Spermophilus_tridecemlineatus Locus RPL23A
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus RPL23A
Spermophilus_tridecemlineatus
RPL23A
GeneScaffold_1380
SNORD42
1512..1578
6159
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAACTTTTCGGCATTTCGAAGTGCGGGTGAG
GCAGACGATTCTTGCCAGGCAAGGCCTTCCACTTCTATTCCCCAAAGGCCCATCCGGCCA
AGTTTTCCCATTATTCTCTATGTAAACAGCATCGCGAGTCTTCAATGAGATTTGGCACTA
TAAGCCCATGGGACCGGGCCTCGTAGACCCTTTTCACCAAGATGGCGCCGAAAGCTAAGA
AGGAAGGTGTGTGTTAGGGCTGGGGACCGCGGTGGGTTTTCCTGGGATGTGAGCAGAACG
AACGGCCTGGGAGGACAGTGGTTGAGCTAAGCTCCTGGAGAACTTTCCCCGGAGCCGCTT
CCTGGGGTTGGGCGAAACTGAAGCGTATGTGGGCCGCGTGGACCAAGCCGCATGGGCTGG
ATTCCAGTAAGGGGGTTTGAGAGAACATTTCTCGCATCATCCGCCAGTGAGGCCAGACAA
TTGACTCTGGGGAGCTACACGCAGTCACAGATATATCCAGATATATAAGGAGTTAAGCTT
TTTCAGCATTACTCATTATTTTGACGTATTCAGCGGGGCTATATGCCCCTCTCCTTCGGA
GTTACATGATGGTATGTATAAAACTCTTTAACACAGATCTCGGCAAAATTTGGGCGTTCG
ATCAGTACTAGTTGGGTTTTTCCCTTGTATCCTTTAAGTTGTTCCAAGTTGATTATCTTC
GCTTCTGGTATCGTGCATATGATGGAAAAATCGTGATCTCCTGAGATTTATGAAGTTTTC
AAAGGAACCACTGATGCACGTGTTGACAGAGGCACCCGTCCTGAGGCCGGAAGTGACCAA
TTTCTGAATTAGCACCCTTTTTTTTTTTTTCCTTCTCTCCCAGCTCCTGCCCCTCCCAAA
GCTGAAGCCAAAGCAAAAGCTTTGAAAGCCAAGAAAGCAGTGTTGAAGGGTGTCCACAGT
CATAAAAAGAAGAAGATCCGCACGTCACCTACCTTCCGGCGACCCAAGACATTGAGGCTC
CGGAGGCAGCCCAAATATCCTCGGAAGAGCGCCCCCAGGAGAAACAAGTCAGTACTGCTC
CTACACCCATGAGAATATTTTTCATTGGTGATTTAGGCAACCTGGAGTATGGCCTCTCCA
ACACATTGATATTCGGTGTGCTCCTCTGATGTGAGATTTCTTTCTGCCCTAACTAAGAAC
GAGGAAACTGTTTTATGGGAATTGAACATAAGGCCTTTCTTGTCTGCTAGGCAAACCCTC
TACCACGGAGCTACAATGCCTATCCTTTATTGTTATTTTTGAGAGGATCTTGATAAGTTG
CCAAAACTGCCTTCGATCTTGTGGTCCCCCTGCTTCCACGACCTAAGTAGCCGGGATTGC
AGGTATTTGCCACTGTATCCGGCTCAGAACAAGAGATGTTTTGCATTATTGACGGGAATT
AAGGCAATATACAATCAATCAATTTTTATTTGAATCACTTATCACTTCACATGTGGTCAG
AGTTTGAAAGACCACTTTATTGGTTGTATGAAGTAGACTAGAGAGGTGCTTCTTATTTTT
GTAGTTCCATTTTAGTTACTTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACACCTATTACTT
ATGGGGGGTTTTGTTGTTGTTGAACCCAGGGCCAATTTACTTCTGAGCTATATCCTAGCC
CTTTTTTGAGATTGGGTTTTTGCTAAGCTGCTGAGGCTGGCCTTGAACAACTCTTGCCTC
AGCCTCCCAAGTTGGTGTGGTTACAGGTGTGTGTGGTCCTGGGTGACCTATTGCTTAAGA
GTGAGAATGTGTGCTGTTTTTTTAGTAGATAGAATGATTATATTATTTATTTACAGAATC
TAACCTAGTTGCTTAGCACCATGCCATTGCTTAGGCTTGCTTTAAGATGTCCATCGTCCT
GTCTCAGCCTCCTGAGCTGCTGGCATTATAGGTGTGTGCCAGTGTGCCCAGAAGAATTCA
GTAATTTTTATTTGTGGCAGTGATAGCCTGCCAGCAGTGTAAAGGAATTTCATTCACTCC
CAAAGTTCAGGCTAGGCTCAGGAAAGGTTCTGGGGAAGGGGTAAAAGCTGTTGAAAAACA
GAAATTAAGGGCTGGGGATGTGGCTCAACTGGTAGCGCGCTAGCCTGGAGTGCGTGCAGC
CTGGGTTCGATTCTCAGCACCGCATACCAACAAAGACGTTGTGTCTGCCGAGAACTAAAA
AATAAATATTAAAAAAAATTCTCTCTATCTTTAAAAAATTGGCAAAAGACTTATTACACA
TATATACCACAATTTTAAAAAAAAGAAAAACAAATTAAGAGATAAGAATTTAGTGTGATA
AGAGATGAGTCCTGACCTTGCTTCAAAACAGGAAAATAGTGACTGGCTGAGCAGAGCCTG
GTTTTGTCCACTTAACCAATAAAAAGTTGGTCTTAAGTAGCTCCCAGCCAGCATGGTTGT
GCATGCTTGAAGTCTTAGCAACTCTGGAGACTGAGGTAGGAGGATCCAAGATTGAGACCA
CTCAAAGCAACTTAGCATGATCCTGTCTCAAAAAGGGCTGGTCAGTGCCCCTGGCTTCAA
TCCTTGGTACAAACAAAAATCCCAGCAATTCTGGGAGTCTGAGGCAGGAGGACTGCAAGT
TCCATGCCACCTGGGGATGTAGCTCAGTGGTAAAGCACCCTTGGTTCCAATCCCAAATAC
AAAAAAAGAAAAAGATTAACTCTTGAGTACTGCCACTTTTTAGCAAACAGAGGTAGATGA
AATGTTTGGTCCAGGCTCATAGTGAAGCACCAATATGAAACTATCAAATGAAAGGGTTCA
AGTAAAAGGTGAATCTTCAGTCATTTAAGGATGCAAGCCCTCCGGTTAAACAAAATGCAT
AAAGGATCTACCTACAGGCCGAGAATTAAGATCCCTAAGATTCAGGGTGCAGCTGATGAC
AGCATTTAGCGACCAAAGTCTGATGAAACTGATTGCTACTTATTGTCTGATGCACCTATG
CTGTATTGGCCTAGGGTTCCAAAGGAAGGCCCATCCTTTCTCATACTGGGCCTACCTAGG
CCAGGTGACTGCAGTTTGCTTCTTCCCCTAGGCTTGACCACTATGCCATCATCAAATTCC
CTCTGACCACTGAGTCAGCCATGAAGAAGATTGAAGACAACAACACACTTGTGTTTATTG
TGGATGTCAAGGCACACCTAAATCAACCAGATCAAACAAGCTGTAAAGAAGCTCTATGAC
ATCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1663..1846, 5011..5123, 5125..5159
1001..1025, 1663..1846, 5011..5123, 5125..5159
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved