Spermophilus_tridecemlineatus Locus EP400
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus EP400
Spermophilus_tridecemlineatus
EP400
GeneScaffold_5169
SNORA49
52254..52380
62807
TGCCCACTATGCCGGGCAAAGGCAGTGGTGGTACCTGTCCTCTGGCCACCCACTTGGCC
TACCTGGGTGATGTAGCATGCACAGCAGGCATAGTGGGCAGGAGGACGGCTGGCCCAGTG
GAGTCGTCATGTGTAGCCACCACCAGCCAGGGGCTTTTTTTTTTCTTTCTTTTTTGGTAC
CAGGGATTGAACTCAGGGTCCCTCGACCACTAAGCCCCAGCCCCAGCCCTATTTTGTCTT
TTATTAGAGATAGGGTCTCACTGAGTTGCTTAGAGCCTCGCAAAATTGCTGAAGCTGGCT
TTGACCTCAGGATCCTCCTGCCTCCATGTGCCTCCGCGCCCAGCCTCAGGGCTTCTTGTC
CTCACCACGGTGGTGACTGTCTCAGACTTGCTCAGAAGGCTGGCACTACCCTGGTGGGGC
CCCTTGCTGCCAGCTTTGTTTCCAGCACTGTCGCTGGTCTGTACTTCGGGGCAGCTCAGG
CAGCTGGGTGGTTGCTTGATGGTCCAGCCTGGGCCAGCTGGTTGACTACCAGAGGCTTGA
CCTGCTGAGGGAATAAGGAGAGTGCTCGGGCAGTGGGACCAGGTGACAGAACCAGGAGAT
TCCTTTTGCCTCAGCATGGGGTTCAGTGCTGGAGTTTCTAGGTCTTTTCTGAAGTAGGGG
ATTTCTGCTTTCTTAGCCTCCTGTTGTTTTGGGGTGGTAGGTGGGGGGCGCACCTTCTTC
CCTTTTTTTTTCTCTCCAGCATCTTGAATAACTGGAGGAGAGCGAGGAGAGGGAGTTGTG
GGCAGTGTATATGTTGTCTCCTGGGACTCTTTTGGTGTGAGGTAGTGAGATGCCTTGTTG
GACTCAGATGACAGTGGGAGCATCCCTCAGAGTGGCCTCTTCTGTGCTGCTCAGGAACAG
TTCTTTCAGTGGTGGTCACGATTCCATATTCTTTCCAGTGACTCAGTTCTGACTTTGCTT
TTCTAGGAGGACGGTACATTGGACTCCAGAGGGAGGTGACGATGCACCATGGCAGTGGTC
CTCAGAACGTCCAACATCAGCTGCAGAGGTCCAGGTCCTTCACCGCCAGTGAGGAGGAGC
AGTCGGCCCATCCAAATCTGCCGCCATCCCCTGCAGCACCCTTTGCTCCGTCGGCCAGCC
CGTCTGCCCCCCAGTCCCCCGGCTACCAGATACAGCAGTTGATGAGCAGGAGTCCTGCAG
CTGGGCAGAATGTGAACATTGCCCTACAAAGCGTGGGCCCTGTGGTGGGAGGAAACCAGC
AGATCACGCTAGCCCCTCTGCCGCTGCCCAGTCCCACCTCTCCAGGTTTCCAGTTCAGTG
CACAGCAGAGGCGATTTGAGCATGGCTCTCCTTCGTACATTCAGGTTGCGTCCCCCCTGT
CCCAGCAGGTGCAGACACAGAGCCCTACGCAGCCCAGCACCGGGCCTGGGCAGGCCCTGC
AGAATGTGCGTGCAGGGGCCCCTGGGCCTGGGCTGGGTATGTGCAGCAGTAGCCCTACCG
GAGGCTTTGTGGACGCCAGCGTGCTTGTGAGGCAGATCAGCTTGAGCCCGTCCAGTGGCG
GGCACTTTGTGTTTCAGGAGGCTCCAGGCCTCACTCAGATGGCCCCGGGGGCCCAGGTTC
AGCTCCAGCATGCTGGAGCGCCCATTGCAGCACGAGAGCGGAGACTGTCCCAGCCTCACG
CACAGTCAGGAGGCACCATCCACCACCTGGGACCCCAGAGCCCTGCAGCTGCTGGAGGAG
CCAGCCTGCAGCCCCTGGCCAGCCCAGGCCACATCACCACAGCCAGCCTGCCTCCCCAGA
TCAGCAGTATCATCCAGGGCCAGCTGATTCAGCAGCAGCAGGTGCTGCAGGGGCAGCCAC
TGAGCCGGCCTCTGGGATTTGAGAGGACTCCCGGCCTGCTGCTGCCTGGGGTTGGGGGGG
CTCCTGCGTTTGGGATGACATCTCCACCACCTCCCACCAGCCCTTCCCGAACTGCCATGC
CCCCCGGCCTTTCCAGCCTGCCGCTCTCGTCTGTGGGGAGCTCAGGGGTGAAGAAGGCTC
CCAAGAAACTGGAAGAGATCCCCCCAGCCTCTGCGGAGATGGCGCAGATGAGGAAGCGGT
GCCTGGACTACCACTACAGGGAGATGGAGGCCCTGCGGGAGGCCTTCCGAGAGTGCCTGG
TCGAACTGTTTTTCTTGCAACACCTCCAGGGGAACATGATGGATTTCCTTGCTTTTAAGA
AGAAGCATTATGCCCCGTTACAGGCATATCTTAGGCAGAATGATTTGGACATTGAGGAAG
AGGAGGAGGAGGAGGAGGAGGAGGAGGAGGAAGAAGGAAAGTCTGAGGTCATCAATGATG
AGGTAAGCAATACTGGTTCAGTCTTCTAGGGGACATGCATGAAGCAAGGTAGAGTGTAGC
AACCGTGAGTTGAAGGGTGACCTTTGAACCCGGGACCTTGGGGAGAGTTTATTTCTTGAG
GGTATGAAGGAGGAGTGGTGTGGGACTCCCTTCCTGTAGAGAAGCTGCACAGTACCCTAC
TTCCTCACGGAGAGCAGGCCCGTCCCAGGTGCAGAGCCGAGCCAGGCCATCACCCCTCCC
ACCCAGTGTGTGGTCCTGGGCTGGTGCCCTGCTTCTGTGGTGGAAGGGTTCTGCCGCAGC
TGGACCCTGAGCACCCGCAGCCTTGTGCTTACATGGTGCTCACAGGAACCCTGCCAGCAA
GGCTTTTAAACAAGCGGTTTAAATCACCAGCTGTAATTAGAAATTGCTGGATATGTTTTT
ATGAGATCTCCACGATTAAAATATAGTTATTGTGGCAAAAAACTACTAAGACTTTTTTTT
TCAGCTTTCATACGTAGTCTTATTTTTGAGATCATGTTTTAAATGCACTTTTGCAAACAC
CTATTGAGTAATATTTAAGGTAGAATCTTTAGTGGACAATATACTTTTTGGGCATCCAGA
ATGGGTGCATAGTAGACCCCAAGCCACCGAAGTTCCCGAAGTTGCTGGTGTGTCCTGAGC
ACCAGGTGGTAATGGTACTATAGCACTGTACTTTGTGCCTTCGTGTTGTGCAGTATATGC
TGTGTTGCGGGGCTTGTTTTACGATACTGTTTAAATAACTTAGGACTTTGCCAGCCCTTC
TGCAAAGAAACCAGCTTGTGGTAAGCCAAAGCTCGTCTCTTTGCCCATGTCCTCTGGCTC
TGTGGATGTATCTGTGTGGCTCTGCCATCTGTGTCTTCTCTGGCGTCCTTCCTGGGATGG
ACCGTTCTTGTTTTTCAGAAGGTCTACATTATTCTGAGGGCTTCACCTCTGTTGCCTTGA
GGCAGTGAAGTCCAGTTCTCTGTTTGTATGCCAGTGTTGTCTGTAAGCCGGTCCCCTTCA
CTGTACGTGAGAGGTCAGCCCTCCACAGCCTGCTGCCGCCGAGGACCTTTGCCACGGGAC
CACTGGTCAGCAGCAGCGCTGTGGTGCAGACGGCCAGAGAAGCCGCAGGACTTCCTCCCT
GAGTCTGTTGCCACTCCCACTCCAGTCTGGGGTTGTAGAATCCAGGGTACGCCCATGATC
TGGACTGGAGCTGCTGAGTGTGCATCAGGGTCACTGGGCGTCACGTAGCACGTCTCTCAG
TTCAGTGTCCTTGACAGGATTTGATGCAAAAGCATTTTAATCACCTGAATCAGTGAGCTG
TCAGCAATGAAATTCTAACAAAATTCTGAGCAGTCTTAAAAATTATGTTGCCTTTTTTTC
TCAAAATATTTCTCTCAGGTAAAGGTTGTGACAGGCAAGGATGGGCAGACTGGGACTCCT
GTTGCTATAGCAACCCAGCTTCCGCCAAATGTGTCTGCTGCTTTTTCATCCCAGCAGCAG
CCGCCTCAGGTACTTTTCGATGGTTCTAAATTGTAGTCTCATCCCAAACGTCTCCTTCAT
CCAGATATTTTAACTTCAATTTACTATTTGCTCTTTGGCATTTTTTTTTCCAGAGCCCAT
TCCTTATTTTTTAAAAGTCAAAACGCCTTCCCACATACACAGCTGTAGATCAAGTTGCAT
GAGCCTATGCCAGCCCAGGCCTCGCTGCGCTGCTCCCATGCACTGCAGCGTGGTGGTGGC
CCTTAGTCTGCATGTCCACTTTCAGTCCTGTGTGTGTGCCCAGGACCCTTGTGTGCTGTG
TTTTCAATGTTCGTCCTTTCTTGTGTCTTTTACCTGTATTTTGAGAATGTTGCAAAACAG
AAAAAGAAAACATCTTAAGCAAATGATAATGCTGGTGTTCCCCTTAGCTAGAGGGATGTT
GAGGTGAAGTCCCCGAGATTGTGGAGACTGCGAGCTTCTGGGTGGAGTCAAGTCCGTGCC
AGGAGTTCAACACGCCAGGTTCTAGTGCTTTTGGAATCAGTTGTGGGTCCTGAAGCAGTT
CCGTTCTCGGTGATGCTTTTTGTTATTCTTGCTTTTGAAAGAATCTCAGGTACACGTGAA
AGTTGCACTAAACGTACAGAAAACTCCTGATTCTCCCTAAGCTAGCTGGCGGGCGGCTTC
CTGCTGCCTCTGCTTAGTGTTTGTTCTCTCACGGGTGTGCGGTGTTGGTTCACAGCCTTT
ACCCAGATGCTCCAGCACCTGGAAGGTAAGGATGTCACCTGGCCCACACCATGCATGGTC
AGCTAGGAGACGTCACGGATCCACAGCTCACACCCAGGTCCCGCCTCCTGTCCTAAGATG
CCTTTCCAGCTCCCTCTGACCCTGACCCAGACCTCCCTAGGTGTTCCTCTGCGGTGTCCT
GGTCTTTGTGGTCTGGGCTGGTCTGTCTTTTGTGGCCCTACTGTTTCTGAGGAGTACCAG
CCTGTTTGATGCAGTGTGGTGGGTCCAGGGTTGTGCAGTGTTTCCTTGGGTCATATCCAA
TTGTGTGTTTGATTTTTTGGCAGTGCTGGGGTGGATCCCAGGCCTCCCACATGCCACGCA
AGCTCTAGCCAGGTGTGTTTGAGAGGAGCCCGTCCCATGATGGCTGGGGTTGACTGAGTG
ATTGCTTGAGGTGGTATGGCCAGGCCTGTCCCATGGAAGCTCTGTTTTTCTCTGTGTAAA
GAGTGAGGAGCAGGAAAGATGCCCTGAGAATGCGTAAGTGCCGAGACTCCACTCCCTCCC
TGTTGCTGCTGTGTCTGCCTCAGTCACTGCTGTGATGGTACCAGTGGGCGCTCTGTGTGC
AGCGGTTGAAGGATCCTGTAACCAGAGCTCCTCTTTCTACCATTTTTATGTCCTTTTACA
CGTGAGTGCTTATTTTCATCAGTCCCATGGGTATTTGTTTCCGTCTATCTAAATTCACTC
TAGTTATATTCAGTGAAACTCACTTTTTTGGCCTTATTCTGTGAGTCTTGACAAATCCAT
GGAGTGGGCTATTCTGCACCACAGTCAAGGACCAGGTAGTTTCCAGGACTTCCATGGCCA
GGCCCCTCCCCACCTCGGCCCTGTCCTCTAGCTCCGTGGTGGTGCCTGTGGGGTCCCAGC
TGTGCCCTTGTGGCTGAGTGGCACTCCTTGAATGGACGTGCCTATTTTGCTTACCTGTCA
CCTCAGGAGGGTGCTTCCATTTTAGGGATGTACATGTGTGTTTATTCTTTGTTAGGTCAA
GGTATGTCCAGGTTGCCTGAGTGGCCTCGCCTGCATCCTCCTGCTTCAGCCTCCGGGGTC
CCTGGGACTGCAGGTGTCAGGAGTTTGTGAGCAAAGCTGTGGCGTGCACACAGTGTTAAT
GTGAGCGTGGACTTCTCTTTACCTGAGGGAACATTGCAGTCAGGCTGTGTGTTAAGTGTA
CATCCAGCCTCACGAGGAACTGCCAGCCTTTCCAGAGGGCCTGTGCTGTCTTGTGTTCTC
AGCATAGGGTGCAGGGTCACCATCCAATTCCTCCAGGGTGGTTGGACTTTTCAGAGTGTT
GATCACACTGACAGGTCTGCAGTGACTTTCCTGTACATCTAGGGTTGTTGGTTTAGGCAT
CTTTTCCTGTGTCTCTTGCTGGTCATGGGTTTTCTTTGGTGAAGTGTCTGTTCACAGCTT
ACAGATGTTTTCATTGAACTGTTTTGTTGTTGTGTTTGAAAGTTCTTTACATAATATAGA
TGTTAAATTTTTTGTTAGACATAAGATTTGCAAATTTTTTTCAGTCCTGTGGTTTACCTT
TTTCTCAACAGTATCTTTTGCAGAACAAATATCTTAAATTCTGATGTAGTACATGCAGGG
CACAAGGGCCACGCCTGTAATCTCAGCAGCTCAGGAGGCTGAGGCAGGAGGATCACAAGT
TCAAGGCCAGCCATAGCAACTTAGTGAGGCCCTAAGCAAGTTAGCAAGACCCAGTCTCTA
AATAATTAAGTGAATGAAAATAAATAAGTCAACATAAATGAATGGCTGGGGATGTGGTGT
CCCTGGGTTCAATCCCTGGTAACCAAAAAAAAAAAAAAAAACCAGAAAATTCCAATGAGA
TGCAAGTAATTATTTTAAAAAAAATCCTGCTTATGCTTCTGATATTATATTTAAGACACT
CATATACTCAGTTTAAGATCACAAGGATTTTCTCTTCTTTTTGGGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGGTGCTGAGTATTCGAACCCAGTGCCTTCATGCAT
TGCCAGGTGAGCTCTCCCACTGAGCAACCACCTCAGCCCCCATCCTTAGCCCCTTTTTAT
TTTTTATTTTGAGACAGGGCCTCACAAAATTGAGGCTGGCCCTTGAACTTGCAATTCTTC
TGCCTCAGCCTCCTGAGCTGCTGGGATCACAGGTGTGACCCCTCCCCCAGTTCTATGGTC
TCTGTAGCGTGACAGACATGGACAGAGATTCACAGTGTTGTGCCCACACCGCATCTTGAG
AAGATGACCCTTGTTGGTCCTGGTGGCTTTCGTGACTGCCCAGAGCCCACGTGGTCCCGT
GTGTGCTGGCCATGGTTTGCTGGCAGTGGCAGCCATCCTGGTTTCCATGGCTTCCTGTGG
GCCAGGTGGCATGTGTTTTCCAGCTTTTCAGAATGGTGTTGGTAGTTTTTGTTGCTTTGC
CTCTCCATGTGACCTTCTGGATTGGCCTACTGGCTTTGGGACATTCTGCTAGGTGTTGGT
GTGGTGGCTCTGGCCAGCTAGGGAGAAGTGCCTGCAGTGCTGAGTCTTCTGTCCCTGAGT
GTGGCAGATCACTGTGTTCACTCACGGTTTGGTTTCTGCCCTCTTACAACTGTCAGCATG
CTGCTCTTGTGTGTACGTCTTGTTAGGTCTTTACTTATCAATTTTTTTGGCGGTCTTATA
AGTAGTACTTAGAACACAATTCCCTCTGTTCATTGCAGGTATATAGAAATACAGTTGATT
ATTTGAGTCTGTATTTTGCAATCTTGTTAAACTCATCCATTAATTTTAGAAAGGGCTCTT
TAAATTGAGGGTCTGTGGGGTTTTCTGCATAGAGAGCTGTCTGCATGGAGTCAGGCTGGC
TTTCCTTTCTGACCTGTGTGCATTCCACTTCTCATCCTCACTGTCCTGGTCAGTAGGCTC
CAGCCTGGGGCCAGGTGGGAGTGGTGCGTGGTGTCCTGGCTGGTCCTGTCCTGCTTCGTG
AGCAAGTGGGAGCTGAGCTGTGGGTTTGTTGATGTCCTTATCGGGCCAAGGGAATTCCCT
TTGTTCCTGTGCGTGTTGAAGTCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAGCGACTGCTTGTATTTACCTTCTTTGCCCCAGTCCACTCCTTTTGGAATGCAG
GTGTTCTGCTTGTCTCTTCCGTGGGCTGTTTCCTTCCTTCACCTTCTTTTTGTGGCCTAG
TTTCAAGGCTCCCCGTAAATGATATTAACTCTGTGGAATTAATTTTGGTGCCGTCTCTCT
TAAAAGAGCACCCAGAATTAAATCCTGCCAGAGTATTCCTTTTCCTGTTTTTATTAAAAA
ATCAAGTTTTTATTTTAAAACTAATAGTTTCTTTATTAGTGACACATTCATGACAGCAGA
GTGCTTGACAAAGGTCGTCCTGAAAATCTGTGTGGGGGCCTGCCACAGAGCACCCAGGAA
CTCTACAGAGCAGAACGGCAGTGTACTCCTGTGTCCTCAGCCCACCTGTCAGGGCCTTTG
GGCGAGTAGAGCTTTCTGACTTTGTTTGTTTTTGTGGTGTCAGGGTTGGACCCAGGTCCT
TGAGCATGCTGATCCTACATTCTACCCCTGAGCTACATCCCCAGCCCCACCCCAACTCTT
TTTATGTTTTATTCTGGGACGGGGTCCTGCCAAGGTGCCCAGGCTGGCCTGGAGCCTACC
ACCCTCCTGCCTCTGCCCCCCGAGCTGTTGGGATCACTGGTGTGGCCACTGCACTGGCTG
AGCTTTCTGATTTTGATGAAGTCCACTTTGCCGGCTTTTTGGTATTTCTATCCAGTTTTA
GGCATCATTTGTTGGGAAGAGTTTTCATGGCCCTTGGATTGCTGTGGTGTTCTTGAGGGT
CCCATGATCACAGCTCAGCCCATGTGGGCCTGGAAGTCTAGCAGCTCTCTTCTTTGAGAT
CTTCCTTGGGCCTACTGGCTGTCCTGTGCCCTCGTACTGCCCCTGAGCACATCCTGAGGT
TTTATTTTCAGATGTGATATTCTCAGCTCTGCAGTCCAGGTCAGTTCCTGGGTTTCCATC
CAGTTTTCTTCTTGGTCCTTTGTTAGATGTATTTTTTTCGTATATTTGTGTGCCTACTAA
AGCTACTTTAAATTCCTGCTGCTGATTCCAGCTTGTGGGTCCCTTGGGGTGGAGTCCTTG
ATTGTTTTGTGGCTCAGGTTTCCATACTTGTTTATGTTTTTGAGCAACTTTGCATTGGAT
TTTGGAGAATTGTGAATCGAATGTAGAAACCCTGGGCTCTATTACATTCTTCTAAAGATG
AGTCATTCTGCATTGATACCTGGCTAACTTCACTGAACAGAGGTGCGGATTCTGTCCTCT
GAAGCAGGTGGCACCTGAAGACTCAGGTTCGAACGCTGGCTTTTGCTTGCACCTGCATAT
GGTGTCAGCCCGCTGGGCTTGAGTCAGACCTAGGGAGAGGCCAGGCAGAGAAGGGAGGTG
TTGTGCTCCCAAGGCCCTCTGTCCTCCTGCCTGTCCTTCTTCATCCTGGGGTCTGTTTTT
TGGGTTTGGCCTGCTCTGGAAGCCTGGCCACACTCATCCTTTTGTGCCAGGGTGGGCCCT
GTCCTGTGCTGCCTGCCACCTCTGCCTTGTTTCACATTTCATGTAGAGCTCAATGTCGTG
GAGTGTGTTTGATCTTAGCAAGTACTGGCCACAGCTGGATGAGGACCCTTTATCAACTTG
TTTTGTTAATATGTAACTTAGGCTGGGTGCTGTGGTCCCCGTGACTTAAGTGGCTGAGGC
AGGAGGATTGCAAGTTCGAGGCCACCCTCTACAATTTAGTGAGACCTTGTCTCAAAATTT
TAAAAAGGGGTAGGGATGTGGCTTAGGGGTAAAGTGGGTTCAATCTGCAGTAGCAGGAAA
AGAAAAAAAAAAAACCCTTGATTGTATAAATAATACACATTCATTGTGGGAAGTTTAGAA
AAATGTACACATGAAACTAAAAGTCACCTGTAGCCCTGCCCACAGAGAGTATGCTGGTAG
GTGCTGTTTCCCTCCTCGTGTGCCCACCTGTGCTCTGGTCCCCTCACCCCCACTAGGTGT
GAGCGGGCTGTGTGCCATGAGCATGCGTGGGCTGTGTGGTGGCAGTGGCTCTCTAGGGGT
CCCTAGTGTCTCTCTCTAGCTGCGGGGCCTTTGGCATAAGCAGACCCCTCCTGCTGGATG
ATGGCCTATGAGGGCTCTCCCACTGGTGCAGTGGGGCTGATGGCACCCTTGGAGCCTGGC
TGGCGTCTGGCAACTGTAGAGCAGCACCCACTTCGTGTCTGCTGTGGGGGCAGGAGGGTG
CCCACGGGGAGGGCGGATCTGGTTGCTGTCTTCTGCCACCTTGCCCACAGCTTTAGGCTG
GCCGCAGATTGGAGAGGAAGGTGCCCTGTGTAGGCCCAGCCTCCTACTGTTAGCACCCCT
GAGGGCTCACATCCTTGCCACCCAGAGTACATAGTGTCTTGGCTAACTTGGGGCCACACA
GAGGGTTAGCACCATGCATCGTGGCGTCATTTATGATGGTTTCCCTGCCTCAGAGCCTGC
GTCCTTCCTGTCCTTACCCCTCTACCCCCACCTACTGCCACCCCTGATGGCTTCTGCCTC
CATAGCTTCATCCTTTCAGAATGTTACCTATAGGTGGCTGGAATCAGACTTGCCTCAGAA
TCACCATATCTGAATATGTAAACACACACACACATCAAGTAGTGTGGACTGTTGCAGATG
TCATCTTAAAGGTCCAAGGGAGCTGTGGTTGCCTGGTCTTGGGGCTCTCCAGCAGGGAGA
CTGCCCACTCTCCCCCTCACTGCCGAGAGTCTGATGGGAGTTGGGCCAGCAGTGCAGCTG
GTCCCAAGTTTCCCAGGTTGGCCTTTGTGTGGTCTGGTAGGCAAAGCCAGCTCGTTTCCC
AAGGATTATGGATAGGTGTGATCTGAAATCCCATTTGAAACCAGAATGGTGTGTCTTATG
CAAGTCCTTTTTTTCTTCAGAGGTAAGTTAGGACTGTCAGACACCTTACCATACAGAGGT
ACATGTTCCAGATATGAATTGAAGACACTGGGTAGATCCCACTTGTTGAGAAGCCGTCAG
CCAGTGCCTGGGGTTGTTGTGGCAGTTCTAGTTCATGCTCGTTCTTGAGAGGCCGCATTG
GACCAGAGTCTCACCATCTCCCGTATTTTTCAGCAGCAAGCCCTGGCAGGGAGCTTGAGT
GCTGGAGCAGGCAGCGCAATGGAGGTGGACCCATTCAAGAGGCAGCCGGTGATGCCACCC
GCAGGTATGTCCTAACTCAGGCAGCGTGACTGCGCAGCGCTCGCTCGCTCAAGGGAGCTT
CTCTGTTGTGGAGGTCACTCATCACTGTATCGAAGTAGTTGGGTAACAGTGTGCCTGGGG
TGGAAGGCCCAGTCAGTCAGGTGTCCCTGGCTCATGCAGGTCACCACAGGCAGAATGCTG
TGCCATCTGCTTTTGAGGCTGTCTTTTTCTTTTGGGGTACTGGGGATTGAACCCAGGGGC
ACTTACCCTGAGCCACATTCCCAGCCCTTTTATTTTTTTTTATTTTGAGACAGGGTCTCC
TCATGAATTATTTAGGGCCTTGCTAAATTGCTGAGGCTGGTCTTGCACTTGTAATCCTTC
TGCCTCAGCCTCCAGAGCTGCTGGGATTATAGGTGTGTACTATTATATCTGGCGGAGGTT
GTAATTTTTTATATAGAAGTTTTCTTTAGATTCTAGATGTCACGGTGAATTTCTCCATGG
GAGATTGAGGAGTTATGGGGTGTGGCGGGAGCCCTGTGGCTGGCACTCTGGGCTCTCACA
GACATGTTTCTGTGCAAACAAGTATCGTCTGCACGCATGTCTTTCTGGATCCTCCTTCAG
GTGTGCTTGTGTGCATACCAAATCCAGTGAAGAAGACTGACAACACTGGCTATTGCGACA
GGCCACAAGTCTATGACTATAAGTGTCTGTGCAGCACCACACACTCTGGCTGCTCCCCAC
CTCTCAGGGCACATCTTAGCTGTAGGCTTCAATGGTAAGAGCACATGTGTGGAAGAAGGC
AAGCCCAAAGTGTAAGTGGCCCCTGCTCTTTGCCACCTAAGGACAGGGGCTCAAAGACAG
TCTTGAGCCTGTGGCTCCCTGAAAGAAAGCTCCTGGAAGTGTACCACCCTCTGCAGGCCG
CAGGGCGCCAGCTACCTATTCGCACAGTGGCCCTCTGTCTGGTTGCCACCTGGGCCACAC
CACTCATCTCTTGGATGTGGGCTCCTCTGGCTCAAATGGGGCTGCCCAGCCTCCTTGGGT
GCCAGTGGCTCTGCACTGTGTTGCGGCTCCCTGTCTGTTGGAGTGTGACTGTCCTGCCAT
GTGGGCCTCTGTGCGTCCTGGGTAGTCTCACCACCTAGCTCTGGTTGTCCTTTGCCTTTT
CATAAGTTTTCTCTTGATTGGCGAGTTCTTGATGAGACCAAGCTGTATTTATCAACCTGA
TCCCATGGCATGGGAAGGTCCCCCTGTTGGAGAGATCGTGAAACACTTGCACATGTTTTT
CTTGCCGCTTCTCTGGTTTTATTTTTACATGAAATGGCACCTTTCTTGAAAATCGTTCTA
GAGCAGTCCAAGAGACCTCGACTTGAAGTGGGCCATCCAGGGGTGGTCTTCCAGCCCCCA
GGGGTGAGTGCTGGCGTGCCTCTGCAGCAGCTGATGCCAACCGTGCAAGGTAAGCCACGC
AGGCCCTGTGCTTCTAGTTTGAGGGGCATGCACAGCTCGAGGCCACCCCTGTTGAGGCTG
TGCGGGTGAGGAGTGCGTCCAGCACGTCTGAGTCTACGAGTGTCAGAGCGCCTTCCCCTG
CGTGTGCAAAGCCCTGAGACCCGTACTTGGTCTACTGGGGCCATACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTTTTCTTTTTTAATATTTATTTAGTTGTAGATGAACATACAGTAT
ATTTATTTATTTTTATGTGGTGCTGAGGATTGAACCCAGTGCCTCACACATTTGAGGCAA
GCACTTTACCACTAAGCTACAGTCCCAGCCCCAGTGCAGTTTTTGATAGTAGTTTTACTG
TCCCTCTTGTAATAGCTGGTTAATTCAGTAGTTGCAACATGGTTTTATTTGGCTCTGCAA
TAGTAATCATTGTTAAAGGAACGTAAAGCTATGGTGCTGGTGCCCTCAGTACAGGAAACT
TCCACCTTTTGACGCCAAGGGTATGTGTCCATGTCCTACTTGATATGCCTTCTGACTCTC
AGATAGTGACCAATTTGGCCAATCTTGGAGATTTGGGAGCTAGCCCCATGTTATGTGGCT
TGAGCAATTCCTGTCTGAGGGCAAAACTGTGCCCCTGACCGTTCACCAGGCTTCTTCTGT
GGGTGGCTCTTCCTGTTTTGGGCGCCATGCTCTATGAGTGTGTGTAGCCATCACTGACCT
GCCTGGCTCGACATGCCCCTCCTCCTCCACTGACCAGTCCTAGCAGGGCTGTGCTTAGGG
TGTTTCAGTAACCTGGCTTTGGTCCCTAGGGCGAGCGCTTGAGCCTGGGAGCCCAGCTTT
GTCTCTCTCTGCTGGTGTTGGGCGTGGGAGAGCCTGCTGACAAAGAACTCCCTCTCCTCT
GCCGTCCTCACTACCAGGGTATTGCCCAGGGGACTTGGAGCTCCAGTTCTTCATGGGCTA
TGCCAGTCTTTAGGACATGATAATAGAATGGAAGCAGCACTGAGTGACAGTGACCACTTG
CTTGTCCCTTTGAGGCGAGGTGGCAGGCCCTGTGACAGGGATGGCAATGGCATGATTTTA
TTTTCTCCGCCCTGCAGCCTATGAAGCAGTCTTGTCTGCCTTGTTTCATTGGTGGAGGGG
TGGAGTGGCTGGGCTGCAGGGGCTGTGGCCGGGGCAGCCGTGTGGACCTTCCCAGCACAG
CTGAGCTCCCCCATGCGAGTGCTTCCTTGAGGTTTTCTTGGAAACAATTCCTTCTCTCTT
GGAAACACACCCTAGCTTGGAGCAGCACGTGACTTTCTTTGGGTGATCTCCCTGCCTGTG
TGGAAGCTCTAGGGTCTGCAAAAACCCACTACCTGTGGATGGGCTGTCAGCTTATCTTTA
AAGGGACAGCTGTGCAGTGTCTTGGCTTTGCTGGCCAGTCACTCAGCTCTGCTGCTGAAG
TGCAGAGCAGTACAGACAGCTTGAGGGTACACTGATGGGCTGTGTCCCAGTGAAGCTCTG
TTCCCCAAAGTATGCAATAAAGCTGTGACTTCCTGCCCAGAGCAGGAGAATCATCTAGGT
CCATGTCTCAAGGGCCAGTACTTACTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCAGACAGAGGGACCTGAGCCTAGCACTGCCCGTTACCTCTGGCTTCAG
TGGCCATCAGTGGGCCAGTCTTGCTCCATGGCTCCTCCCTGTTCCTGACTATTGAAGCGA
GTTCCAAGGGCCACAGTGTTTCCCTTGTTAACGCTTTGGTGTGAGCATTGAGTCTTTCCT
AGGTTTCTTTTGTTTTGTTTTGTTTTTCCTTTTTTTTGTTTTGTTTTGTTTTGTTTTGTT
TTTTTGCAGCTGGGATGGAATGCAGGTCTGGTGCAGCAGACACTCCAGCCCTGGGCCACA
GCTCTGCCTAGTGCTCTGGTGCTGTGTAGACATGGTGGGATGCTGCCCCAGTTTTGCCAT
TTCTCTGTGCTTGCCTGGAGCCATTTTGACCTGTATCCAAGGCTCGTCTTAGACTCTAGC
CTCCTGGAGGTCTCTTTCCCTTCAGTATCTGAGCCATTCACATAGTAGGGTCTTCTCAAG
TATTTGGGGTCTGAGTTAATGGAAAACACTTAGTAGTTACATGCCCACCCCTTACCTCCC
CTGTACTGCATCCCTTACAGGAAAACCACATCCATCAGCGCGTAGCAGATCTAAGGAAGG
AAGGTTTGTGGTCCCTGAGACGACTGCCAAAACTGCAGGAGGCCCCACGTCCCAAGTCGC
ATTGGGACTACCTGCTGGAGGAGGTGCAGTGGATGGCCACAGACTTTGCCCAGGAGCGGA
GGTGGAAGCTGGCTGCTGCTAGGAAGGTGGGTCCACTGGGGGTGGCTGTAGTCAGTGGGC
TGCCTTAGGCCAATTCCCTGAAGGCTCCTGCTGGTCCTGCATAGGAGAACATTTTGCTCT
TGCAGCAAGGTAACTGAGATGGCCTCCTCTGCCTTGAAGGGCCTATCAGAACAGGCGTGT
CCTTCGCTGCAGTTCTGGTGTAGAGCTTGGGTGCCTTTTCTGGTTTTGCCTAGTGGTTTG
AATTAGTCTGCCTCCAGCACCCCAAATTCTGCAGGTGTCCAGGGCTGATCAGGGAGCCAA
GTCGCTGAGAGCCTGGAGCAGCAGGCCTTGGTCGATGGGTGGCCAGGTGTACCCTGACCT
GCCTACCCTATCCCATGTATCGCTGCCTGGCCTTTTAACACCCCTGATTTGCATGGCCGC
CTGTCAGTTCTTGGGAGACTCTGGAGGTGTGGCTGCTGGCTGTAGAAAATTGGAGCAGGT
GACTGGTATCTGGGACACGTGGGCTATCCTCACTGTGTGAGCAGCTGGGGCCTGCTGTCC
TGCTGTGTCATGGACCACTCTTCAGGCTGGGCATGGCCCTTTTACCCTCCCCTGCTGAGG
TCTGAGCTTGATCTTTGCCCCCTGCTCTGTACACATCCCCTCTGGGTTAGGAAGGGCAGG
GCTGCTACCAGAGGGGACAGTGGGGCTCTGAGAATAAAAGGCCTCAAGTGTGATCCATGG
GTGTTTCAGAAAAATCCCAGATGTCCTATAAATTGTGGAAAATGGTCCTGCACAGGTGGA
CACTGGCATGGACAGGGTGGGGGACTGGACATGTAGGCGTTGGGGTGGGCATTGGCTGGA
CAGCATGTGGATGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTTACTCTCCTCCACTGCTCACCCAGCAGCTTTGGGGTGTGGTGGCCTCTTGCAGAGCT
GCCCGGGAGGGCTGGTCAGTGACCCCTTCTGCATGTCTAGTCTTCCTGGTTGCTACATTA
GTCTTTGTGTCTAGCTTTTTTTTTTTTTTTCCATTTTAAAATTTGTTTTAATTAGTTACA
CATAGCAGTGGAATGCATTTATGAGTTTCGATATACCATATGTAGATGGGAAATAATTTC
TCATTTTTCTGTTTGTATGTGTTATAGAATCACATGGTCATGCAGCCATGCATACACATA
AAGTCATGTCTGTTCCGTTCTGTCCTTCCAATCCTTTCCCTCCCCTCCCCTCACTCCCCT
CTACCTAATCTAAGGTAACTCCATTCTTCCCTAGTGCCCCCCACACCTCATTGTGAATTA
GTATCTGCATATTAGAGAAAACATTTACCCTTTGGTTTTTGGGGATTGGCTTATTTTGCT
TGGCATGATATTCTTCAGCTCCATCCATTTAGCTAGGCTAGATTTTTATCTCAGTTCTTT
TGAGGTGTATTCATGTGAGCCGGCACCCCAAGTTGGTCAGCTCTGCACACTCGGAACTGA
GGTCTTGCACCCATTGCTGTGGACAGGGAGATGGATCATCAAGTGTCTGCCAGGCTGTGC
CTCTGCGTCATCCTGCCTGCAGTAGCTGCCCCAGGCATTGGGCACCTCTCATTGGGCACA
TGCCAGAACCTGGTTCAGGCTGCATTCACTGTATCTTCTGGCACTTGGGCAGACCCTGGG
TGGGCATATGCTTCTCGTTACTGGAAGTGGAGTCCCAGAGGTGACCCCTTGTGAAAGGTC
ACAGACCTGTGACGGTCTGTCTGGGGTCATAGGAGGGAGGAGTGTAGCTCACATAAATGC
AGGCCAAGCGAGGAGCTGGTCTCTTCACAGCTTTGGCCAAAGCTAACCACATCTCTCATC
TCCTCAGGGAAGGAGTCAAGAGCTAGGGGATGTGGCACGTTTCCTGAGCACTTCCTGGTA
GGTTCTGGTCTGTCACGCTACTGTGTAAGAAGGGACGAAAACAGTGAAGAGAACATGGTG
TTCTAGTGTGGGGGGCCATTCGTTTCCATTGGGAGGAATTTGTTTGTCATGAATACTATT
CCCTTGATTGTAAAAGTCAGCCTGCTTTAAAAACAAACTGACACTCAGAGCCCTGGTCTC
CTGTGAGGAGTCCACTCGGCCACTTGGAAAGGTGCAACTGGTGGGACCTACACCCCACTC
CACCTCCACCCAGGGTCTCCTGCCATCCTTGTGGGCACATGCAGAATAGACATTTCTTCC
TGACTTTCCCTTCTGCAATTCCAGATACCATGTTTGTGATTTTATTCTCTTTCAGGACTC
GGGAATATCTGGAAGGAAAAGGAAAGCCAGCACCTCTTTGACTGATGACGAAGGTCTGTC
CCTGGCCCTTGGTGCTGCCCGTTGGTGGGCAGGGCTTGCAGTCCATGCTGCCTGGCCCTG
TTGAGCTGGTTGGGAAGTCCGACTCCCAGCGTTCACCTGGGCGCCTCCTGGTTTGCTGGA
GGGTTGTGGAGCCTGCGGTGGTGTCTGAGTGTGGGATGTGGCGACCCTCATGCATTTAGA
GGGTCTTGGGGCCACTTGCTCAGATGGCACATCTGAGTTCCTGTCTTTGATGGTGGCCCT
GGTACACTGGGGTGGATGTGTCAGGTTGCAGCCAGATGTGCCTGCTGCCTTCAGTCCAAG
ATGACAGTGTACTTGCTGTGGGCTCCTTTGAGGCACACNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCCCTGACC
TTTGTGATGCCCATTTCAGTGGAAGATCGAAGAGGAGACCATTGAAGAGGAAGAAGCACA
TGAAGGGCTTGTGGACCACCACACAGAGCTGTCCAACTTGGCCAGGGAAGGTAAGCTTTC
GGCACTGACTTAACGTTGTGTTTATTAGACATCAGATAGGCACATGATTTTTAAAAAAAA
AAACAAAAACCTTTCTTTTTATTTTTTATTGAGGCACAGTGATTTATTCAGGAAAAAAGT
ACACATTCAAGGGAGGTTAGGTTGCAGGCTGTCTTGAGAGGAAGAAGCCTGTTCAGACAA
GAAGCTAATATTTTTTGTGGTGTCGGGAATTGAACCCAGGGCTTTGCACCTGGAAAGCAA
GGGCTCCCTGACTGAGCTGTTCCCAGCCGGCCTCAAGTGCATTCAGAAATGACACATCAG
ACACAGGGTAGCAGTATGCAGGTCACATTGCCATAGGCCACCCAGTTCACAAAGACAGTG
CTGGTGCCTGCTGGAAGCCCCACGTGGTGCTGCTCGCCTCTACTCCTGTCCCACCTGCTG
CTGCCTCTGCCCTTCTGGTGGATCGTCCTCTGCTTTCCCTCCCCATCTGCCACTGTGGCT
TCACACACACTGGGCTCATGCCCCACGATGTTCTGCATGTCAGCGGGGTCACATTCTGTG
GGCAGGAGGGCTGCTGGGGTGTTCTCTTCCTTTGTGTGACACGGAGCACTCTGTGCCAGA
GGAGGGACTGCAGGGCTCTTTGGGTTTGCTCCGCCTGCCGCTCTGCATCTTCTGTGGAAT
GTGGCTGTTCCGCATGCCACAGTCGGACTCTGCGCAGACTGCCATGAGGTTTTCCTGGGG
TGTAGGAGCACGGTTCTTTGGTAGCTGGTGAGGAGCATCTTATCATGGGGCTTCTCATGG
GCTGCAGGTCAGGTTTTCCTGACCTGGGTCACGTTTTAGTATGGGGTTTCTTTGCCTTGT
TGTCCTGTGCGTGTTCTTTATGTATTCCGGGCACTACTTCTAATTTTCTTTATTTACTTA
GTACTTGGGATTGAACCCAGGGTGCTCTGCCACTGAGCTACATGCACCCCTGCCCAGCAC
TTTGTATTTTGAGTGTTGCTTGGATGCCAAGCTTGCCTGGAACCTGCTGCGGTTCTTCTG
CCTCAGTCTCCCAGGTCCTGGGAAGCAGGCATACACTTGATCCCATGTCCAGCAGCTTGG
CTGAACTCTCTCCCTGGTCTCTGCAGAGCGGAACTGGTAGAGTCATGCCTGTTTGTGCAG
ATCTGTTTGTTGCTGCCCAGCTGGGATGGTGTCAGGCTGTCTGTTCTCCCCTGGCGTCTC
CCTGGTGGTTTTGCAGCTGGAGTGGAGGGCCTGGCTTGGTGTGAGCTCCTCTCTTTGCTG
CTGCTATGGGAGGGTGTGAGGATGGCTTTCCTAGGCTGCTCTTGGGCCCACACGTGGGAC
TGAGGCAGGGCCTTTACCAGCTGTGTGCCCTTCTGTCACGCATGGGCCTCGTGCTTCCTG
CACGCTTGTCCTTGCAGGCCTCGTTTGGTGGCGTCTTGCCTGAGGTCAGTCATGGTGGGC
TGCTTTCACGTGTGGCCGCACTCTGAAGCGCCTCGTGTCTGCTGCTCGACTTCCTGCTCG
GGCTCTGTTCAGCACCGGGGCCGCTTTGCACAGAGTACACAGGCTGGCCATGGGTTGCAG
GTCAGGTTGTCCTGACCTGGGACGGGACACAGGTGGCTGTGGGACAGTGCAGGGCTCTGT
CTCTCTTCCTGGTTAGCTGAGGGCTGCACTGTCTGGGCCTTTGATGGCTTGGTCCAGGTG
AGCTCCCTGCTGTTTGTCCTGATGGCCCTTCCCATTTCCTTGAGCACTCTACCCAGGTTT
GTCTGTGTCCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTAATTTCTTTCATC
TGTCTAATTGCTCTGGCCACTGTTTCAAGAACTGTTAAATAGAAGTGGTGAAAGAGGGCA
TCCCTGTCTTGTTCCAGTTTTTAGAGGGAATGTTTTCAATTTTTTCCATTTAGAAAGAGG
TTGGCCTGAGGCTTAGCATAGATAGCTTTTACAATGTTGAGTTATGTTCCTGATATCACT
AGTTTTTCTAGTCTTTTGAATATGAAGGGGTGCTGTATTTTGTTGATTGCTTTTTCTATG
TCTCTTGAGATGATCATATGGTTCTTATTTTTAATATTGATGTGATGAATTACATTTATT
GATTTGCATATGTTGAACCAACCTGTTCATCCCTGGGATGAACCCCACTTGATCGTGGTG
CACTATCTTTTTGATATGTTTTTGTATTTGATTTGCCAGAATTTTATGAGAACTTTTGCA
TCTATGTTCATTGAAGATATTGGTGTGAGGTTTTCTTTCTTTGAAGTGTCTTTGCCTACT
TTGGAATCAGGGTGATATTGGCTTCATAGAATGAGTTTGGAAGTTTCTATTTCCTGAAAT
ACATTGAAGAGTATTAGTGTTAGTTCTTCTTTAAAGGTCTTGTAGAACTTGGCTGTGTAT
TCATCTGCTCCCAGGCTTTTCTTGGTTGGAAGGCTTCTGATGGCACCTTTTATTTCATGG
CTTGAAATTGATCTGTTTAAATTGTGTATATCATCCTGATTCAATTGGGCAAATCATATG
TCTCTAGAAATTTGTCAATGCCTTTGATATTTTCTATTTTATTGGAGTCCAAGTTTTCAA
AATAATTTCTAGTTCTGTATTTCTATGGTGTCTGTTGTGATATTTCCTTTTTCATCACTT
ATGTTAGTAATTTGAGTTTTCTCTCCTGCTCTTCCATCAGCATGGCTAAGAGTTTGTTAA
TTTATTTTCAAAGAACCAACTTTTTGTTTTGTCAACTTTTTCAGTTGTTTCTTTTGTTTC
AATTTCATGGAGTTCAGTGCTGATTTTAATTATTTCCTATCTTCTACTGCTTTTGAAGTT
TATTTGTTCTTTTTCTAGGGCTTTGAGATGTAATGTTAAGTCATTTATTTTTCTTCTTTT
GAGGAATGAGCTCCATGCAATGAACTTTCCTCTTAGTACTGCCTTCCCAATGTTCCAGAG
ACTTTGATAGGATGTATCTATGTTCTTTTTACCTCTAAGAATATTTTAATCTCCTCCTTG
ATGTCTTCTGCAACCTATTGTTCATTCATTAGTATATTATTTAGTGTCCAGGTATTGGAG
TAGCTTTTATTTTTTATTTTAGCATTGATTTGTAATTTCATTCCATTATGATCTGATAGA
ATGCAGGGTAGTATCTCTACCTTTTTTGTATTTGCTAAGAGTTGCTTTTGGTCTATTTTA
GAGAAGGATCCATGTGCTGCTGAGAAGTGTATTCACTCATTGAAGGATGAAATATTCTAT
ATATGTCAGTTAAGTCTAATTTCTTGATTGTATTATTGAGATCTATAGTTTCTTTGTTCA
GCTTTTGTTTGGAAGATCTATCCAGTGGTGAAAGAGGTGTGTTAAAGTCACCCAGAATTA
TTGTGTTCTGGTCTATTTGACTCTTGAACTTGAGAAGAATTTTATAAACATAGATGCTCC
ATAGTTTGGGGCACGTATATTTATAATTGTTATGTCTTGTTGGTGTATTGTTCCCTTGAG
CAATATGTAGTGATTGACTTTAGTTTAAAGTCTATTTTATTTGATACGAAGATGGAAACC
CCTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACAATCCTCTTG
TCTCAGCCTTCTGTCTAGCTGGGATTATTGGAGTGCACCGCCATACCCAGCTACTTTTTA
AAAAATATATCTTTTTTAGTTGTAGTTTGAAATAATACCTTTATTTTATTTATTTTTATG
TGATACTGAGGATCAAACCTAGAACCTCACACGTGCTAGGCAAGGGCTCTGCCACTGAGC
CACAACCCAGCCCCCCCCCCCCAGCTACTTTGTTTTGTGTGTGTTACCATACATTTATCA
GATGATTTCAGAAAAAAAGATTTGTTCTTTTATGAATGAAAATTGTTTCTCATTGTATTT
CAAAGATCTCATTCTACTTTGAAGAAAATATTTAGACCTGTGTCAGTAATGGCAACCCTC
TTAGTTTTTAGAAAAAAATAAGTGTGCTTTTAGAAATTGCAGGTTTTGGATATCTCTAAT
CTGAAAATCCAAAATCTAAAATGCTTTGAAATACAAAAATTTTCAAACATCAAGAAAATA
ATGCTTAGAGTGTTTTGGATTTTGGAACATTTTGAGCTTTAGATTTTCTGATTAAGGAAT
GCTCAAGATATTTGAAAATCTGCACATTAGACATCAGAGACACTTGTGGTCCCAGGCACA
ACAGGTGACACAGACACAGCTTCTGCTGCTGTGCGGGCGTCCTCCACAGCAGGGAGGGCG
CGTCTCCTGTCTCCTGACCCTCGGGCGAGTGGTGTGACTGACGATCTTTTTCCTATATTC
TTCCCAGCTGAGCTGCCCCTGATGGATTTGATGAAGTTGTATGAAGTGCCTTTTTGCCAA
ATTTCCAGTGGCCCCACCCTGACCCCGAGGTGGAAGAGACGAGCGAGAGGAGGGTAGGTC
TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCCCTGTGCCGTGCTC
TTTCTCTGCCGCCTCTCTCCCCACTTGCCATGCTCTCCCCCTCTGCCATGCTCTTCCCTC
TACCATGCTCTTTCTCTGCCATGCTTTTCCCTTCTGTCATGCTCTTCCCCTCTGCCATGC
TCTCCCCCTCTGCCATGCTCTCCCCTCTGCCATGCTCTGTCTTTTGTTTTCCTTTGGCAC
CAGGGATTGAAGGGTGTTCCACCCTTCAATCTGGAGCTGTAGCCCCAGTCCTTTTATTTT
GTTTTGAGACAGAGTCTTGCTGAGTTGCCCCAGCTGGCCCTGAACTTGCTATCCTCCTGT
GTCAGCCTCCTGAGTTGCTGGGATCACAGGCAAGATGGCAGCTCTACCTTTAAATTGGCA
TGTTTAGTACATCTGTATTAATTAAATAACTAAATTGAGCTTAGATCCACATGATTTTAA
ATCACTCTGTCCCCTGCTCTGTCTTTTATTCGTTCCTTTATGCTGACCCAGGGTTTGGAA
GATGACTCTACTATGCTTCTCTGGTGGCCTTTTGGCCATGTTTCTTGCTGTGGGCCCTGG
TGATGGCACCCGCATCCTTGACGTGTGGCTTCCATGTCTGGGAGCCTGCAGTGGCCTGCC
GCTCTTCTCTGTGGCTTGGGAGTGGCACAGCCTTGCGGTACCTGTGGCTCAGGCCTCTAA
TGAAGATATCCTGTCGGGATGTGGACATGGGCAGGTTGGAGGCATTCTTTCCAGGCTGGC
AGCTCTTGCTGGACATTAAGAGCTGTCTGTCCTTCCTGAGCAGGTGCTTATGTGGGCAGG
ACATGTCTGGCCAACCCTGGCCCCTATCTGTGAGGGCTATGCAGAGCTGTGGACCAGTGT
GTTTGCTCAGGTTGGTGTCTCCGTGGTCCTTAGGAGCCTGGGAGTTTTCTCCATGGCCAT
GTGCACAGTTATGAAAGTTTAATTCTGGGTTTTCTCTTTCTCTCTGAATGGAGTCTTCTT
TTTCTGATCTATTTTATTGATGTGTTGTAACTGTATTAAATGGTGCCTGGTGTTGGAGCT
TCTAGTTTATGTACCCAGAGGCCATTGCTGAGAACCCTGAGGGATTCTACAGGGGTCTTG
CAGTTTCTCCTGCTACATGGCCACCATGTGAGAAGTAGATGAATTTCCCAGCCGTGTGCT
ATGAAAGCACTCAGACACACAGATGTGGAAGACGTGCCTCTCGACGACCACAGTCCATCA
TTTGGAGTCTGCAGCTCCTATGTGACATTGCTTGGCTTTGTCCCAGATCTGCCTGTCATT
CCAGTGCCATGGGTAATTTAAATCATAAATGGAGGGACTCAAGGAGACTCCTGCCTTACC
ATCTCAGCTGGGTGCCGCAGTCTGGCTGGGCACAAATCACGAGCCACTCAAGCAGGAACA
AACTTTATTTCCAAACTAAACCAGCACACTCTCCGGGAACTCTCCTGAATGCCATCCAGG
AACACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTA
ACATGTTTCAAGTAGTTTTAGTTTTATTAATAAATATTCCAGATAAATACACAGAATACT
CCAAAAATGTCTCCCTGTCCTGTTTTCATTCCACTTAAACATAGGCAGGGGTGAGGCCGT
GAGAGACCGAGACAGGTGCCTGAAGGTCCCTGAGGAGCTCAGGCCCTTTAGGACCTTGGG
GTCTGGGGTGGGCCGCCTCCTGGTTCCTGATTGGAAGACATCCTGACTTATGCTTTCCTG
GCCCTGGGCCGGGGATTTACCATAAGCCTCCCTGTGACACTGGTGGCCAGTCGATACAGA
GAACTCCTTCAAACGCCCAGCAGTGTGGGCCAGTCATACTCCAGAACTTCTCAGAAGGGT
CCTGAGTGTGGCACTTTCAGCATTGTCCACTGTGCTCAGTTTTGCAGATCATAGGGTGGG
TCACAGACGAGAAGACCACTGCCCAGTACTGTATCTCAGGTGTCTCCTCCCTGTTCTCCC
TCCTCCTTTTTAACACCAAGGCTTATAACAGGCACAACAGTTGCTCCACCCACCTGTTTC
TTCTTGTTCCAGATGCTGACGACTGTCCCAGTGACAGGGAGAGCCGCAGGGACTTGGTTC
TCATAGACTCCCTCTTCATCATGGATCAGTTCAAAGCTACAGAGAGGGTGAACGTGGGGA
AGCCCAACACCAAGGACATCGCAGAAGTCACTGCTGTGGCTGAGGCTGTGCTGCCGAAGG
GCAGCGCCCGGGTCACCACCACGGTGAGGCGCTGGGGTTGAGCGGCTTCCAGACCTGCTC
CAATCTGGCCACTCGTGCTACTGGAGAGGCAGTCCTCTCTCTCCGTGTCCCAAGGATATC
TGCTCCCACCGGTTTGCTGCAACTGCTTTGATTGATGTGTGAGGAAGGTTTGATGACAGT
TCTCATGGGTGGGTATCCTCTACTGTCATTGTCACAGGTGAAGTTCAGCGCACTCTCCTT
GTTGTACGGTGCCCTGCGAGATTATCAGAAGATCGCTCTGTACTGACTGGCCAAGCTGTA
CCGGAAGAACCTAAACGGCATCCTGGCGGACGAGGCCGGGCTGGGCAAGGCGGTGCAGGT
CATCGCTTTCTTTGCTCATCTCGCTTGCAACGAAGGTGAGTGCCTGCGGTTCCCGGTGAG
CAGGCCAGGTCTGCCAGACTGAACCGTGGAATGCCTGGGCACGGCCTTTGTTCTTTTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGACAATTCGT
GGTCCCTGTTCTGTGCAGGTCTAGCATTGGCTGACCAGATGGCACTCATTTATGAGTCCT
TGTGTGGGGCAGGCAGAAGCATCAGCTGTTCACTACAGCCTTGGTCAGGGTCCCACCTGC
CCATGAGGGTAGAGAAGGCCCCTCCTTTTATATTCCTAATAAGCAGGTGTTCAGCTTATT
AGGAATTTTGGAGGGGCCACATTCAAACCAAAACTCTGTATGTAGTTACTAACTTGCTTT
TAAAAAGCGGTCAGCTGCCAGCAGGTATCCACATTCTCTGAACACGGTTTTTACTTGTTC
AGATTATCCACTATAGACACTGCCCGCCTTCAGGGTCCCCTTTGGCAATTTCCTTTGGGT
TTTTCTTTTCCTCCCGGTACTAGGGATTGAACTCAAGAGCATTCAACTACTAAGCCACAT
CCCCAGTCCTATTTTATGTTTTATTTAGAGATGGGGCATTTAAGTTGCTGAGGCTGGCTT
TGAATTCACAATCCTCCTGTCTCAGCCTCCCGAGCAGCTAGGATTACAGGGTGTGTGCCA
CTGTGCTCGGCTAATCTCTATATTTTCCAAATGGCAGTTGTCACTGCTTCCAAGGCGTTT
TGATCTGTCAACAAATGAGCTTTAGCTTGGAGGAAAAGGTGAGCAGGCCAGCGCAGCCAG
TCATGTGCAGGAGCAGGTCGCCAGGTGGCCCCATGGGGCTGCTCTCGGTGTGTGGCTTGC
CTTCGGGCCGCGGGGCAGGCCTGGTGGGAAGGTGGCGCTCTCTCTGCTGCAGGAATGGGC
CGAGCCCAACAGCTTCCACATCTGCATCACGTCCTACAAGCAGTTCTTCAGAGGCTACCC
TGCCTTCTCACGAGTGCGCTGGAAGTGCCTTGTCATCGACGAGATGCAGCGTGTGAAGGG
CCTGACCGAGCGGCACTGGGAGGCCGTTTTCACCCTGCAGAGGTCTGCTGCCACTCCAGG
GCTGGTGCAACCCACTGTCCCGAGGGCTTTGTAGCTGTTCTTGTTACCTGTGGACTCTTT
TGGAGAACACAGGTTGTTGCAGACATGGGGGGCTGTCTTAGTCCAGGGAGTCGCCCTTTA
CCTTTATCAGGGCCTAGGCTGGGGAGGCTACTGACCTTGTTGGCTCAGCCCCTCTCCTCA
GGACCCGTGTGCATGTGCCTTGCTCTGTGGAGCTGCTGACCCTTCTCAGACGCCACCAGA
GAGGAGGGTCGTCATGAGCCACCTCCTCGTATCCCAGCATTCAGTGCTGCCCCAATTTTC
CATGTTTGCTGGGTTGGCTGGGCATGTGCTCACTGACCCCCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTGCTCTCCACACCTGCCGCTGCTGCCAGCTCTGGAGA
TGTCCCTGAGTGCCTGGAATTGGCACACCCTGCACTGAGCTCTGATCACTCTCACACCTG
GTCCTCCAGGGCCTTCCTCTGTGGATGCGGCATTGTCATGGAGCAGTGCCCTTCCCATGG
CTCTGGTCTGTTTCCTGAGTCTCTCCAGACCAGTGGCACCCTGGGGCGGCTGGCCCTGCT
ATGCTGGTCCAGGGCGGCCTCCTCCCCCTAGAGGTCTGCCCCATGCTGCAGCTTCTGTTT
CCTCCTGGACCTGGCTCTGGTGAGCCCTGGGGTCTGCCTGTGCCCTACTTCACCACAGTC
AGGGTCGGGCACCTGCACCCCTGCCCCGAGTGGGTGCTGGGGGCCCTGCTAAGGAGACTC
ATCCCACCTGGGCTCAGTAATCTCTGGCCTTCACAGTGCCTCTCAGGTGCCCGTGCCCTT
GGGGACTCATCACAGTCACAATGGGTAATAGTCCTCCTCTGAGTGCTGCCGCATGGCTGG
CCCCTCTCCCTACCAGGGTATCTTTGTGTGAAGAAGATGTGCAAGTGTCAGCAGGTGAAC
AAAGCCGTGTGGGGATTTGGACTTGAATGTTGGAGGTGACTGATTTGCCAGCCCAATCTG
GAGAGGATGTGTAGGTGCCATGTCCTGGCACCAGCAGAGCTGCTAGCGAGGAGCTGAGTG
GCAAGTATTTGTGTCTGCCATCAGGCTGAACTGTGCTTTCCCCGAGCAGGACTCAGGAGG
CTCTGAAGAGTGGTCACTTTGTCAATGTCCTGAGCATCCTGATGAGGCTGCAGCGCATTT
GCAACCACCCTGGGCTGATAGAGCCCCGGGTCCCTGACTCCTCCTACGTGGCAGGGCCTC
TGCAGTACCAGTCGGCCTCTCTGGTCCTAGATGCACTGGAGAGAGGTGTTTGGAAGGTAA
GTGGAGGGTTCAGAGAGCTGAGCCCTGTCCAGTCCCTGCCAGGCACACAGTAGATAAAAG
CCCAAGCATGTCCACATGTGTTGGCTTCCAGTCCCTGTCCCCCCTCTGCTCTCCCTTCCC
TAGCCACTGCCTGTCTAACCTCAGTCTGTGCGTTTGTGTGTCCTGAGGTTCCATGCGAAC
AGGATCCTTTGGTCCTTGTTTTTGCAGTCCTGGGGATCAAGCCCCAGGGCTCCACTGCTG
AGCATGTCTGCAGCCCTTTTCAGGCTTGCCTTGAGAGGTTTGCCAAGTGGTGAGGCTGGC
TGGAGCCTGCAGCCCTCCTGCTTCCCTTCTGGTGGCTGGGATCGCAGGCTGCACCCCCAT
GCCAGGCTGTGGCCTTCCTATTGGAGTTCTTCCAGTGGTGGTGTCCGATGGCTCTGAGTC
TCCAGGCTGAGTGATACCCGCTGACAGGAGCAGCCTGGAGCTGTGTCCCCTGTCATCAGC
TGGGGCACATCTTGGTGTTTTCACCCTTGGCTGTCATGAGTGTGCTGCTGAGAACACGCC
TGCCAAGTTTTCTGCACACCAGGCTGTAGCTTCTCTGGGGTGTGCTGGGTGGGGGAGCTG
GCCTCACGTTGCCCTACACCTGACTTGGTGAAGCTGCTGACTGTGCTCTACGCTGCGTCA
CCTTCCTCCCCAGCAGTGGCAGGAGGGCCTTCTGCTCCCCACCCTCACCAGCACCTGCCA
GGAAGCACAGGCTCGGGCTTTGGCACTAGGCCTGGCACTGCCCTCCTTCTCCCTGGGTGT
CCTGCCTTCACCTGTGTGATCCGCAGCTGCCAACCCTGCCCTTGCCCCATTCCCACGCCC
TCCCCGGGGTCCCTTTGTTAAGGAGGGGCGCCTGGCACCAAAGTGTGCAGCCTGATCCAG
CTGCACAGGCTGGGAGGACCCCCTCTGCAGAGCCTGCTCAGCTGGACTCCCAACCCCCTA
GCAGGGCTGGCTTCATGGTCAGGCTGTCTTTCTGCCACCCTGTGCGACAGGGTTTTAATT
TTAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGTCGCACCGTGCTT
TCCCAGCACCACCCGCCCGGACAGCACTGCATACAGCTGCTGCGCTCCCAGGTCCAGGCC
CGTGGACGGCCACCGATTGCACGTTCTCTGCAAACCCGGATGCAAAAGGTACCTTCACTT
GGTCGTGGCCCCTGTGCCAGGAGCTCCCTAGTGAGCGCCTGCAGGTCAACACGTTGAGCC
ACCTGGTCTAGTTTTCAGGAGGCGTAGACGTTCTTGTTTCTTACGCTGGGCTTCCCCTGT
GTGAGAAACCTCTCTCTTGGCTGAGAACACGTTGAGGATGATGGCCACCTTGGCAGAGGG
CTCAGGACGTTGCTGGAGACGATTGTTATTACATGTGCCATCATTTCAGCCTAACTGGCG
GTCACTTGAGGACGGATAGGGTTAGATGGCAGAGAGGTCGCAGACGTGGCGTCTTGGCCT
CCACGGAGGTTCCTGGCGTCACACCCACTTCTTCCTCCGAGGTAAGCAGACTCAGGGCTG
CGACTGATGAGAGTGGCTGCCCTCCCAGTGCTGTGTGTGGGGTGCAGCTGTGGCCGGCTT
GGCTCCGCCCGGCCTGCTCCCGGGAGGAGGAGCACCAGAAAGCACAGTGGTAGTCTCTCC
ACTTTGGACCGTCCTCGTCCTGCCTCTGTCTTTTCCGAGAGGGCTTTTCTCTTGAGGACA
GTGTGCAGTAACATTTATGTAATTTCTTTGAAGTTCGGGTGTGAAGCGTTGTCGTTGAGA
AGAACTGCTAACGGCTTTGCACAAACCGACTTATCGATTGCAGCGGCCCTGTTGCAGACC
TCGCCGGCCTTCCGCAAGCTCTAGACACCAAGCCCACCACGACATCCAGCCCGGCAGCTG
GCCCTGCCCCTCCTGTGGGGACCCGCGGGGCTCAAAACGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACCTTGAC
AAGGCGTCTGCCAGGGGTGGGCCTCTCCAGAGGCAGCATCCAGGCCCCTGCTCCTCTCTG
CGCTTTCTCCTCACCCTCTCGGCTCTGCTTTTCTCCTGTGCCCCTCGCCACACTGGGTAC
AGGTCAGCACCTCCCTGGTGTCCACCAAGGTCTCTCTCCGTCAGCCCGCAGCCACTGGGG
CGAGTGGTAAAGCAGTGGGCACTACGGCCTCCAAGCCCTCATGGGTTGTCAGGTGCAAGC
CTGGAACAAGCTCTTGCCAGCAGAGACCCTCAACTTGATGCAGTGGCCGGAACTGGGCAC
CTTCACTCGTTTTCCCAGGGCAGAGCTTCCTGCTGCTGCCTAGGGGGACTGGCATCCTGC
AGAGCCCACCTGCCTACGTCCTTTCTGCTGTGGAAGTCATCCCAACTTACCACATCGTGG
GCAAGGTGCTGCTCAGACACTGCCTCACGGACTTTGTCAAGTGACCAGACCCCAGCGAGG
CCTCCTGGAGAGCCGGGAAGGGAGGAGGAAGCCATGCAAGAGGCGCTGCGCCTAGCCCGC
CCCTCGTTCCCAGCCTCTTTATGCCAGTCGCAAGTGGCCATCTTGCACCTGCTCAGGGAA
AAGGCCCTTGCTCGCCCCGAGGCCAGAGTCACTGAGCCATGAAAGGCGAGCCACATAGAG
AGCATGGCAGTGGGCAGAGCCACTGTCTGCCCTGCCTGGTCACCACCGCCTGCGGACCGT
GGAGGGCTGACGGGGATTTGAGCCTGCGCGTAGATCTGTCTCCTGCCTTCATTTCCCCTC
TCGTTCACGGCTGTTCTGTGGCAAGACATCCTTGGAATTTTCCTGGTCCTTACTAACCCT
TCTCTTTATGGTGTGACTAATGGTTCTGGCATGGATTTCCCTGGGAGGGACACTTGGCCT
TGGGTGCCAAGGGCTGGGTCACGGGATCGGAGCTGCTGGGCAATTGTGGCCTGGGCGAGT
GCTGCCGAGTTGGCACTTCTGACGATATGCAGTGGTCTTTCAAAACAGTGCCAAGTTCCA
CAAGTTCCACGTTGCCTCTCAGTGCACATTAGGGGTCGTGTTTGAGATCTAACTCGAGAT
CCCTTAAGGCTTTACCCCTTAAAGCTGTACGTGTGGTTTATTTATTTAAACACTTCCCTA
GAGTTTGAAAATACGATTGTAAGGGAGCTAATTGTTTGTTCTTTTTATCCAATGTAATTG
CTCTCCTTTTTTTTCTTAATTTTTTTAAATTGTAGATAGATACAATACCTTGATTTATTT
TTATGTCGTGCTGAGGATCCAACCCAAGGCCTCATACGTGTCAGGCAAACGCTCCACCAC
TGAGCCCCAGCCTAGCCCTTTATCTAGTGTGATCTTATTTGCCTCTGTGAGCTTAAGTTG
ACACGTTTTTTTTTCATTTTTAAAATTCTCCAAAGAGAATTAGGTTGATAACAGGGTTTC
TAGGTTTATTACAAGTAGATTTCTATTTTTGATGTTTGCTTTTTTTTAATAGCATTACTA
TCTGACATCTAAAATCCCTACCGTTTGTGGTTAAATAAGCAAACCATTAAAATCTATCAT
CTGATTGCTTTCTTTTTTCCTGTAAGGTAGTTTTTTTTTTTTCTTTTTCAATCTACACTT
TAAAAAATACATTTATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGCACTGCTGGGACCAGTTTGCGTAGGTCATGGTCATT
CACCACAAGTGATTGGTGTATCACACAACAGTCCTCGACTTTCCCAAATGGTGTTAATTC
AGCTTTTCCTCTACATTTCCCCAGGTGGAGAAGTAGTGAAGATAGCTCAGCTGGCATCCA
TTGCAGGGCCTCAGAGTCGAGTGGCACAGCCCGAGACACCTGTGACGCTGCAGTTCCAGG
GGAACAAGTTCACCTTGTCGCACAGCCAGCTGCGGCAGCTCACGGCAGGCCAGCCCCTGC
AGCTGCAAGGTGAGGGTCTTTTGGGCTCCTGTTTCTTCACCTGGGAGTGGAGTTAACAAC
TCATGGGGTTGTAGGGGACTGGTGGGTAATACTCATAAGCCACCTGGTTTCCGGCTATTT
GATCTGTGCATTAATGACATCTGCCCCTTGAAAAGAGTCTTATTGTGTAAATCCATCTAG
AAATATTTGTTGTAGGAGTGTGAGGTGAATTTTCCTAAGTAGATTTCCTGGAGATTTATG
TAAGAGAAATTATTTTCTTTTACACACAGATGGTTTCTGTTTTGCTTTGTTTTTGTTTTG
AAATGGGGTTTTACTCTGTTGCCCAGGCAGGTCCAGAACTCCTGGGCTGGGGTGAGCAGC
TGGGACCACAGGTGCACACTGCCACCCTGGATGGATGGTTTCACTTAAACTCCCAGGCCT
TTGGCCAGAGTAGCATGCCTATCCAGTCGCTGCTTTTAAAAGCAGGGAATGAGGGTCATC
TCCAGAGATGGCCTGGCAGCAGTTAATGGCTTTGGCTCCTCCATCGGGTGATGCCAGCTG
CCTGTTAGTGCTAGCAAGAGTTAGGAGTAGTGGCCCCGCAGCCTGGGGCAGTGCCCTCCC
CTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATTCTTTGCCAGG
CCCGGGGCTTCTTTTTAGGGGAGGAAGTTTCTTCCTTGTGGGGCGAGTTCCGTACCACCA
GTTGTTCAAGCCTTAGAAGCTGGGTTCCCTCAGGGCACCTCTGGTTTTGGTAGCACACTT
CAGGGAACACTCTGGGGGCAGATGTGGGGACTGGGGCAGGTACAGAGTCAGTGGTGCTCC
TGTGCAGCCTAGCAGGGGCCTGGGCCACACCCCAGCTTTCTCTCCAGTCCTGTGCTCTCC
ACGGCACTGTTGCAGGTGCAGGGCTAGGTTGGGCTTCCTGTGAGCTCACCACCTGCAGAG
AGGTGCCAGGAGGGTGAGGCTCTGTGGTGTGGCCCTGCACTGGGGTCCTGCTGTCTCCTC
TTTTGCCTTGTGTGCTCAACTTTTGAGTCTCCAGTTATGAACTCATTAGCTTCTCTATGG
TTTGGAAGTGACTGTCACATGTGGCCATGATGCTCCCTTGCCATGACTGATACCCTGGTG
GATGTGTGATTGCAGGCAGTGTCCTCCAGATCGTATCTGCCCCCGGGCAGCCCTACCTGC
GAGCCCCTGGCCCTGTGGTGATGCAGACCATGTCTCAGGCAGGCACGGTGCATGGTGCCC
TGGGAAACAAGCCCCCGGCCGGCGGCCCCAGCCCTGTGCCCTTGACCCCACAAGGTAGGG
TGTTCTGAACCAGGGGGAAGGCTTGGCCCATAGCCTCCTCCTGACTCTTGTGAGTGTTCA
GGAGGTGTTTGGGCCTCCCTGGCCATGGGTCCTTGGTGTGTCAGAACCCTGCTCTGACCG
CCTCTACTTCCACAGCTGGGTCATGGTGTCTGCCTCTGTCCCCATTTGTCCTCAGAGGTG
CTGGTTCAGTATGACCAGCCCCACTGTTCTGAGGTTTTTGTTTTGATCTTGTTCTGACAG
GAGACTCTGGGAATCATGAGAGTCTTTGCTTGCCAACATGTCCCAGATAACACTGAGGGA
GCATGCTGAATTCCCTGGGGACTATGCCATAGGATTTCATTCCTCTTTGGCTGGCCTGTG
CCCCAGAGCCGCTGGGTTCCCAGTTCCTGTCCTGCCTCCTGCCGATGTCTCCTGGGCACC
CCACCCCTGTGCTCTCTCTCTCTTGGAGAAGTGGGTAGTTTGACCTGTGGAAGCAATAGG
AGGTCTGTGAGGCTAGTGTACCTCCCTCCTGACCCGGAACCCTGGCCGCTGCGTGCGTGC
CCAGTTCCAGTCCCACTGCCAAGTCACCCCGGTGATGCTGGGTAGTCCTCTGCCTGCCAT
TGTGGTGCTCCACCAGTGAGGGCCCGAGGAGGTTGCAGGGCCTGGACCAACGAGCAGGAG
GTACACAGCATTTCTGTGGGTGTCACCAGGAGTCTGTGCCCCACTCTGGCCACATGCCAC
CTCCAAGCACGGCAGAACCAGCCCCCTGTGCTCTCGGGAACTAGGGAGCCAGTGGCTGCC
CATACCCAGAGCCCTGGTCCTGGTGCAGGCTGCGGCTGTGGGACTGGACCATGCTTGGCT
GTTCCTTAAGCTCTCTTTTGCACTTGTAGTTGGAGTTCCCGGGCGAGTGGCAGTAAACGC
CATGGCTGTGGGAGAACAAGGGCTGACCTCCAAGCCAGCCTCTCCTGTCACTGGGCCGAC
CCAGGTAAGGCCTTCACTAGTGGACGCATCGTGGAGTTGTAGCAAGGCAGCCCTCATAAG
CCGCGTGCCAGCTGCAGCAGCGGCCCGTGTGCCTCACCACACTTCTTTCTGGACTCAGAG
CCTTGATGGCAATTACTCATTTTTTGCAGTACATCTTATTTTTGTAACAGTTTTGTTTTC
ATCAAGTGCCCTTTTTGTTAGCAGTTCCCACAGTGGGAAGTGACCCATCTCCTCTTGCAG
TGTGTCTGTGGACAGGTCCCTAGGACAGGTGAAACCCAGGACCAAGGCTGGCTGTGGTCT
GAGAGAGACGTGGTTGCGGGCCAGTCCTCTGGCTCTCCGAGCTTTCCTCTGGGGCACAGG
AGTTTGTGGTTTGAATTTTAGCCTGGGGCCCAGTGGCCACGGTGGCTGATGGTGACTGAA
CCAAGAGGGACATCTCCAGAAATCACATCTGTGTCATTTTCTGCAGTTTCTTCTCTGGAT
CCCCAGTATTTTGTTTTGTCTGGTATTCCCCAGCCACGTCCATGTGATGACAGTGGAGCT
GGGTACACTAAAGGCAGAAGGTCTCGTGTGAAGTTGAGTCACACTGTGGGCTGGGCCTTG
TGAGCTGGGAGCCAATCCCCATCCACCAGGGTACAGAACTCTATCCCAGTTTCTTCGATG
CTTCCTCCAAACCTTTTCCTCCACAGTTCTAAAAATAAGCAGGTGGTCAAGTGAAGGTCT
GCACCACGGGGCTCACTGCCATTTTCTCCCTGCTGGGGCTGAGTGGCCTGGCGAACAGGG
CTAAAGGCATAGTTAGTCCTTGAGGTGGCAAAGAACCCACCACGCACAGCCACTTCTGAC
ACCTGTCACGATGGTCAGAGTGTCGGCCCAGCAGTGGTTACAGCCCACAGTGCCCAAAAG
CTACCTTGATGGCTTTCTGCTGTGTGTCCCCAGGAACACAGCAGCAGCTCGTGCTGGCCC
CGGTGACAGGAGAGTGAGGGTTGCAGCACGGGAGCGTGGGTTCAGGCCCCAAGCAGAGCA
GTGACGGCTCTCTTGCCGGCCCATGGGGGCTGCGCCCTGGAGCCAGTGGGGCACGTTCTG
TGCTCCACACCACTCTGGGCAGTCGGCCCTGGGGATGCTGACCCAGGAGCAGACTTGATG
AGAGTTCAGCTTCCTTAGAGGACTCTCAGCCTCAAAAAAACTACCATTTTGCTTTGAGGG
CTCAAGGTCATCCTCAGAATTTTGATTTTTTTAAACACACCCTAACTAGTGAAAGAAGAG
AGCGTGAGCTCTGGTCACAACCCTTCCCCAGCACTGATGTGCTCGCCCGAGTCCTGGAGA
GGAAGGAAGCCTGGTGCTCCTGCTCCTAGGGCTGCAGATGCTGGCACTGACACCAGGCTG
TTCCCGGTGCTGGGGAGGCGCCTGGCCATGCTTTTGTCCAGTGACCATGTTTCACCCGTG
TTTTTGGTAAAGGAGGAGAAGAGCAGGCTTCTGAAGGAGCGGCTGGATCAGGTCCACATG
GTCAATGAGCGGCGCTGTTCCCAGGCCCCCATGTACGGCAGGGACTTGCTACGCATCTGC
TCCCTGCCTGGCTGGGGAAGGGTGCCCTGGCCCACACCCGTTGACCGCAGCTTGGGAAAG
AGGTCCGGGCCAGTGAGCTTTCCCTCAACCCCCTCGAGAAGCGTGGGTGATCTGATTTTG
AGCTTGAATCGACGCCAGGAGTCCCTGCAGGACGTTCTGGACAGGTAAGGCGGGGTCCAG
GTAGGGAGAGGCCTTGGCCTCTGCTCCCTCGTAGTGCCGCACCCTGGTAGTTTTCTAGGT
TGGATTTTCTTATTCTCTGCTCGTCTCCCTGAGTTGCCCCTTAGGAGTGTTTGAAGCCAT
TGTTGGCGGTCTGTAGCTTTAGGACCAGAGAACTGTTGGCTGGGCATCCCTCTTTGAATG
TTGGCGGTGCTGGGGGCAGGGCCATGGCACACCGTGTCCTGTACTTCTGCTCAGCTTCCT
CCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTGCAGTAGCCCTAGGGATCACATCTAAA
ACACAGCGTGCCCCTGCCCCCAGATTCCCAGATGGGCAGGACTTCAGGCAAATGGGGCCA
CCTGCGAGCTGGCTCTATGGCCTGTGACACCCTGAGCTGGTTCTTGCAGCCTGGGCTGTC
TGAAGTGGCCCAGAGGCTGTCTTCCCCTGCACTGTCAGGCCTGCTTAGGCCACGCAGGGC
ATTGTTCCTAATGCCTGATGTATACCCTTGTCCTCTGCCACACTTGTTGCCAGGTAGCTC
TGCCCTCCTCCGCCTGGACCTCTCTGCCTGCCAGGGGACCCTGGGTGCCACGCAGTGATG
TGATGGCATATGCTTTGTGCTTTCTGCTCTGCAGGGTGGCCTGTGTGATCCCTCCGGTGG
TGGCCACACCCCCTTCCCTGTGGGTGGCCAGGCCACCCACTTTATACCGCCGCAGGCTGC
GGACCTTGAGGCAGCGACTGCGAGAGCACACTGCCCCCTATGCCCAGCAGCTGCGGCAGC
TGACCTCCCTGCGCTCACTGCAGTTCCCCGAGCTGAGGCTGGTGCAGTTCGACTCAGGTA
GGCGGATGCCCTACCCACGTGGTTTGCTGCATGAAATGCACCTGCATGACTGCAGGGTGC
TCTTGGTGTTGTCTCCTAGGAAAGTTAGAAGCTTTAGCCGTCTTGCTCCAGAAGCTAAAG
TCCGAAGGACGTCGGGTGCTTATTTTATCCCAGATGGTTCTCATGCTAGACATTCTGGAG
ATGTTCTTGAACTTCCATTATCTCACCTATATAAGAATTGACGAAAACGCCAACAGTGAG
CAGCGACAGGTAAGAAACGCGACACCTTGAGTCATTTGTGACCCAGTGGCACTGGTTCAC
GTTCCCTCTAGGGACCTCATTTCTGTGTGCCATGTAGACTGTTGCCCTGATCCTCCGAGG
GAGTGTGAGTGCAGCAAGTCTGTCTCCTCCCTTGATGTTCTTAGCATGGGTCGTACTGCC
CAACAGGACAAGGCACTGACCTGCCGTCACTGCCGGACGATGTCATACTTCAGAAGGTGG
CTCTGGGGTGACTTAGGGTTGAAGCACGTGCCTATTTTTTGCATATCAGATTGGCTAGAC
ATTGCTCTGATTCCTCGGGTGTGAGACCCACTGCACATGCTGCCAGGCGTTGCCCTGACG
TGACTTTATGGAAGGCAGCATGGCACTGTAGTTCACCTTGAGGTGGACAGATGGCTGGCC
CACCAACCCGCCCCAGGACCCCCTGGGACAGCAGCAGTGCACCCATGGGGTGCTCATGTG
TGTGGAGAGCACGTGCGGAGGGGGTGTGTCACCTGCCCACGTCTCATAGCATGTGCAGGT
TTCATTGTGGTGGACACACATGGGGATAGTCCCAGAAGGGAGGGGCTAGCTAGCTGGTGT
TCCTGGCAGTAGTTTTGCAAATTTTATGTAATTTTTTTTAACCCAGGGGTACCACATCCC
CAGCCCTTTTTTATAATTTATTTAGAGACAGGGTCTCACTGAGTTGCCAAGCACCTTGCT
AATATGCTGAGGCTGGCTTTGAACTCTCAATCCTCCGGCCTCAGCCTCCCAAATTGCTAG
GATCACAGGCGAGTGCCCCCGCACCCAGCTTATGGAGTTTTTTGGAGGAGGAGTATCAGT
TAACTCTTAGGTCTTGTTCTGGTGTGGAGATATTTTACAAAGAAGCTTTCAAGTTGCCAT
TTCGGGTCATGGTCTTGAGTGGGCAAGGAGGGTCTCTGCACGGACTGGATTTTCCGTCCT
CAGCCTTACTCCAGGGGCTTTTTTGCCTGTGAAGTGCCCTGGCATTGCCTGAGGATATAA
GAGAAAGCACGTGCCTCCCCACAAGGCTCTGATCTCGTGGGCCACAGGCTGAGCTGACAG
TTAATGCTTGGGGCGGGGGCTGCCTGACGTCCTGCACTCCTCAGTGCTCAGAGGTGCTTC
TGATCACAGTGGGAGGTGATTCACAGGCGGGAAGAGCAGAGCATGAGAGGTGACACTGTG
GTGTCGCTTTCCCCTGGACTTGTGTCACGTGGAGCCAAACNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCAAG
GGTGCAGTATTGCCAGGACCTGGCCCAAGATTGTGTGGAGCAATTGTTCTGGCTCCTGTG
TTGAGGCTGGGTCACGGCAGGCCGGGGAGCCTGCGGGACAGAGTGGGCAGTGGTGGGGTG
GGACTTGTTGTGGGGCATGACTTGTTGTGGGGTGTGAGAGGAGGGCGGCTGCTCCAGCAG
GGGCCAGCACTGCGGCTGGAGACTGATAGAGTAACCTTCTGCTGTTGTGGGCATATACAT
CCCGAACTTGCCTCTGGTGACCAGGGCGCGGCTGCAGGGCCATGCTCATGGGGGAAGAGG
GGGTTGTGCCTGAAGGGAGCTTCAAGGAAGATTTCTGTTGAGGTCTGAAAACTTGCAGAG
TGTGTGCCTCACAAAGCTCCAGCTGGATGCGTTTGACTAAGTGACACACATGGCTGTCAC
CCTTAGTCACCACTCAGAGGCGAACCTCAGAGGGAGGGCTGGTCACAGCTAGTTTGAGTT
TGGTGTAAGTGGACCCTGACTGGGCCCCTGATCTGCGTGGTGCAAGTCTGCCTGCTGTCT
TTCTGGGGAGCCTTCTGCTGGGTGAGCACTTAGCTCTTCGCTCAGACCTGCTGTCCTAGC
TTGGTGGGCTCTGTTTTAAAGCTATTCCCGTTGTCTTGTGCACAAATGCATGTGAATGTG
AAAACAGATTTCTATGAGGCACGAGCCCCGGGGTGGGGTCCTGAAGGTAGGCCAGCAGGT
GTGCACGATGAGTGCTGAGCAGCCTGTGTGTGCAGAGGGCATATGGTACCCATTCCCCTG
CTGCAGCATCTTGCACCCTTCAAGGCTAGGTGCTGGCTGGGGGACTTGTGATAAGTCTTT
GGCAGCGGCTTTATTTGCGTCTTGCTGTTGAGTAATACATTTGAACACCCCCTTGTGTTC
ATGGCAGTTTGGATGTTTCCCCAGCCCCTGTGGCGCTGGGGTCTGACCCAGGGGTTTGCC
TATGCTAGGCAGATGCTCTTCCACTGGCCCACGCTTAATCCCCTGATGCTTTCAAAATAA
AGTGCTTGGTCAGGTTTCTCTATTTGTTTTAAATTGGGTTGTCTCCCCTGCCTCTCCCAT
TTTCCTTTTTACTGGAACCCAAGGGTGCTCCACACATAGCCGTGGGATCCCACAGCATCA
TTTGTTTGACCCATGTCACTCCCAGTAACCACCCCCCCCAAGGTTCCTCGAATCCACTTT
CTGTGTCCCCGGGAGCCTGGTCCTTCCACTGGCTACTCCCAGGGATTGGCATGCTGCCAC
ACGGACGCCTCTGTTGGAAGAGCGTCTCGGTGGGCTAAGGCAGACTCTCTTCAGGCCCTC
AAGAGCATTGAGGATCTGGAGGAGGACACACAGAAGGCCGCAGAGGAAGCAGTGCCCGGA
GCAAGCGCTGGCCTGTCGACCTCAGAGGTGGGCAGCTCCAGGTGTGAGGAGGAGCCTTCA
CAGCTGGAGGAGCTGGCAGACCTCATGGAGCAGGTGTGGGCATGGTGGAGTTGCTTCTTA
AGCTGAACGTCTTAGGATTCTGATGCTTTCTGAAAATACTTAGAGTACTTTTTTCCAGTC
TGTTTTTTTTGTGGTGCTGGGGATTGAACCCAGGGCCTTGTGCATTGCAATGTAAGTGCT
CTACCAATTGAGCTGTATCCCAGCCTAGAGCACTTTTTGAGTGACATATTGGGGAGCACA
TTTTATTTTGAACCTTATTAACTTTTACTAACTTGCTCCTAACCCTATTTTAAAAATATG
TGTTTTTGAAATAGCTCACACCAATTGAAAAGTATGCTTTGAATTACCTGGAATTATTCC
ATACGACTGTTGACCAAGAGAGAGAGAGAAATAATGAGGTAAGAGTCAACTTGTGACCAT
TTCACATGTGAGGAGTTTCAGATTTTTTGAGTGTTGACTTTGATTGGAAGTAAATGTGAC
TTCATTAAATTAAAAGGACAGAGCCTCAACCCAGCAGTGCTGAGCCGCCTGAGCCCTCCC
CTCTCCCTGAATGGTCCTGTCTGATTGGATGCAGCTTGGCCTGCCAGGCTCTGAGCGCCC
GGCTGGCGGCAGCACTTCCAGCTCTGGTTCTGATGTCCTTCCCCATCCTCCCAGCAGGAC
TCAGTCCTGACATCGGTAAGGGACTGGGAGGCCCACAATGCCCAGATCCTACAGGAGAGA
GAGGCCCAGCTGCAGCGGGAGCAGGAGGAGGCAGAGCTGCTTACCTACACGCGGGAGGAC
GCCTACAGCATGGTATGGCCCCACCTGCACCTGGGCTCCCTGTTCCTGCCGGCCTGTTGC
AGGCTGTGCACCTCAGCTACACCTGGGACCACCTTCCTCGCCTCTTGTACTTGAGGGGGT
GCACAATTAGATGCTGGCTTTCCCTACAGCGAATTTCCAGCCATGGGTGAGACACTTGAA
GTCTCAGTTGCACTACTCAGACTTACTCCAGAGACAGGAGTAAGTGAGAGTGAATGGGTG
GTGCTGCATAGCACGGGGCTAAGACTTGGCTGGGTCTTTTAACTTGTCCACTTTGTGCAG
GAATATGTCTACGAAGATGCCGACGGACAGACAGAGGTCATGCCTGTAAGTAACCGCCCT
CAGCTTGTGCCCAAGCGGCCAACCCTCCACAGCTCCGTGGCTCACAGGAGTCTTTCTGCG
CAGCTCTGGACCCCACCCACCCCACCCCAGGATGACAACGACGTGTACATCGACTCTGTC
ATGTGCCTCATGTATGAGGCCACACCCATCCCAGAGGCCAAGCTGCCCCCCGTGTATGTG
AGGAAGGAGCGCAAGCGGCACAAGACAGACCCCTCGGGTGTGTGCTCCACAGCTGTGTCC
CAGGTTGCCACAGTCCGTCTCAAGTAGCTGTGGTTTCCTGCCTCTGCCAGGGGGTGGCAA
CCACAGGCTCATCTGTGATCTCTTGTCCCACGTCCACGTGTCCCCATTACCAGTGAGGCA
GTTTGTCCTGTAGCAGTCCCTCCTGAGCCCTTCAGTCCTGGTGCCCCGTGGTGGCCCTCC
TGCCCTGTCTCCCCTGGCGACCCCTTGTCTCTGGTGTCCCTTCCCTGAAGCCAGCCTCTG
GTTAGCTGCAGGCAGGAAGAAGAAGCAGCGGCACGGGGAGGCGGTCGTCCCACCCCGATC
CCTGTTCGACCGGGCAACGCCGGGCATGCTGAAGATGCGGCGTGAAGGCAAGGAGCAGAA
AAAGAACCTGCTGCTCAAGCAGCAGGCGCCCTTCGCCAAGCCCCTGCCCACCTGCGTCAA
GTCCTCAGGGGAGCCTGCCCAGGACAGCCCTGAGTGGCTCATTGGCGAGGACTGGGCCCT
GCTGCAGGTGTGTGGCATGTGCAGGCCTGGGGTGGGGCCTGGTGGGGCCTGGAATGGGGC
CTGGCGGACAGCACTGGCAATCTGCCCCTGCCCTCCAGGCCGTGAAGCAGTTACTTGAGC
TTCCCCTGAACCTCACGATCGTGTCACCTGCCCACACACCCAACTGGGATCTGGTCAGCG
ATGTTGTTAACTCCTGCAGCCGTATCTACCGCTCTTCCAAGCAGTGCCGCAGCCGCTACG
AGAACGTCATCATTCCCAGAGAGGAGGGCAAGGTGAGCTGGCTGTGCGGCCCCTGGGAGG
GCATGTCTGTGTGCAGCTGGCTGCCCCTGGGCTCTGATGGGAGCTTCAAGGAGCAGTCCT
TGTGCCCAGCTCACAGGCAGCCTGGAGGGGTCCATGCCAGCTGGTCGGTGAGGGTTGTGG
CTGTGCTGGCTGCAGCCTTGATGTGTTATCTCACCTGCATCTGTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCACTGCCCTGTGCTGACAGCCACTGTCTCACCATGG
GACTGGGAAGCTGGAACATCTCCTCCTATTACCTGGTTTGTGAGGCGAAGGCTCAGAGCC
AGGCTCACAGTGGTGGGGTGAAGGTGCTGCTTCTGTGAGGTATAGGGCAGGCCCAACGGG
GCACCTGCCTAGCAGTGGCCAGTGGTTTTCTCTGGAGCCCTGATTCCTGTGCCACAGGGT
TGGCTTCTGCTGGAAGGGGGCCGCTGCGCTCACTCAACCCCCACCAGTGCTCACCACCTG
TGCAGTGCTGTGACACTGCAGGCCGTAGTCAGGGCCAGCAGGTCCCTCGCTGGACAGTCC
TGTGTCTGCCCCACTCTCCTTGCCCTGGGTATGGAGCATATGGCATGCCCACCCGCATGT
CCACCTGCTTGCCCTGGCTGGCTCTTGGTTCTATGGGAGAGGGTCCCGTGTGGTGGTCAG
GACGAGGGCCAGTGTTTTCTAGGTCGGGCTTTCTCAGCATGCCCTCTGAACTTAGGGGTT
TCTCCAGCATCAGCTGCCCACATGTGTGCACCTATCTGCTGTGCCTGTGCCTGGACCATC
ACCATGTCAGCATGCCGGCCTCTGGTCGTGGGGTTGTGGGGCTGCCCTCGTGCAGAGGTG
CCGAGCAGAAGGGCACTGCCAGGAAGGGGCGCTGAGCTTCCTGGGCTCCTCCTGAATGGC
CATGGTCCTGAGCAGGCGCTGCTCTCTGTGCCTCCAGAGCACATGTGCGACGACGGCCAA
GAGGCTTTGCTGAGCTGCAGGGCTTGTGAGGGAAGGGTGACTGGCACGCGTGGTGCCGAT
CCCCTGGACAAGCGCTTGTGGCTGTCCTGGATGGTTCTGCCCTCACATCTACCATGTGTA
GAGGAAGGCCATGTTAGTGGTCATCACTGCTGTCAGTGCCTCCTGAGCACCTGTTGGGGG
TGGTCTGCCCAGGACAGGCACATCCTGCTCTGCCCTCACCCACTGTGAGGCTCCAAGCAC
CTCTGCACAGCCACAAGCAGTGACCACCACTTCATGGTGGTGCTCTAATGGTGCCATTGC
CACTCAGAGCTAGGGCAGGGAAGCGAAGTCGGGTTCAGGGACGCTCTGGCCAGCAGACCA
GCCGCATGTGCCCTCCTCTGTTTTGTTCCAGAGTAAGAACAACCGTCCCCTGCGCACGAG
CCAGATCTACGCCCAGGACGAAAATGCCACGCACACCCAGCTCTTCAGCAGCCACTTTGA
CCTAATGAAGACCACAGCTGGCAAGAGGAGCCCACCAATCAAGCCTCTGTGGGTCCCCCA
CTGGGCAGGCTGCGCCCCGTCCCCCGTGTTCTCAGTGCTGTTTTTCTCTGTGCAGTGATC
GTGTCTCATTCTCTGAACTGCAGGCTCGGCATGAATCCTTTCAGAAAAACCCCAAGCACG
CCTCGGTGTTGTCAGAAAGGTATTTCTGTGTTTGTGACGCGTTTCTTACTGTGTGGAGCC
AGGTCCTGATTCAGCATCCACTCGCGTCCAGTCACCTGGCTGAAGCCTGGGACCTGTGGA
CTCCTGATGTTGGCTGGGTGTGCCGGGGTGCTTCTGCAAGCGGGGGCATGTGGAGAGCCA
TGTGTGGGGCTCTCCACATGCCCCACATGGGGGGCCGTGATTCCCGCTTTGAGTGGGGGG
CCGTGATTCCCGCTCACCCTGGCAGGGTACCTGCTGGGACGGGGTGTGTATGAGGCTGTG
GGTGGCCCGCAGGGCTTTCTTCCTCCTGCTGGCCTCGCCAGCCGTCAGGTTGCTGTGCTT
AAAAACACATCTGGTTGAGGAAAAAACGCTTACCAACAGGTGGGTGATGAGGCTGTGAAT
GGGCAAGCCGTGGGGCTGGACACTGGACAGTGGCGTCAGATGAAGGTCTGCCCCATGCAG
ACCAGGGGCACTGTGCCTGGCTTGCTTCCTCCTGGGCTCGCAGTGTCTGTTGCTCACTGC
TGCAGGGAGTGTTCCCTGTCAGAGTGCCTTGGCTCTGGCGCAGCCTGCCTCTAGGGAGGG
ACCGCATTCCTGAGAATCTTCGTCCTGCCCTGGTCAGATCATCTTCAAGATGTGCCCTGG
GTATGTGTGATGTGCTGACTGCAAGCCCTGCTGATACAGGGCTCCTAGTTCAGGGCAGAG
AGCCTCAGTTCTCAGGGGTTGTTTAGAAGACTCTTCCCCTGGAAGTGCTGTGGCTGGGTG
TGGAGAGAGGCTAAGGGCTGATGTCCCAGCCACCAGACCTGCTGCAGGGGCAGGGGCTGC
AGGAAGATTGAGGTAGCCTCGTGCAGCTAATGTGGGGGCTGAAGTGGCCACTGCTATGGC
TGTGTCCATGGGCTGAAGGGCAGCAGGCACTGGTGCCTATCGAGGGGCGTGTCCAGGAGT
CGGGGCTGGACTCTGGCTGGTCTAGACTGTCTACAGAGATAGTGGGCTCGGCGTCCACAA
GGCATGCCCAGGACTACAGACAGCACCGAGCTAACAGGTGCTTATTCTCAGCTAAGTGGA
GGAACTTGCCTCTGCACCTCGTGGAAGCATGGGTCCCTTCGCAACCTGGGTGGCCTCACC
CTGCATAAAGTAGCCCTCATAAAGTAAGGTGCAGTTGTTTGGAACACAAGCTCTGCAGCT
CTGTGCCACAGAGACGCTCAGTCTGGTGCCCAGGATGGTTAGCAGCACCCAGTGTGGATC
TGCTGGACAAAGGATGGGGCGGGAGGGAAGTGACGGTGCGTCTCGTCACACTACTCTGAA
GAGTGATGCTTAGGAACTTAGAAGTTATTTGCTTCTGGGATTTTCCACCTAACATCTTTA
GACTTTGTTGACCGTGGGAAGCTGCAGCTATGGACGCACACGGCTGTGTTCCAAGCTTTC
GCTCTTGTGTTTCAGTGGGATCACCTACGACAAGCCCCTGCCTCCCATCCAGGTCGCATC
CCTCCGTGCAGAGCGGATCGCAAAGGAGAAGAAGGTGAGGTGCTGGCTCCTTGCACTTGC
GTGGGAATGTTCTGGGGCTGGGGGGTCACAGGTAGGGGTCCCGTGCCACCCCTTCAGAGC
TCCTCTCACCACCGAACCTATTTAGGCCTTGGCTGATCAACAGAAGACCCAGCAGCCGGC
TGTGTCACAGCCGCCACCCCAACCGCAGCCCCCGCCACCCCCACAGCAGCCGCCGCCACC
TCCACCCCAGCCACAGGCATCTGGCAGCCAGCCACCCGCAGGGCCTTCCACTGTCCAGCC
CCAGCCCCAGCCCCAAGCACCGCCGCAGCCTGTGCAGGCCCCACCAAAGGGGCAGCCTGC
CATCACCACTGTGGGCAGCGCAGCTGTGCTGGTGAGTCCTCGTACCCTCCAGGGAGTGGG
GGTGCGCCTCCCGCTGCTGTCCCCTGCCAGCCCACCATGGCTCAATGTGCTCACCTGAGT
GGGGGTTGGGAAGGACCCCACAGGGCCGCAAGCAGCTGTCCCCAGCATGTGCATGCAGTC
TCCCCCACACGCCTGTTGGAGGCAGAGTGCGTGGGGTGGTGAGTGAGAGCAGAAGGCCGA
GCGCGACCCTCATGAGGCTGCTGGCACCCGTGTTGTGTGTGGCAGCGCAGCCCAGACACT
AGAGTTGTGCACAGGCCACTGGCGGAGAGCAGGTCTTCTGGCTGGACTGGGGTGCACTCT
GGGCCTCAGCCAGGCACAGAAACAGTTTTCTGATTGTTGTTTTAGAACAGTATTCTCCAT
TAGGTTAGCTTTGTTTTTGCCTTCAGCCTCAGTGGGATTTCTGTAGCAGCTGGGCAAGTT
AGAATGATGCATTGATCAGGCACCTGCTGGGTGCAAGGACCCTGGGAGGGGCAGACCTGC
TGTGTCCCCACTTGCCAGAACATTCTGGTGGAGCTGGGAGGACAGCAGGTGCAGTTGCTT
TATTTTTGGCACTGGGGATTGAACCCAGGGGTGCTTTACACAGAGCTACATCCCCAGCCC
TTTGTATTTTTTATTTAGCAACAGAGTCTTGCTAAGTTGTTGGGGGCCTAAGTTGTTCCT
GAGGCTGATCTTGAACTTGTGATCCTCCTGCTACAGTCTCCTTGACTGCTGGAATTGCAG
GCGTGCACCACCAAACCTTGCTAGATCACTTTAAATGTGGAAGGAGGCGAGCACAGCCAG
GCAGTGACTGCTGGGTCGTAGGAGCCTTTCCCAAGTTGCCTTTGAGCTGAGGCCTGAGCT
GCAGCTGCTCCTTTGCAAAGATGGAGCAGCAAGGCCATGCCTATGGGAGGCTGGCCGTGT
GGGTGGGGTGTGGGTGACTGTGTGACGTGGGTGTGCCAGGGAGTGGGACACACACTTGGA
TGTGCTTTCTGTTTCAAACAGGCAGGAACCATTAAGACGTCAGTGACCGGGACGAGCATA
CCAGCAGGTGAGGCTCACCGGAAAGGGTGAGGTGGGAGAGGATCCCTTCGGTCCCTGCTC
ACTGTGTCCTCCTCCCAGGCACAGTGAGTGGCAATGTGATTGTGAACACCATCGCTGGCG
TCCCTGCCGCCACCTTCCAGTCCATCAACAAGCGTCTGGCTTCGCCTGTGGCCCCAGGGT
CCTTGACCGTGAGTCATCCTACGCCTGGGGATGCTCCGTGGGGTTGTTTTGCAGGGAGAT
GATTTGCTTTTTTAAGACTCCATCAGTGAGAAATGTGCTGGTCTAGCTGAGTTCTGTGCG
GTAGGGCGCTGGTCAGGCGGCAGGTCAGTACACTCAGCGGCTGGGGGCGGTTTCTCTCGT
GTACTTGGAGGGAATGAAGACGGGAGTTTGGTGTGTGTGTGAGACACTTTCCCCGCAGAA
CAGAGGTGGGCAGGACATGAGGATGCAGCTTCCGTTCGTTGACACAGGTGCCTGTGTGTG
GGTGCCACATATCTGTGGGGACACGGGGGTGAGGCACATCCAGGGTGTGCAGAAGCCATA
GGGCCCAGCTGGAGGTGTGCAGGGAGCAGGGCCCCACCTGGCAGAGATGAAGTATGCTGG
CGGAACACGGAGCTAAGGGCACCTGAGCTCGAAGCCAGAAGACAGTGTCTGCCCCCCACC
CGTCTTTCATGATTTACCATAAAAAATAGAAGTAGAATAGCCTAGGCATGTGGTCCCAGC
ACTCAGGAGGTTGAGGCAGGAGGATCCAGGTTCCAGGCCAGCCTCAGCAACCTAGTGAGA
TCCTGTCTCAAACTGTAAAGGACTGGGGACGCAGCTCAGTGTAGAGCACGACTGGGTTCA
GTCCCAGTGCCACACAACAAAACTGAGATCAAGGGACTTAAATTTGTATTCTGACTTCCC
GTCCAGTCACAGACTCAAAGGCAGCACACACTTGAATGAAGTCACAGCGCTCTGGAGGCA
GAATGAGGTCCCTTGGGCTCAGGGTCTTCCTGTGACAGAGCTATAGTATCTGGGTGGTAT
GGTGCTGGCCACAGGACAGGCACCTGTGAGCGGGTTAGGGTAGAGGCCAGGACAGATGCA
CATACTGGTGTGCAGCACTCTGGTCCCTTGGGAAGTGCCAGAGCATCCAGTGGGGAAGGG
GCATCTTCACCCAGCAGTGCCTAATTAGCTGGAGAGCCACACAAAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2341, 3738..3848, 10896..10988, 12303..12408, 12827..13212, 15683..15976, 17360..17545, 18906..19050, 19151..19152, 19253..19331, 20827..20876, 21235..21292, 22519..22526, 22528..22609, 28027..28064, 28067..28123, 28126..28132, 31992..32182, 32377..32442, 32446..32554, 33733..33869, 35752..35921, 37475..37649, 37750..37886, 39829..40015, 41592..41758, 42306..42342, 42345..42356, 42358..42366, 42369..42377, 42380..42385, 42387..42389, 42392..42400, 42403..42405, 42408..42437, 42440..42466, 43119..43146, 43148..43155, 43157..43162, 43165..43168, 43170..43215, 43218..43228, 43389..43520, 45624..45788, 46995..47153, 48029..48123, 49572..49843, 50854..51056, 51139..51308, 52640..52836, 52937..53048, 53149..53292, 54714..54872, 55154..55237, 55497..55631, 55920..55964, 56043..56196, 56465..56706, 56798..56971, 58411..58547, 58643..58655, 58658..58698, 60135..60213, 60325..60570, 61581..61626, 61698..61807
1001..2341, 3738..3848, 10896..10988, 12303..12408, 12827..13212, 15683..15976, 17360..17545, 18906..19050, 19151..19152, 19253..19331, 20827..20876, 21235..21292, 22519..22526, 22528..22609, 28027..28064, 28067..28123, 28126..28132, 31992..32182, 32377..32442, 32446..32554, 33733..33869, 35752..35921, 37475..37649, 37750..37886, 39829..40015, 41592..41758, 42306..42342, 42345..42356, 42358..42366, 42369..42377, 42380..42385, 42387..42389, 42392..42400, 42403..42405, 42408..42437, 42440..42466, 43119..43146, 43148..43155, 43157..43162, 43165..43168, 43170..43215, 43218..43228, 43389..43520, 45624..45788, 46995..47153, 48029..48123, 49572..49843, 50854..51056, 51139..51308, 52640..52836, 52937..53048, 53149..53292, 54714..54872, 55154..55237, 55497..55631, 55920..55964, 56043..56196, 56465..56706, 56798..56971, 58411..58547, 58643..58655, 58658..58698, 60135..60213, 60325..60570, 61581..61626, 61698..61807
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved