAGTCTCCTTTCAGACAAAAA
ATTTTACAAAAGTGTTTAAAGGTACTAGATGAATAGTAATTCTTAATGATAAATATGTGA
GCTTTTGTATGTGTATGGTGCCGGGGAATTATGTGATCAGTTAATTTTGTTTTATGAAAC
TAGGATTTCAAAAGATGACACACTTGAGGAGTAGTATAATATGATTTATAGCATAGGAAT
ACGGCTTGATAGTTCGGAAAATGTACTGTGAAAATAACAGGTTCAGTTTTGTGTTTTTCT
GAACAGTTGGGTGTCATGACATTGCACATCAAAAGTGCTGAATAAATGGCAGCTATTATT
ATCAACCCTGTGTTTTTTATGCAGGTGGCACAGATATATCAGAGCATTGAATTTTCTCGT
TTGACTTCTCTGGTTCCTTTTGTTGATGCTTTCCAACTGGAACGGGCCATAGTAGATGCA
GCCAGGCACTGTGACCTGCAGGTATGTACTATAAGGGGACATTGAGGTGGGCAGAAGTTC
CCTGAGGACTAGAAAGATATACACCTTTTGTTTTTTTTGCTTCTGGTATAATGGTGCCTT
TTTAAAAAAAACTACTTTTTTATACTTAGCATTCTTGTTAACTTCTTAAATTCAGTTGAA
TTTTATTTTTATCAAGATACTTGTCGAAATCATTATTAAATCATAATTTAATTTCCTAAG
GTTCGTATTGACCACACTTCTCGGACCCTGAGTTTTGGATCTGATTTGAATTATGCTACC
CGAGAAGATGCACCAATTGGTCCTCATCTGCAGAGCATGCCTTCAGAACAGATAAGAAAT
CAACTCACAGCCATGTCCTCAGTGCTTGCAAAGGCACTTGAAGTCATCAAGCCAGCATCA
TATACTGGTATACATGTTTTTTTGGGGAAATGAATTACCCANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTGAGAAAGAGGAATTGGAACAAAGGGAAGCTGAACTTCAGAAAGTACGC
AAGGCTGAAGAAGAGAGACTGCGCCAGGAGGCAAAAGAGAGGGAGAAGGAGCGGATCTTA
CAAGAACATGAACAAATCAAAAAGAAAACTGTTCGTGAGCGATTGGAGCAGATCAAAAAG
ACAGAGCTGGGTGCCAAAGCATTCAAAGATATTGACATTGAAGTATGTAGAATATCACTC
ATTAACAACCGAGTTTGACCCAGGTCTTCTGTTACTTTTGCAACCATAGTCGTTTGCCAT
TACTTGGTTTATTTTGGGGTTTTAGGATATTTCATGCATTTTGTTACAGCTGTCTTGGTG
AGTTAATCTGAGAGTAAGCATTTGATTTTAATTGGTCCATGCAGTTTGTAACCTGTGTCT
TCATCTGTTGGTAATTTGGGTGGATGTAAAGTGGAGGAGGCAGAAAGAGATGTTTTAATT
TAGGATTTAATTTAGAAAGCAGTGTGTCCTATTGATTGTTAGGTATATTGATTGTTAGGT
ATTTCTTTTATGTTTATATTAATGATGGTACATTTGAATTACCTTTTAGGATCTTGAAGA
ATTGGATCCAGATTTTATCATGGCTAAACAGGTTGAACAACTGGAGAAAGAAAAGAAGGA
ACTTCAAGAACGGCTGAAGAACCAAGAAAAGAAGGTAAATGAAAGGTCCAGTAAACTTTC
AACACAAGTTAAAAGAAACTGGGTATAGTGGTATACACTTATAATTTTACTTAGGAGGCT
GAGGCAGAAGAAGGCCAGTTTGGGCAACTCAGCAGGAATCTATCTCAAAATAAGGGCTAA
GAAGGTTTGGTAGAATAGTTGTCTATTATATATGGGTTCAATCCCCAGAACTGGAAAAAA
ATGTTTATAAAAATGTTAACAACTGAATTTATTTTCATGCCATTCAGATTGACTATTTTG
AAAGAGCTAAACGTTTGGAAGAAATTCCTTTGATAAAGAGTGCTTATGAGGAACAAAGGA
TTAAAGACATGGATCTGTGGGAACAACAAGAAGAAGAAAGAGTAAGTTTTTCATTTAACT
AATGTTTTTGGGTTGTAAACTGTAATAAAACCTTCTGCCCTTGATGGGATTAGGGTTTCA
CAGTTGACTTATTTTGTTAAAAATGGTGATTTAATATCTGCTTACTAACAGATTAATGGA
AAGTAGAAATTTTTACAGTAGAAGGGAGTATGGTGTTGCACGCATGTATTCCTATTTACT
TGGGAGGCTAAGGCAGAAGGATCTCAGCTACTTTGTGAGACTCTGTCTCAAAATTTAAAA
AAAAAAAAAAGGGTTGGGGAATTATCTAGAAGTAGAGCACCCCAGGCTCAATCCCTAATA
GCAAAGAGAAAACGAGGGAAAAAGGAAAATTCATGGTCTAGATTACAAACGAATAACATA
AAGAACAACTGGAATGCTTATTTAAAAAATAAGTTTATGTACACTTTATTTTTAAATATA
TATATATTTTTTTAGTTGGACACAACACCTTTATTTCACTTATTTATTTTTATGTGGTGC
TGAGAATCGAACCCAGGGTCTCGCACGTGGGAGGCGAGCGCTGTACTGCTGAGCCACAAC
CCCAGCCCTTATGTGTGTGGCTCAGCGGTAGAGCGCTCCCTAGCATATGTGAGGCCCTGG
GTTCGATCCTCAGCACCACATAAAAATAAATAAATAAAGATATTGTGCCCCAACTGCAAC
TAAAAAATAAATAAATATTTAAAAAACGTATCTCATAAAAATTTCTGTTATCATGCTAGT
AAATAAATCCTATCTCTTAAATGATAGCTGCCCCAGGACTCCTTGTGCCTGAGTGCCTTC
CTGGGGACCTGTGGACAAGAATCATAGTTATCATGCCACTTTTATGGGAAGATGGAAGAA
GGAAGGAAGTAGTCATTGCTAATTGTTCGAGAATGTCTGGCAATTTGTTTGGAGTGATTT
AGTAATCAGTAATAAATACTTTCAAATTTAACTGTATTGTGTACTTGCAGATTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNATCTTATGCCATTTAGCTGGTTTATAATTTCCTTCTACTGTATGCATCCT
GTTTATTTAACACTAGAAAATTAGGCCTAAAACTAGGGGAAAAGGTGCTGGTGAGAGGAA
CACTTAGTAACCAAATAAATTATATAGAGCGAGAAGAAAGAGAGAGAGCTGAGCGTGCCA
AACGTGAGGAAGAGCTTCGAGAATATCAGGAGCGTGTCAAAAAACTAGAAGAAGTAGAAA
GGAAAAAACGTCAAAGGGAGTTGGAAATTGAAGAGAGAGAACGCCGCAGAGAAGAGGAGA
GAAGACTTGGCGATGACCCACTTTCTAGGAAGGTGAACACAGATATGATTTTCTGTTGTA
ATGAGTTTCATGTTTGTCAGCTAACGTTCTTTTTTTTTAATTGCTCAAAACATTACAATA
ATCTTGACATATCAACTGACGTTCTTGCATGATACCTAGAAGGTGACGTGACACAAATTC
TCTCTTGGGCAGAGATAAAACAGTCTGCATCAGCTGAGAGCTTGTCCAGTCCCACGCCCA
AACCTCATGATTCAGAATCTGCAGTTTAATCAGATTCCTAAATGATTCAAACACTATTCT
AAATATTTATAATACATATTGTCAAACTGACCTGTATTCTCTCTACAATCTTGTGTCTCA
TGAATTTCATTTCCTGATTGATTTTATGTTACCCACTTAATCAAAGAACTCTTAAGCTTG
TTCATTGTGTCCCTACATTAGGCCTCTCATGGTTATTGCGTATTTCACTAGTTTCTACTA
TCACCATTTTTTTTATTGTAGATGGACACAATACCTTTATTTTTAACTGTTTTTATGTGG
TGCTGAGGATTGAACCCAGTGCCTCACATGTGCCAGGCGAGTACTCTACCACTGAGCCAC
AACCTCAGTCCTACTGTCACCACTTTCTTCTCTTTCTGCTTTATGTATCTGATGCCTGTC
TCTGTATTCTTCCTTTTCCTTGGAATGTGCCCACTTTGTTCTTTAGAGAAAACATTGTTT
CAACATTTTCTTTTTTTTTTCTTTCCTTTTTTTTTTTTTTTTTTGGTACCTGGGATTGAG
TGTAGGGGTGCTTACCGTTGGACTACATCCCCAGCTCCCCCACTTGTAGAATTTTTAAAA
AAATATATATTTTTTTAGTTGGCAGTGGATCTTTTTATAATTTTTATTTTTTAAATATCT
TTTTTAGTTGTTGATAGACCTTTATTTTATTTATTTACACATGGTACTGAGAATTGAACC
CAGTGCCTCACTCAGCTAGACAAGTACACTACTGTGCTCAGCCCCAGTTCCAACCCCTAT
AATTTTATTTAATTACATGCAGTGTTGAGGCTTGAATCCAGGGCCTCACACATGCCAGGC
AAGTGCTCTACCAAGCACTCTATCACTGAGCCACAACTCCATCCCTAATTTTTAATTTTG
AGATAGGGGCTCATGAAGTTGCTTAGGACCTCACTAAGTTGCTGAGTCTGGCTTTGATTG
AATTTGGCAATCCTGCCTCAGCCGCCTCTGTTGCTGAGGGTATAGGTGTAGGCCACTGCA
TCTCCTGGGTCAACTTTTATTTTAAGAGAAATAGCTTGGCATGGCATTCTCTGTGCCACA
CCTGTATTGGATGCTTCTCTTTATGGAAGGACCTCATGCTATTACAATATGGTCTTTACT
TTTATAATGTATATGGACAGAGTTTTGGGGCCCCGCCCCCAGATTGAACCAAAGGGTATT
TTATCTCTGACCTACATCCCCAGGCCTTTTTAAATTTTGAGACAAACTCACTGAGTTGTA
TAGGCTGGTCTTGATTTAATGATCCTCCTGTCTTAACCTCCCAGGTTGCTGGTATTATAG
GCATGTGCCACTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCCGCTGGCGAGCTCTCTACGCTGAGCACAGCCCCAGCCT
AGATGCTTTTTTTTAAAAAAAAATTTATTTATTAGTTTTAGTGTAGATGGACACACACAA
TGCCTTTATTTTTATGTGTGCTGAGGATCAAACCCGGGTCCGCCCGTGCCAGGCGAGCGC
TCTATCGCTGAGCCACAATCCCAACCCCCCTAGATGCCTTTTTATTCCTTAAAAATTTCT
ACAGTTTTCTTTATCCTTAAAAAGAATTTAATCATTTCACTGATGATGTTAGGCTCATTG
TGATTGGTCTTTTTTTTCATATTCACTGTTGGCATTTTTACTCTTAAAATCAGAGGTATA
ATTCTCCTTAGACAAGATAAGATTATATTAACTTAAGGAAGTTTCCCTCCCTTTTCTCTT
CAAAATCTCTTTTGTGTGGTCACTTTAACTATCTATTTTAGTGCTGGGAATTGCACCCTG
GATGCTTCACCACTGAGGCATATCCTCAACCCTTTTTTGCACTTTTTCTCTTCTGAGACA
TGGTTTTGCTAAGTTGCTTAGGGCCTTGCTGAGTTGCTAAGCCTGGCCTTGAATTTGTGA
TCCTCCCTCACCTCCTGCATCACACACTGTTACACATGTGTGCCATCATGCCGGCTGTAC
CCTGCCACCTTTTGTTATTGTTGTTTAAGGCAGGGTCTCACTAAGTTGCTAAGGCTTGCC
TGGATTTTGTGTTCTTTGTGCGCTTCATCCTCCTACCTAGCTGAGATTACTATTAACTGT
GTACCAACATTCCTGAATTGTCTTTAAAAATTTTTCTTTTGCTTTTTTTTTTTTTTTTTT
GTAGTAAGTTGTCTGAAATTCCTTTATTTTCATTAGCATGGCCCATTCCATTATTTGCTC
TACTGACTTTAAAGTATTTGTGGTCAGTCCTGGTGGCACATGCCTATAATCTCGGCTACT
TAGTAGGAGACTCAGACAGGAGGATTGCAAATTCCAGGTCAGCCTGGGCAAATTAGCTAG
ACCCCATCTCAAAATAAATAAAGATGGGGATGTAGCTCAGTGTAGGGAGAATACTGCTGG
ATTCAGTCTTAAGTACCACCCTCCTTGAAAGGGAATTGAGGGGGGCACAATATCTTATTC
TTTGTTTTGCATAAAGATGACAAGAGTAAAATAAACATTTGAAAGATAAAGAAGAGCACC
TTGAAAAGGCAAAGTTGGAAAAAAGATGAAAAACATCTTTAAAGGAAATGTGAGGAGTGG
GAGAAATGTGGTCTTTGGGTATGTATGTCCCCCTCCATTGGAGTGACCATGTTAGTTACT
AGTTACATTGACTTTTTAATTTGTGTCCACTTGGGAAAGTCTTGGCACAGCCTCCCTCTT
AATAGGCTAGAGTCATCCATGATAGCAGGAAAACAATTATTATCTGACTACATGTATCCT
TCAGTGCTTCTCATCTATAGGCTGTATCTTCCAGAGAGCCTTACATACCTAATTATGGCT
GAAGGTTATGTTGTAGGAGCAGGCAAGCTGTGTCAGAGGGTGCTCATTGAAATGTTGTGC
CAGATTTTTAATGAAATACCAATTAAATATCTCCTGACACCCTTCCCATGATTTTTAGTG
CAGTGCTTTCAAGAGAGAAACACTGTTAATCTAACCATTCTCTTAGACATTTCATTTATT
CTACTCTTTTTTGCATGTGCTCAGTAGGAACTGTTTCAGAGTACTTGTTTTGTTTTTTCC
CCCCACATCATATTTTTCAAAAGGGAATTTCTAGGCCAGTGGTAATCTGTAGATCTCTCA
GGTGCTCCAGATGTGTACTCTCAGGGTGATTTCAAGTGGTGTTTTACCAGCTTATAAAAG
CCATGTACAATATTTGAGAATATTAGTTTGGTTGTACTGTCAGTCTGATTGCAAAAAAAA
AAAAAAAGAAAAGAAAATTTTAAGACATGCTTATATTTAAGGGCTTGAGGTCAAGATTGA
CTATGTTTGGTATTACCAGTAGTTGTCCTTATGAATCATTGTCACTGTGGTGCTTCTTGT
TTGCTTTGCTTATGCAGGATTCTCGTTGGGGAGATAGAGACTCTGAAGGCACGTGGAGAA
AAGGACCTGAAGCTGACTCTGAGTGGAGGAGAGGTCCACCAGAGAAGTAAGTAGAGTCAT
AGAATTTTTGTTATGGATCCTGGTAATACTCCATCGGGGTGTGTGTGTGTGTGTTTTTCC
CTAGTACCTAGGATTATTGAACCCAGGGATACTTGGCCACTGAGCTACATTCCCAGCCCT
TTTTTATTTGAAACAGGGTCTTGCTAAGTGGCTTAGGGCCTCACTAAGTTGCTGACACTG
GAACTTGTGATCCTCGTACCTTGGCCTCAAAGGATTACAAGTGTGTGCCACCATACTTAA
CATCTACCAGTGGTTTTAAAAATAGGCTTATTTGTAGGGATGGAGAAAGGAAAAGCTGAG
AATTATTATCATGCCTGATTCTTTATTTCAGATTTGTTAAATAGACGTAGCTGTCCTTGA
AATAACTTCTAGTGGTAGACAAGAATGCCAGCTTTTTAGTTTCTGTTCAAAATGTAAGTT
AAGAATAATCATTATAAAAGATTAGAAATTGCCAAGGTTCTTGTTTCCCCACTTTGCCCC
GCCCCCCTTTTGGTATTGGTGATTGAACTTGGGGATATTTGACCACTGACACACATCCTC
AGTCGTGTTATGTATTTTATTTAGAGACAGGATCTCACTGAGTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1031, 7950..8140, 8287..8399, 8401..8424, 8795..8958, 10800..10999, 12295..12503, 14772..14943, 16168..16272, 16645..16743, 18024..18140, 18360..18535, 18537..18546, 18654..19001, 19369..19473, 19727..19840, 20810..20932, 21524..21677, 22407..22591, 27077..27163
1001..1031, 7950..8140, 8287..8399, 8401..8424, 8795..8958, 10800..10999, 12295..12503, 14772..14943, 16168..16272, 16645..16743, 18024..18140, 18360..18535, 18537..18546, 18654..19001, 19369..19473, 19727..19840, 20810..20932, 21524..21677, 22407..22591, 27077..27163
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved