Spermophilus_tridecemlineatus Locus SLC25A3
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SLC25A3
Spermophilus_tridecemlineatus
SLC25A3
GeneScaffold_5931
SNORA53
9898..10098
12934
CTGAACTGAGTCTAATGAAGATTTTATAAATGTATTTTACACACACACACACACACACA
CAAATCAGCTATCACTTTCACTCTAGCACAGTTCTGTTCCCCCATGTGTTAAGCATTTAT
TGGGTATTTTAATATGCTTTGTAGACTCCTATGATAAAGCAACAAGCTATCTTTGTCTCT
TTTTAGAGTTCCTGCTGCACATTTTCTTTCAAAATATTCTCCCTTAGTCTAATGAAAAAT
GAGACAGGCATATGTTTAATGTCAGTGAATTAAACTTTAAAAAAGGAAGTACTAGAATGG
CAGAAGTTGTAATGTCCCAACTGCAACACCTACATAATATAGTCAAGCATTTATTTTATT
TTTTAGGTGATCACCATATAATGGAAACCAAATGTAAAGAACTGAACTCCTGGAGTCAAG
GAGAGACACCTGAAGGTGAAGGGACAAAGAGTAGATCACGAGTCCTAGTTAAGCACAACT
CAAACGCCCAGCCCGGAATGCGCGCCTGCGCAGTACGAATCCTCCTGCGCACAAGCTGGG
CCGGAAGGGCTGAGGCGGGCGGGGGCGGGGATAGAGTTGCTAGGAGAACGCGATGACGCT
ATGGGCCCCCCCGCTCTTTTCTACCAATAGGCGACGCGTGCCGCATTGACGCGCTGAGTG
CGTCATGCTGACGACGCGCGAAGGGCACGGATCTGAGGACCCTTTAGGACATTCGGCCTC
TATGAGCCGCAGCCTTTCCGAGGGAGCGGTCGGGTGTTCGCCATCTTAAGGAGTGAGTGT
GGTTCGGCCTTCCCCGCGGTGGGTGTTGGGAGCGGATCCTGGAGCCCCTATGGGGCAGCT
GCTTGGCAGTAGGCCCGGTTGGGCACGGCCTCTTAGGGAAGGCGCCGTGACCTCCTCAAG
GGCGCGGAGGCGAGAAGGAAGAAGGCCCCTCTTTGGGTCCCAATGACATTGACGGGCTCC
TTGCCTTTCCTCTAACCGCCGCTTCCTCCTCTCTTAGGAAGATGTATTCGTCCGTGGGTC
CACCTGGCGCTGGCGAACCCCTTCAACGCGCCACACCTGCAGCTGGTGCACGATGGCCTC
TCGGGGTCCAGCAGCAGCCCCACCGGGCCCCCAGGCCCTCCTCGACGTTTCCGCAAACCT
GGGCAGCTGCCGCTGTGGAAGGTGAGATCAGACAGCCCCGATGCAGTTGTCAAGGCCACT
GTTGCCCCGCTCTGCCTTTGAGGCCTGGGCCTGCCCTGGAGGACAGGGAAGGCGCCAGCC
CGTTGCACCGCAGTGTATGGCACCACAGTTGCTTGCCCTGGGATGTTACTCTTTTGCCCG
GTAGGCTGGTGTCGGATCCTTGGCCTCCCCTCCCTCAAGGGCGTGGAAGGGTCTAGGCCC
AGCGTCTTTCCGTGACCTCTCTGTCCCCAAAGGAATAGAGGCAGACAGGCTTCAATAGCT
TCTTATCTTTTTTTTTTTTGAGTCTGCCTGGTCAGCAGACTTTGGGAAAAGTCTTCTTCC
TAATCGCTGCCCACCTATTGTTCTAACTGTATCACCTGTTCTTTAATTTGCCTTTAATTT
TCTTAAAAATATTCTTCCCCAACTCATATTTCCCAAGCTTTAGTTAATGCAGGGTAAATG
ATCTTTTTTGTTTTAATGCTACTGGTGGAGAAGGTGACTTATGACCCCAGGTAGACAGAG
GAGATAATTTGGGGGCATCCCTTTGGACTTATCTCTTGGGATTCAGGGGGTGGGCCCAGC
TCTAATTTAATTGTGTGTGTTTAAATTCCCAGTGAGCGTATATACGGGAAAAACTCTGAA
AACCGAATTGAGGAGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCTCCAAAGAGTAAGCAATCTATTTCAGGTCATAGGTTGTTT
TAGAAGAGACAGGATGAGAAACAAAAGCATTTCATAAAATTTCAGTGCTCTTTTCCTTTT
GCAGTGTTGCTTTCTAAATAATTTGGATTGAGGTTCACTTCTTTGAAAAAGGAGGATTCT
GGGATTCCTTTGTGTAGGGCTAACTATACCTTGCAACCAGATATTCAAAAAATGTTCACA
TTTGGTTCATGAAGTTACAACTTATGAGATACAACATATATTAAGTCTCATATTGTGTGT
TATCTAGGGACTGACTGTGTGATAAATACAAAGGTCTGAAATTATCACTTAAATTGAAAA
TAGCCAATGCTTCAGCAATTTACATGCCTCCTTATGTTTTGTTTTTTAGGAGAACGCCTA
TCTCTGGCGCACATCACTGTATTTGGCTGCTTCTGCCAGTGCTGAATTCTTTGCTGACAT
TGCCCTGGCTCCTATGGAAGCTACTAAAGTTCGGATTCAAACCCAACCAGGTTATGCCAA
CACTTTGAGGGATGCAGCTCCCAAAATGTATAAGGAAGAAGGCTTAAAAGCGTAAGTAAA
CACTTGGCTAAAAATACTTTCATTGTTTAGCATTAAGCCCAGCAGACTTACTGTCTCTAT
TATGTTATTTAATGTTATCTTTTTTTTTAATATTTAATTTTTTTTTAGTTGTAGTTGGAC
CAATACCTATATTTTCACTTATTTACTTTTATGTGGTGCTGAGGATTGAACCCAGCATCT
CGCACATGTGAGGTGAGCGCTCTACTGCTGAGCCACAACACCAGTCCTTAATGTCTTATT
TACCCATGTCTAGAACCTAAATTCTAGGGGCAAAAGTTCTGTTAGTACATGGTTTGAGCC
CTGAATTAAGCCCAAACACTTACTATTTGGCCAAATATTTACTATTTTGCTTTTGAGAGA
ACTTGTTAGAACTCATGTGATCCATTCATAGTTAAGAATTTGCCTGTAGTCAGGCCACAA
CATGCTTCCTTAGATCCACCTTTGTGGATGAGTCTTGGGCTGAGTTCTACTTGTAAACTT
TCTTGTTCCTGTAGTTTCCAGTCAAAGAACATCCGGCAACTTTTTTGGTTGTATAGTCAA
AGGTGCTGAGTCATGGCATGTGAGATCATATACCTGCATGCTAGTCTCAGGTTCTGATGG
GAATTGGCATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGTTTG
CCTGCTTGAACGTTCTGCTGCAGCATTGTACAAGTTAGTGGTCCTTAGCCCCGAAGTGCA
TGTACAAGAGCAGCACAGCTGGTTGTAACGTTTTGTGGCAGTTTACATTAGTAAGAGTTA
TTTTGTACACATTTGTCTGTGAAATCAGGGGCTAATAACTTGTTCTCATTAGTGACCTCT
TCTGTGAGGAAATAGTATTCCAAAGGTTACAAAGCGGTTTTATCTTCCCATAATGGGATG
AATCCTTTGGTCTTTTTTTTTTCTATGGTACAGGATTGAAATCAGGGGCACTTAATCACT
GAGGCACATCCCCAGCCCTTTTTTAGAGATAGGGTCTCACTGAGTTGCTTAGGACCTCCT
CAAGTTGCTGAGGCTGGCTTTGTAATCATGATCCTCCTGCTTCAGCCTCTAGAGCCGCTG
GGATTACAGGCATGCACCATTGTGCCCATTTTCCCATAACATTTTATATGTCCTTTTGGA
TTCATAAGTACTTTCTAACTAATCTAAAAGGATTGTTTTATGGTTAGACTTGGGAATATA
TGTATTGATCTGCACCATTTTACAAAAAATTTATCAAAAACTGTTTTTTGGGTACCTGGG
ATTGAACCCAGGGGCGCTTTACCACTTGATCACATTCCATCCGTTTTCATTTTTTATTTT
GAGATATGGGATCTTGATAAGTTGCCATGATTACAACAGATTTTTTTTAAAAGAGAGAAT
TTTTAATATTTTTTAATTATTGGTGAACACAACATCTTTGTATGTGGTGCTGAGGATCGA
ACCCGGGCTGCACGCATGCCAGGCGAGCGCGCTACCGCTTGAGCCACATCCCCAGCGACA
ACAGATTTTTTTTAAAGATATTTATTTTTTAGTTGTAGTTGGACACAATACCTTTATTTC
ACTTATTTTTATGTGGTGCTGAAGATCGAACCCAGGGTCTCACACATGCGAGGCAAGCGC
TCTACCGCTGAGCCACAACTCCAGCCCACAACAAATTTTTAATAAAGAGGAAGTATTGAC
TAAAATCTAATAAAAACTGAAAGAATTGTTCATTTTTACATAGAATAGACTGCTTTATAA
TCTCACCAGTCTCACCTGAATTCTTTATTTCTTTCTCCTTTTTTTTTTTTTAATAATGAG
GGTCTCACTATGTTGGCCGACATCTTGAACTCCTCGGGCTAAAGAGGAGCCTCGTTCCTC
AGCCTCTCGAGTAGTGGGACTATAGGCCTATGCCACCATGTCCAGCTAAAATCTGGGTTT
TCTAAATAAAATTATAAGTTTATTCTCAGAGGCATGGAAAAGGGAGGCTGACTATGATTT
AACTTTTTTTTAACTGATCCATATTGAATCATTTATCTTGACTTTTTTTTTCAGCTGGAG
TCTTTTGTGCAATTGTTTCTCACCCTGCTGATTCTGTAGTGTCTGTGCTGAATAAAGAGA
AAGGTAGCAGTGCTTCTCAAGTCCTTCAGAGACTTGGATTTAAAGGTAAGGTGAATTTTT
TCTCCTTGATTAGAGAAAGAACAACACTTGGGTATATTGCATTTTTTTTCATTCATATTT
CCTGTTTGAACCAGGTGTGTGGAAGGGACTCTTTGCCCGTATCATCATGATTGGTACTCT
TACTGCACTACAGTGGTTCATCTATGACTCTGTGAAGGTCTACTTCAGGCTCCCTCGCCC
TCCTCCACCTGAGATGCCAGAGTCTCTGAAGAAGAAGCTTGGGTTAACTCAGTAAATAGA
ATCAAAGTAAATGGACTGAATCTGCTTGTTGATCAGTGTTGAAGAAAGTGCAAAAGGAAC
TTTTATATATTTGACAGTGTAGGAAATTCCTGATATATAATCACTGTAGGACCCTTTGCT
TAAGGCAAGAGTTTCAAACTTTAACTGCTGAAATAAACTCCATCTGTTCGTGATTTATCT
GTGAGAGTTGTTTTTTTGTTGATGTTTGTATTAAGGAGTGAATCCAGGAGTGTGCTGCCT
CCTCAGCTACTACCCCTGGCCCTTTTAATTTACTTTGAGACAGGGTCTTGCTAAATTGTC
TGTCTGGCTTTGAACTTGCAATCTTTTGCTTCTGCTTCGGCCTCTGAATTTGCTGGGATT
ATAGGCATGTGCTACTGTGCCCAACATGTTAATAATTATTTTAAAAGTATAGTGTTTTTA
AAGATTTAACCCTGAAATAGTTGGAAAGAATTAAGTATGAATTAAGACTGCCTGGGGGAA
AAAAGCAAACTAACTATTGGTGGTTGACTAGTCTGTATTTATAAAGTGTCGTGTCTCAGT
TTTTATTTATTTATTTATTTATTTATTTATTTATTTGTAGTTGTAGATGGGGACAGCATG
CCTTCATTTTATTTGCTTATTTTTTTATGTGGTGCTGAGGATTGAACCCAGTGTCTCACA
CATACTAGGCAAATGCTCTGCCACTGAGTCACAACCTCAGCCCATGTCTCCAATTTTCTC
ATTCAAAAAGTTCCATTTTAAGGAGACATTCTAAATCTTCAAAAATGTGATTTAGTAGTT
AGATATGGCTATTCATTTTTGGTTTATTTTGACTAATTTCAGCATGAAATCAAATTTTCA
CAGTCTGTACTATTTAAAAAAATTTTTTTTTCAGTTGTTATGAACCTTCTTTATATGCAG
TGCTGAGACTCAAACCCAGGGCCTCACACATGTGAGGCAAACACTCTACCACTGAGCCAC
AACCCAGGCCAGCCTGGAGGTTTTTTTTTTTTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1016, 1018..1135, 1138..1160, 8393..8517, 8618..8797, 9289..9470, 10138..10204, 10207..10239, 10242..10244, 10248..10292, 10294..10309, 11574..11684, 11774..11934
1001..1016, 1018..1135, 1138..1160, 8393..8517, 8618..8797, 9289..9470, 10138..10204, 10207..10239, 10242..10244, 10248..10292, 10294..10309, 11574..11684, 11774..11931
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved