Spermophilus_tridecemlineatus Locus EEF2
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus EEF2
Spermophilus_tridecemlineatus
EEF2
GeneScaffold_4301
SNORD37
3357..3421
9675
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNAATGCACACACCCTATTCACCTTGTAAGGTGCCAT
TAATAGAAATGCTTGGAATTTTGCAAACTGACACGAGTTGCAACAGTATGATAACTAATC
TCGCTCTTCGCTTTGGGCACCTGACCACGGAACGCTGGAGCCGGACCACCGCCCCCCGCC
ACGCCCCCTCCCCCGCCACTTTCCCCGGCCACTGAGCACCTGCCACAGAGCAGAGGCGCC
GGCGCCTAATGGGTTAACGACAAAGTGCGTCCTTCCGCGCTTGCGCGCTGCGTCTCTGAG
CTCCGCCCCCACAGCGAGGTCATATGACTCGCCCAACCGGCGTCGACCTATAAAAGGTTG
GGTGTTGACGTCAGCGTTCTCTTCCGCCGTCGTCGCCGCCATCCTCGGCGCGACTCGCCT
CGCTCGGATCTGCTTGGGAGAATCCACCGCCATCCGCCACCATGGTGAGCAATTTCGTGA
GGCTGGTGCCTCAGGAGTGCGGTGGGCTCTCTGCGGGTTCGAGGCTGCCCACCCTGAGGT
CCCGGTGCCTCCTGGACAGGGAATAGACATGGCGGCGGCGGGGCTGGCGGGCTCAGAGCT
GGGGAAGCGGCCGCCGCCATGTCTGTGGGCCCCGCTGTTCACTCGGCCCCTTCCTCGCTT
CCGGAACCGCGGCCGCCTCACGGGACCCGGGGTCCAGCTAGAGCTGGGGGGGAGGAGCGG
ACGAGGGCGTATGATGATGTGGCAGCCGCTGTAATGGCGAGCACGGCGGTGGGAGCAGGG
TGCAGACAGGGAGGCGCCTTATGTAACTCGTGGGCCGTGAAATCGTTTTTTGTTGGGGGC
TGGGGGCGGTAGGAAAATGGCTGGGGGGAAAAGCAAGGCCTGAAGAGGTTCTCCCCAAAC
GGCTCCTTCTGCTGTGCCACCTCGGCCTAAGTCCTTGTTCCTGTTGTTGCCTGAATTGTG
AAAACGTGCTTTGAGGCTGGAGGTGCTGGCTTGTGTCCGGCGCCCCGGCTCCGCGTTTGT
CCGAAATGGCCTACTTAGAACCCTTGGGTGGGTGCTTGTCTCCTCTTCCAGGCAGGAGTG
ACCTTGGGTTTTAATTACGCGTTTACTGGGGCAGTCGGCCCCGTGGTAAGGCAAGTGCTG
GGGAGGCTCCATCCTTCCAGTGGCAGAGTCCCACTGCCTCTAGGGAAACCCGTTTTCAAT
CGCAGAGTCCTCTTCTCTAGCTTCCTTCTTGCTTGTCAATTCTGAATGACAGCTACAAGG
AGACTCTTCAGAGAGTGGCAGTGGTTTTTAAAGGGTGTATGCAGATACTGGCAGTGTGGG
GGCATTGAAGCACCCTCCCTAGGACTGTGCCACAGGCGTGGCAGTCTGTCGACCTAGTGT
GACCTGGTGTTCCCTGCCAAACCCGGTTCCTGGAATCCCTGTTCAGTCTGAACCCCATCC
CCCTTCACCCAGGTGAACTTCACGGTAGACCAGATCCGGGCCATCATGGACAAAAAGGCC
AATATTCGCAACATGTCTGTCATCGCCCACGTGGACCATGGAAAGTCCACCTTGACCGAC
TCCCTGGTGTGCAAGGCTGGCATCATTGCCTCTGCCCGGGCCGGGGAGACCCGCTTCACC
GACACCCGGGAAGGATGAGCAGGAACGTTGCATTACCATCAAATCAACGTGAGCGCTGCT
AGTGCTCTCTGGGCTTGGGCAGGGGTGGGAGCCCAGCTGCAGGCCTCGGGCAAGACACAG
TGAGCATCAGGGTCTCTACCCAGCCTTTCCCCCGCTTCTGATTGGGTTTTCCTCCTAGGT
ACAGTTGGGGTTGTCTAGGAGCCAATTTTGGTTGCACTCTTGGGAAGGAGAGAGAATGTC
ATCGGCCATCTAGGGGTGCTCCTTAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTCTTAATGATGGCGCCCGCTTTTCACTGCTTCACCTTTGGCT
TTTGGTTGCTCCAGCCAGCCAGGGCTTTAGTCATGAGCAGGAGACTTGTGTGGCTTTTAT
GCCACTGACCTCTCCTGTGATTCACAGTGCCATCTCTCTCTTCTATGAGCTTTCGGAGAA
CGACTTGAACTTCATCAAGCAGAGCAAGGATGGCTCTGGCTTCCTTATAAACCTAATCGA
CTCCCCTGGTCACGTAGACTTCTCCTCAGAGGTCACAGCTGCTCTCCGTGTCACTGATGG
TGCTTTAGTAGTAGTGGACTGTGTGTCTGGTAAGCTGTGGGCTCCCATGTGAAGGCTCCC
CCAACCTGCAATGATTGCTGCCTATGCGTGACAGATCCCCACGTGTCCCCAGGTGTATGT
GTACAGACGGAGACCGTGCTGCGGCAGGCCATTGCCGAGCGCATCAAGCCTGTGCTGATG
ATGAACAAGATGGATCGGGCCCTGCTTGAGCTGCAGCTGGAGCCCGAGGAACTCTACCAG
ACCTTCCAGCGCATCGTGGAGAACGTCAATGTCATCATCTCCACCTACGGCGAGGGCGAG
AGCGGCCCCATGGGCAATATCATGGTGCGCCCCTTGCTTTCAGGGAGTTGTGGGATTTGG
CTAGAGGCATTGTGATTGGAGACATGCTTTTTGCTAGGGGTGACAGGGTGACATGTTTTA
GAACTAATTGGACCCAGCTCCTGAGCTTTCAGGGACTCTGCCTAGTGACCGTGTTGTCAG
TGCTGTTTCCCTTTTGTTCTAGAGATAGGGGTCCTGGCAGGATGGGCTGGGCACCCTATG
CGTGATGACTGAAATTTCTTCACTTTGACCTGATGTCTGTTGAAGAAACCTAGCATCTGA
GCCTGGGTGCCCAGGGAGTTAGCTGTGGGTTCTACCCAGAGCCCACCCCCTGCTCATGCC
TCTTTATTCCTCACTCTCCCAGATTGACCCAGTGCTCGGCACCGTGGGCTTTGGGTCTGG
CCTCCATGGCTGGGCCTTCACCCTGAAACAGTTTGCAGAGATGTATGTGGCCAAGTTTGC
TGCCAAGGGTGAGGGCCAGCTGGGGCCTGCTGAGCGGGCCAAGAAAGTGGAGGACATGAT
GAAGAAACTTTGGGGAGACCGGTGAGTCCTGCACACAGCACTGGTGGTGGGGTCTGGGTC
TCTCTGGTGGGCGGGCAGGTGGAGATGGGGGATCCCTGTTTTTGAGTGAGTGCGTTATGG
AATCTTCCCCAAGTGCATTCCCTGTGTTGCCCATCTTGGTCATTGCAAAATCCCTAATCT
GGTGGGGCTGAACCCTTTGTTTCCCCAGGTACTTTGACCCAGCCAATGGCAAATTCAGTA
AGTCTGCCACTAGCCCTGATGGGAAGAAGCTACCCAGGACTTTTTGCCAGCTCATCCTGG
ACCCCATCTTCAAGGTGAGAGTGACTCAGGAGCCATCCAGGCTGATGAATAGATGTGTGT
CCTCTGCACTGTCAGATGGTGTGAGATCACCCCTGAAAAGGCCAGTCCGCTGACCTGTTG
CTTCATTGAGTGGGCAGGAGCAGCAGTCAGGGTAGCTGGTACCTGATCTGTTTCGACTGG
TAGCTTAGGCTTGCCTTCAGCTGCCTGAGAGGTGGAGGTAGCGTAGGTCCAGCAGGCAGG
GGTCTGGTGAGGCTTGGCTTGCAACTTAAGGAGAAAGCACGGGCAGGCCTGCCCGGCCCA
GTAGGCCTGCAGTCTTTATAGGTCAAAATCTGTAAGTTGGAGCGGACTCTTTGCTCCCAA
ATGCCCTGCTCAGAGGTGTGCTGGTGTGTGGTGGGTCAGGCTCTTTGCATCATTAGCAGC
AAGCGGCCATGGGCTTTGTAGGTTTTCCAAATGGGCTTGCTTGTTTGCCTGGCGCTGTAG
GTGTTTGATGCGATCATGAATTTCAAGAAAGAGGAGACTGCGAAGCTGATTGAGAAACTG
GACATCAAGTTGGACAGTGAAGATAAGGACAAAGAGGGCAAGCCACTGCTGAAGGTGAGC
TGGCTGGAGACGGGTCCGTCTCTCCTCCCGCCTGGTCACCTTGTCCTTTCTTTTTTTTAA
TGTTTGTTTTTAGTTAGACATGGTGGCGTTATTTTGTTTATTGGTGCTGAGGACCAAACC
CAAGGCTTCGAATGTGCTAGGCGAGTGCTCTACCGCTGAGCCACTACCCCAGCCTTAACT
TGTCATTTCTGTGGGTGGTCAGCAGCCTGCTGGCCAAGAGATGTGGGCAGGAATTTGCCC
TGCTAGCATGCTTTCCTGGAAGTGGCCATGTTTCGGAGAACTTGGTCCTTGATTGTTGGT
TTCCTTGGGTCCCCAGTGAAAGGAAAGGTGATGTGATGGTCCTGGGGGTTACTAGGCCAC
TTGGGAGCCTCCTTCCCTGCTGTCCTTCAGGCTGTGATGCGCCGCTGGCTGCCAGCTGGG
GATGCCCTGCTACAGATGATCACCATCCACCTGCCCTCCCCGGTGACAGCCCAGAAATAC
CGCTGCGAGCTGCTCTATGAGGGTCCCCCGGATGACGAGGCTGCCATGGGTAAGCAGGCG
AAGCCAGGCCGGGGTGGGACTCCTGTTTGTTGGCTGCCCTGCCTCAGGCCCAGGGTTTTG
GAGGGCCGAGCTGCAGGAGAATAGCTTTCTGTGGTGGTTTCTCTACTCAGGCATTAAAAG
CTGTGACCCCAAAGGCCCTCTTATGATGTACATTTCCAAAATGGTGCCAACCTCCGACAA
AGGTCGGTTCTACGCCTTTGGACGCGTCTTTTCAGGGCTGGTGTCCACCGGCCTGAAAGT
CAGGATCATGGGGCCGAACTATACTCCTGGGAAGAAGGAGGACCTCTACTTGAAGCCCAT
CCAGAGGTGAGTGGTGGGGGTGGGCCTCAGTGCCCCAGGTGCAGCTCTAGAGCTGTGGCT
TGTCCCTGCCCTGCCTGCAGCTGGTGGCTTAGGCTTGCTGGCATCTGCACAAGGAGTGAT
AAGTTTGTATGAGGTCAATTCATCGCCACCTTTGGTCATTATGACTCCACAAAGACGAAC
AGAGGGGGATCCAAGGTCTCCAGAAAGCCACCAGCAAGGTACTTCCTCTGTTCGCCTGAA
CCCTAACTCAGAAATAGGACGAGATGTCCTGAGGAATCAGGTGGGTGGCCAGTTTTGTCC
TCCCCAGAGAGCAGGTAGAGAAGTCCAAGATGGCACCACCAGTAGCTGACACTGCTCACT
GGGCCCTACCAGCAACTGAGAGGGGAGAGACAACCAAACCTCATTTCCGTCATCTGCTTA
GGCCTGTCCTGTGCGAAGGCCTGGCCAATATTCTCAGTGCCTTTGTTCTTGCTTCCCTGT
GTTCACATTCGATGTGGCATGTGTGGCACCCACAGGGGATTTGGAATTGCTGGTGATTCC
TTCAAGTTATGTAGGAAATGCAGCCAGGGCTTGAGGCCCAGGCAGGAGAGCCTTACACTC
TGGAGAGGACTGGGATCTGGCAGAACCAGATCTGGTGGCTGCGCCTGACATTTTCTGCTT
CTCCCCAGAACAATCCTGATGATGGGCCGCTATGTGGAGCCCATCGAGGACGTGCCTTGC
GGGAACATCGTGGGTCTGGTGGGTGTGGACCAGTTCCTGGTGAAGACTGGCACCATCACC
ACTTTTGAGCACGCCCACAACATGCGCGTGATGAAGTTCAGCGTCAGTCCTGTCGTGAGG
GTGGCTGTTGAGGCCAAGAACCCAGCTGACTTGCCCAAGCTGGTGGAGGGGCTGAAGCGG
CTGGCCAAGTCTGACCCCATGGTCCAGGTGGGCAAAGTCCCTTTCCAGTCACCTGGGAGC
AGGTACCCCCACTAGGGTAGGGGTTGTGGGTGACTTCGCAAAAGGAGAGACTGACGCCAC
CCCATGTCTTCCTGGTTGGAGTTGTTGAGGTGACTCTACCAGACGGCTGCCTTCTAGCTT
GCCAAAAAGGTCTCATAGCCGCAGAGAGAGGTTCTTCAATTTTGCAGGCTGTTGCCTCCA
TCTGGCAACTGCTCACGGCCTCGGTGGTCTTGCTCGCCCATGGGTGGTGGTCAGTGGGGG
TTGACCCTGTGCTTCCCACAGTGCATCATCGAGGAATCTGGGGAGCACATCATTGCGGGG
GCCGGGGAGCTGCACTTGGAGATCTGCCTTAAGGACCTGGAGGAGGACCACGCCTGCATA
CCCATCAAGGTGAGCTAAGGCCGCCCGTGTCCCCCTGTGCTGTGGGGCAGGGGCAGCCTG
TGGAGCAGGCTTCTGCCACACCAGGCCTCTGCCCTTGGTGCTGAGCACTCGCTCTGCACT
GGAACTGTGTAGCCGCGATGGCTCTGCTTGTTTTCTGCTGTTTATGGTTGGGCTCCTTAG
GCCTCTGCGCCTTTCTTCCTTGGCTGTCTTGAGCAAGGGCAGTTTGCTCTGCTTGCCTGT
TGCTGGCTCCCTCAGCCTCCCAGGGAAGAGCTGTTAGGGATACCTCTCCCTGGAAGGCCA
CCTCCAGGCAGCAGTTCGACTTCCAGACTCTTCTTGCAGAAATCTGATCCAGTGGTTTCA
TACCGGGAGACAGTCAGCGAGGAGTCAAACGTGCTCTGCCTCTCCAAGTCCCCCAACAAG
CACAATCGGCTGTACATGAAGGCGCGGCCTTTCCCTGATGGTCTGGCCGAGGACATCGAC
AAGGGTGAGGTGTCAGCCCGCCAGGAGCTCAAGCAGCGAGCCCGCTACCTGGCTGAGAAG
TATGAGTGGGACGTGGCTGAGGCCCGCAAGATCTGGTGCTTTGGGCCTGACGGGACTGGC
CCCAACATCCTCACGGACATCACCAAGGGTGTGCAGTACCTCAATGAGATCAAGGACAGT
GTGGTGGCTGGCTTCCAGTGGGCCACCAAAGAGGTGAGCTGGATCCAGATGGCCTGGGAG
GGGTCTCCTGTGTCTCCTGGGTCTGGAGTTGGGCTGGGGATCTCTGGGATGCCGATCTTG
GGGGTGAAGGGGACCTTTGCATGCTAGGTCAGCACAGGCAGGGCCTGCAGCTGTGTGGGT
GAGGGGTATGCACCTGCTAGGAGCTGGTGTGTGCCTGGTCTCTGAGGCCTCCTTCCCCAT
TCCCCAGGGTGCACTGTGTGAGGAGAACATGCGGGGCGTGCGCTTTGATGTGCACGATGT
GACACTGCATGCAGATGCCATCCATCGTGGGGGCGGCCAGATTATCCCCACCGCCCGCCG
CTGCCTCTATGCCAGTGTGCTGACTGCCCAGCCCCGCCTCATGGAGCCCATCTACCTTGT
GGAGATCCAGGTGAGCGCACTGGCCTGCACTGGCCTCCTGCTGTCTTCCTGCCCCACAGA
GTTAAATGCTTGTCTTTTCCTGGCAGTGTCCAGAGCAGGTGGTTGGTGGCATCTACGGTG
TCCTGAACAGGAAGCGGGGTCATGTCTTTGAGGAATCCCAGGTGGCTGGTACCCCCATGT
TCGTTGTCAAGGCCTACCTGCCCGTCAACGAATCCTTCGGTAAGTGCCCCTCGGGCCTAT
CTAGGCAGATGAAAGCCTGGCTTTCCGTGTGAGTGTGGGGAGGGGCGGTGGGAGCTTTTT
TGATCTGCTTTCTGCAAGTAGGTGGTCTGCCTGCACCCTGTGTGGCCCCCAGTCACTAGT
AGGGAGTTTGTTTGATGAGGGCAGTAAGGCTGTGGCACGTAGGTCAGTAGGATCTTGCCT
GTGGCTCAGGCTGGTTCTCTGCACCCAGGAAGACTGTCCCTTCTATATACTAGTGGCCTT
TGAATCATTTTCATTATGTGCGGGGCTTAGTATCTGCCTTGCCCAGGATTCTCGACTTCT
CTATAGTCCCAGGTGGTCATCACCCTAGGGAGAGCCTGGGTTCCCAGTGTCTCCCTGCTG
TGGTGCTAGGGATAGAACCCAGGGCCTAGTACATGCAAGGTACCTGCTGCCTCTTGAGCT
CTCTCCGTCCCTCTCCCCACAGGCTTCACTGCTGACCTGAGGTCCAACACAGGTGGTCAG
GCCTTCCCCCAGTGCGTGTTCGACCACTGGCAGATCCTGCCTGGAGACCCCTTTGACAAC
ACCAGCCGTCCCAGCCAAGTGGTGGCGGAGACCCGCAAGCGCAAAGGCCTGAAGGAGGGC
ATCCCGGCCCTGGACAACTTCCTGGACAAATTGTAGGCGGCTCTTTCCAACAGTGGTTTG
CCACCCCTGGTGGGACTTGGCACAACACCCACACCCAGTTTGACCACAGCAACATGTCCT
CGCATTCTCAAATGACACCTTGAGACTGTCCCCACACAGTGATGCCCTGCCTGAGGGGTT
ACGGGGGCCCACTCCGTGCCATCGCTCAACAATAACACTTGATGCCGTTTCTCTCTATTT
ATTTCAGGAGTCCAGAGGCAGGGGAAATGCCCTTTCTGAAGGGACTACTTGGCTGGTGGG
GTGGGGAGGTAGGGTGGGACACCCAATGCTTTTATTTCAGATCATCAGAGGGAAACTGAA
TTCGGATGTCCAAAAGTTTAAAATAAATGCATTAAGAAGTTTATTTGGGTATATGGCCCG
AAGTGGATTTCCCTCAGAAAGGGGGAAGGAACGGTGGGTAGATAATTCCTAGAAGGCAGG
AAGTCCTGTGCCGTGTCACCATGAGCACCTTCAGCTGTATTAGTACCATTGGAATAATAA
ATTTGATAATGGTGGTGAAGTGTGCCATCCCTGTGACTTGGCTCTGCATCCTTCCTGGGG
CATCTGCACAGGAGAAGGGTAGGGTTGGTTGGTTCCAGTACCTTAGGTACCTGCTTGGGC
TCCTACAGAGCTGTCTGGTGCAACTTGTGCAGTGGTAAGAACTTCCTGCATCTGTCCACA
GTGGCAGCCCTGGCTCCGCATCTGCTGTACTGATGGTTAAGTCCCAAGGGTGCAATGCGG
ATGGCTTCTGGGAGAAGGTGCCACTAAGGCTGTGAGCTCAAGTGGGCCTCGGGATTAGTG
CAGGAGGCCATCTTGGGCCAGAAAGTAGAATTTGTACTTTCTGGGGGATAGGAATAAGTT
GAGGCCAGAAGTAAGGTGAAAGTGGCACTGGAGTTGTGGCTCAGGTAGAGTGCTCATGTG
GCATGTTTTGAGCACTGGGTTTGATCCTCGGCACCACATAAAAATAAAAAGATTGTGTCC
ACCTATAACTAGAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1992..2166, 2168..2207, 2667..2848, 2932..3143, 3502..3680, 3868..3973, 4440..4553, 4950..5088, 5210..5405, 6068..6326, 6621..6728, 7059..7412, 7627..7809, 7886..8018, 8482..8675
1001..1003, 1992..2166, 2168..2207, 2667..2848, 2932..3143, 3502..3680, 3868..3973, 4440..4553, 4950..5088, 5210..5405, 6068..6326, 6621..6728, 7059..7412, 7627..7809, 7886..8018, 8482..8672
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved