Spermophilus_tridecemlineatus Locus TEC
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus TEC
Spermophilus_tridecemlineatus
TEC
GeneScaffold_501
SNORA2
50205..50337
75147
AGTTATAAAGGGCTCATTGGAGTGATCAGATTGGGTGGGAGGATGATGGGGTCCTTCAG
TGGTCACTGGCTCTGCTATCAAGTAGCCACGTAGTGCTCTTCATGTGACTCCTTTTTCCT
CAATACAATCACTTCTTGAGAGGGTGCGTTGGAGACAAGGGAAGAAAAGACTGTCATTCA
TTCAGTTTATCTCAAATAAAGATCTTTGGGCCTGAGTATCTTTAGGCCTTCAGATTTAAA
TTTTGTTGATTATTATAGGACCTGGTGTAGGTATGGACAGTATTGAGAGATGGACTCCCT
TATAAAGGACTGAGGACCTTCTTATCCAGGTGGACTCGGTTTAGCTGTGATTGAGTGGGT
TTCCTTTCTTTGATGATTGAGGCAGGAGCCAAAGGGAAGGGAAAGATGGAGTATGGTAGT
GTAGACACTTAGTCACTATGGCCCTGGTGACTAGGGTGCTGGATGGAGCTTCCACCCTTC
TCAGAGTGTGAATTGAATCTACCACTGTGCGCGATTCATGTTGTTCAAGAGTCTGTGATG
TTTATGTGGTCCTCTGTTTTATGTACCAACATCTTGAGACAATTCCGCGCCAGCCTAAAC
ATAATATTTACACCATGAAATGAATTTGCCATCTGAGATTTTTGTTCCTTGCAGTCAAAT
CGAAGAAGAGTGTGCTAGAGAGCCAAGGGATACTGGGGAAAACAAAAGAGGGAGTCATCC
TTATGGGGAGTCCTGGGTTAGTTTTTTTTTATGAAATGACAGGGCAGGGTGGAGAGTGGG
GTAGGAGATGAGGCTGAGCCTGTTTTCCCTGGTTATTCTCCATCCAGGCTCAGAGGATGA
CATGTTCATGGGTCCAGCGAGGGTGAGGGGAAGCCTATATTGGTAATCTGAAATGGCCAC
ATCCTTGTGTAATTAAAATGTCACATCTTCACTGTTTATTTTTCTCACGTTAGAATACTG
GGATCTTCAATGGCAGCAGAAGGAGTGATCAGGAGACCGAGATGAATTTTAACAGTATTC
TAGAAGAGATTCTCATTAAAAGGTCCCAGCAGAAAAAGAAGACATCACCCTTAAACTACA
AAGAGAGACTTTTTGTACTTACGAAGTCCATGTTAACCTATTATGAGGGCCGAGCGGAGG
TAGGAGACCATCACAGCAATATGTTGCCGCTTTCTGTGTCGATATGACTTGTTACGCTGC
TCTGCTCTCTAGTCTTATGGCACGAGCGGTGGGATGATGAAGTTAAGGTTCTGAGTTGTT
TTCGTTTGAACGTGAAAGGTGAAATTTAGCATGTGAGTAGAAATTACATGGCTGTTATAT
TGAATACAGGCCTGTGACATATTGATGCTCATTTTATATCAAACTACTGAACAAGTGTGC
CAGAGAAAGTAAATTCCTTCATCAGTTTTAGATCCTTATGGATTAATTGTCTATGTTGTG
CACTATTTCCCACAAACCATCAAAGTCTTTCTTAGCAAACATGTACTCTGTGTCCTTTGC
TTCATAATAATGTTGCTTCATCATTAAACAGAAGCTACTTAAAACTGGTTAGTGATTTGG
TGGTCCCAATATGTTCCGGAAGTTGACCTAAAGCAGAAATGTTCAGCTCTTTTCATGATA
AGCAGCTACTGCCAAGTTCCTGTGACAGGAGCAGGGAGGGGCAGCTAAGAAACCCGGCCA
GGGAGCACGTGCTGCAGGAACGGCTGTGCTCACCAACCCCCTAGCTTTTCCGTTTGTTTC
TGCTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACTTGGTGATC
CTGATGTTTGGTTTGGTTCTGCTTATTTCCTAGAGTACCATCCTCAGAAGTTGATTGACT
TGTTCTGTTTTCGTTTTACTCCCACTGATTTCTCTGTGGCTGAGTTCCCCCAGTTCAGAC
AGAATTGCGTTGTTGCTCATAAATGGTCTTCCCACTCTGTTGAATTCTTCTGTGGCTTGT
CATTGTGAGATTATTCAGTTTCACATAGATAAGAGTCTCTTAACCCTAAATCCCCAAAAT
GCTAAAATCCAAAACCTCAAAAACTCTTATTTGCAAAAGCATGCCTTAGTTGAAGCCAGT
TTTTGTCTTTATCCTATTCATCGTGTTATTCATATAGAAATGCGAATAGTGTTTGCGTGG
GACTGTCTCAGTCCCTGTGTTATGTAATGTGTGGTGCATGTGCTATATTTTACTTATTAA
ATCTGAAAATTTCAGAAATCCAAAAAATGTTTCAGATAAGGATTATTACCACTTTAAAAT
ATAAAGCAGATTTTTAAGGGAAACATTTACACGTTTTTGCTGTGTGGTAAAGATTTGTTA
TAATTTGAATCTTATATAGTAAATTTAAGGAGAAAATAGAAGCGTAGCAGTGAACGTGGT
AAATGTGGTTCTTTTCTAGCTACAAAGCCTCAGAAACCTATATTAGAAATATGCCTGATA
GTATTAAAACACATTGTAATTGTTAATTTACTTCGAAGATGATTGCTTTATAGTTGTCCC
TTCGTATTTGTGGGGGATTGGTTCCAGGCACCTGCCTCTGATACCCAAATCTCCAGATGC
TCAAACATCTTCTATAAAAAAAAGAGTAGGTGCCTATAACCTATACACATCCTGATATAT
GTTAAATCATCTCCAGACTTACTCATAATACCTAATACAATGTATGCTTTGTTAATAGTT
GTTATACTGTATTGTTTAGGGAATAATGACATGAAAAAATAAAGTCAGTACATGGACAGT
GGAGATGCAGCCTTTTCCCCTGGATATTTTTTGTGTGTGCTCAGTCACATCTGTGGATGT
GGATCCCGCAGATGTGGAGGGCTGACTGAATGAAGTTGAAAGTGCACTCCTTGCTTTGTC
TGGAGCACGGCGAAGAGAATTCTTTGATTCCTCTTACATCAGATCCCAGCCTTAGCTGCA
GTGAGAACCAGAAAGGACAGAACAAGGTGGTGTCGCATATGAAATCCCACTTCAAACACT
TTGGGTCAGATTCCTTTTCCTTCCTGACCGCTGCTGAGTGGTCCGGAGATCCTAGTGCCA
TTGGCTTAATTCCTGCCTTACCTTTCACTCTTGTGGAACTACTGGGCACTTCCATCCTCC
TGTTTCTTTCCTCCTAGCCTGACATTCATTGGTGACCTATTGCTTGAAGTGGTTGCGAAG
TTGTTTGTTTCTCACAGTTAAAAATAAATAGCTGTCAATATTTTTAAAAATTAAGAATTT
TAAGATAAGAGTCAAATTCTTGAAATAACATTAATTCTGACTATTCTGGGCTAATTCTCA
CATGACGGCCTTCAGTCTGTGTTTTGGATGAGCTCATAGCACCTCACTACTGTGTTTCTT
TTCCACTTGGGTGAATATGCTCAATTCTCTGATTTCCAGTGACAATCTTCTGGTTTTCAT
CTCCCTAGCATTAGAAGTGACAATTCAAAAAGTGCTGTGAGGTGGGAACTGCATGAGAAT
CAGGAGGAGTTGTAAAAATAATATTTTGTTAAAAATGTAAGACTCTAGAAATGAGTTTGA
AAAAAACTTGGAAGCTATTTGGGGTTAAAATAAATAGCCTAGAGATGTTTAAGTGGTTCA
TAGTTGTCCTATTTTTTTTTTTTTTAAACCAGGAGGCAGGCTGTTGATCCAGTAGCTATG
ATTCCTAAGTCTTCATTGCAATCAAGTGGTTACTAGTACTATGTTAAAATTCTTAGTCAA
TCATAATGGCAAACAGACATCCACCCCATCCTTATTCTCTGGACCCCATCTCTTTCAACA
CGGCGACAAGAAGCTTTTATTGAAATGCTTCTAATAGGCATACTGCCTGTTGTGCTTTTG
GAAGTATACTGAGAAGTTCTGTTCTGGATGACAAGATATTTCCTGAAAATCTTTGTTCCA
GTGACTATATGGGGTCATTCTTCAGTTTGTCCTCCTTTCTTTTCTGGTGGTTATTTCATG
AGACCTGTGTTTCCATACATTGAAATGAACTGAAAAAGATCTTCCTGACAGCTGTTGTTT
GATCTTACTCATAAAAACACAGATCAAAGGGTCAAGGAGTTTTCACAAGTGATGTCACTT
TTGTAATTGTGGAACTAAATGACCCATGGCATAGGCCATTTGATGTTCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTTTTTCCTTTCTTTCATCTCCCTCCATCTCAGCTA
TCTTTGGTGTGTTGTTGCTAACTGTAATGCTCTTCACATTTGCCTTTGCTAACATTGCCC
AGTCTGCTCCCAGTGACATATTTCTCTGCCTGTGTGCCAGGATCCAACTATCTACACACT
ATTATCTATTAACACCCTGGAAATCCCTCATATTTCTGTAGGGTCGCCTGGTCATATTAG
GGTTGTTTTCTTGACCAGTTCCAGGAACCTGGAAGCTCTCAACCATGCAGAGATGAAAGT
CTTCCAGGGTTCTGAAATGATCTGATATTACTCTCTTAGTTGTATCCTTGGATTAGGTGG
ATGCCCAAGTGGGAACCCCAAACTTACAGGGCCCTCCTGAAGTTTTGTATCTTTCAGTAG
TTTCTTAAATTTTGGGGAGTTAACGTGGGGTGGGAAAAAATAGTTCCTTTTACTTCAGGG
TAGTTGGAAGCATTAGCATCAGACTTTAGAGGTTGCCAGGAAGTTCACCAGTTTGTAAAA
AGTGGTGTGGCTCTCAATACCATAGTGCCTTCTCTCTGAGGGTTATATTCTAAGACCCCC
AGTGGATGCCTGAAATCATGGCTAGCACCAGACCCTATACATATTTTTCCTATATATAAA
TACTTTACAGTAAAAGTTTAATTTATAAATTATGCACAACAAGTGAATAATAACTAATAG
TAAAATAGAACAATTATAAGAATAAATAATAAAATTGCCAGTATTGCTACTGTTGCCTCA
GGGAACATTATTAAGTAAAATAAGTGTTACTTGAACACAAGCACTGTGATGCTGTTACTA
TGGATCTGGTACCCAAGTTGCCTGCTAGTTGACTAATGGACCTGTAGTGATGGACATAGA
ATGCTTCATGTACTTGGTGGGATAGAGGAAGACAGCTTGAGATCTCATCACATTACTGAA
AATGGCATGAACTTAAAACCTCTGAGTTGTTTTTTCCTAGAATTTTCATGTAATATTTTT
GGATCGTGGTTAATAGCAGGTAACTGAGATCTCAGAAAGCAAAATTGTGACTGAGGGATA
CTGTAGTCCATGGACAGTACTTTGGTTAATGTGTGACATGACTTTTTCTGGCTATAAAAA
TTCTCAACTATATTATCCCATGAAAACTCATTTTCTCATTGGCACTTAAGCCTCCTTATT
TCTGAAATAAGGTAGCATGAACTTCCTTTTACTGTCTCAATTTCTTCCATCTCTTCTCCC
GTTTCTGATTTATACCTGTCTTCTTATTCTACTCTCTTGGAAGCAACCTTTCTTATCCTT
TATCACTTAAAAAGGCTAAGATACCATGTTTCAAATCCAAGGGTCTGACTTATCTCTTTA
ATTTTTCAGGTTGTCTATCTTCATTTAATAAATTAATAGTCACTTTTTTCTTAGGAAGCT
GAAGTCTATGTAAGATAGATGAGGGGAGCAATACCATTCCCTTCATCCACACTCCTGATA
TTTTTTGGTAACTTTAAACTTTGTATAGTTTCAAGCATATAGAAAATTTACAATAAGAGC
ATACAGAACTTTTAAGTAATGATTCTGTTTTTTTCCCCCATAATTGTTTGATAGTTAAGT
TGCAGACATTGCCTCCTCCCCTTTTACAACTAAATAGGTCATTGTGTGTTGTCTGAGTAC
AAGGACATTCTCTTTTATTATCATAATTCAATGATCAATTTCGAGATGTTTAATCTCAGC
CCATAGACAAATTACATTTGTGGTCCCTTTGTTATCTTTATAGTTCTTTCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCTATATGCAGTTCTTGAAAAACTTTTTAAGAACTGTCATATTTTTCATTGTGATTTAT
GTAAATTGCATTTTATTTGTCTGCAATACCATAAAGTACTGGGCTGGAGATTCTTAGTAG
CTTCTTTGAAGCTACTTCTTATAACTAGTAGTTTCTGTTAAGTGTTTATTGATGATGATA
GGTATGGTGACACTTATCCTGGGAGACAGTTTAAAAAGAGACTGAATTATATGAATGGAG
GAAGCTTTGGTGGCAAAAGTACAGGAAAAAAAGTACTTTTAAAAAATTTTTTTTCCTGGG
AGTGGAGATAGGAAGGGATTGGGGAAGGTTTCTACTTGACCTTCCAAGAGTTAGAGTGTG
AGCAGTAATAGACACAGATAGCCCACGCCACACAGAAGGAACAGTTCATACAATGACCCT
GGGTGAAACTGGGCTCAGTGTGTTTGTGGAGTGCTTTGTTCCCAGACCTACATAGGTTTA
TATAACTGATAATTTCTCATACAAAGTGGTGATTGATTTGTTAGTAGTAAAGATGAATCA
CACAATTTTAGAGTTTCAAGAGACTTTGAAGAAATACCTCCAGATTTTTTTTTTACTTAC
GGAAATTGAGGATAAGGAGATGATTTGCTCTGGGCCACCCAGTAGCGGATTGCCTATGCT
GAAACTTATATCCGGATGTTCCTGGATTAGCCACTGTGCTTGCATTGCTTCAGTTCTGGA
AAGGTAAAGGTTCTTTTCAGCTTTAGACAATGTGGTGGATGTGATTATAATAAATACCAT
TGGGCTGGGGATATAGCTCAGTGGTTGATGACTTGCCCAGTATGTGTGAGGTCCTGGGCT
CTATCCTCAGCACCACAGAAAAGAAAAAAGAAAAGACCATTAATTGATAGCAGATCTATG
ACTGTTTAGACCCCTGTGCTCAAAAACACTTGACACTTTGCTACTTTGAAGCTTGTTCTG
CAGTGCACGACAGCTCTCAGTATGGGAGTCATCTGGTCTCTAGGACTGGAGATCCCTGGT
TGTAATGCTGGCCTTTCTAAGTACTCTCCCATCTGTATGCATTATTATTACTGCCTTTTT
CCTCATCACTATCTGAACATAATAATCTTCCTAGGGCCATAATTGTTGCTTCATAGTTTA
AACATACTACACCATGCCTTGTGCCCATTAACTCAAGAAAGTTTTTGTTGGTAATGATTA
CAATGCTAACGATTAGTAAGACTTTAGAGTTATCAAAAAGGTCTTTAGATCTTTGTGGGA
GTGCTTTCTCATTTAATTTTGTTTCATTTTTTTGAATAAAAAATTTTAGTTGTAGGTGGA
TACAATACCCTTATTTTATTTACCTATTTTTATGTGGTGCTGAGGATCGAATGCAGTGCC
TCATACATGTTAGGCAAGCACTCTACCACTGAGCTACAACCACAGACCTTCATTTTGTTT
TTTGAGGAGATGCATTATTTAAATTTAGACATGAAAGTATATTCACTTAATATTTATTAG
TATTAATCACTCCCACAAAGTAAAAGGTGGACATTGTTACCAGCAACCAGAATAGAATCT
GTTAGAAGAGATCATGTGGCAATCTGAGAAAGTGAAACAACATTTTGAGTTGTTTCTAAG
ACTATTTCAGATGTGCCAGCTCTTAGCCATTGGTTGATGCTGGTTAGATACACGTAGAAC
ATAATGCACAGATTGGGGCCTAGAAACACTCGTGTTACTCAGGAATTGATTTAGTAGAAT
TAATTCTTTTAACTCTATTAAGAGAACTCTTAGCATTATTAGCTTTGAGTTTTGTGTATT
GTATTTCTAAAATGAATATTAAAGTTTAATGATGATGATTTCAGATAAAAAATAGTTATA
TCCTATTACCAAAGCTCTTCCCTTCCCTTTAAAAATTTTTAAACTTAGAAAACTAACATT
TGCATGATTCCACACTGGTAAACAACTGAAAAGAAAAATTGTCGAATAAATGAGTTAAAT
CAACAAATGAGTAAGAGGTTTCCGTGAAATCTTTAATGATTTCTAAAAGATTGTGGGGAG
AAAAATTTTCACATTATTCTAGTTCTACGAGAACACCTTTTCACTCTCTGTCTTTATTCC
AGGTGGTCATAAAGATACAGGGGGGTTGTGGCTCAGCGGTAGAGCACTGGCCTAGCAAGT
GTGAGGCCCTGGGTTTGATCCTCAGTACCACATATAAATAAATAAAAAGAAAGGTATCGT
GTCCGACTACAACTGAAAAATAAATATTAAAAAGATATAGCTGTTCCTTAAATTTATTTG
CCACTGCAAAAGTAACATGAATGTGTAAATCCTTGCTCACGAGATTGCAGCCTAGTAAAT
TTTGCTCCTTCTAGAAGCTTGTGTACATAATTTCCGAGGAGAAGAGACGCCATACACTGT
AATTTGTAATATGGAGGCAGCCCCTTTGTTTATTCTTCGTTTGTTCAGCAGAGAGAGAGC
AAGTATGCCAGGGACGGAGAAATTAAAAGATGAATGGTCCTGGCTTCCTTAAGCTCCTAG
TTGGATTTTGCCGAATCTCTGCCTTTCTGGGCTCATGATGGCTTACTTTTTCTTATGCTG
CCTCCACTCTGCTGTGAAGGTGGCCTTGAGACTTGGGGTTCCTGTTTCTTATCCTGTGTA
CCCGTGTTGTTGGCCCTCACTGTGCATTTCTTGATCATCCAGGACTCAGCCTCACTGACC
TTTGGATTTCAGTTGGGTGGTGGTGGGGGCCACTGTACCTATTGGATTTCCAGATTTCCT
TCTGTTCTTAAAATGTACATAGCTTAGATTCCAGATCATGTGTATTTGCAAATAACCCAC
AGAATTTGTCCACTGTCTGTTTTATAAATGAAGAAACCAGGGGACAGACAATGTCAGGTG
CCTTCGCATTTGAGTACGTGCCTCAAGATGCCTTATCGTTCTGGTGAGTGTGCTATCTGT
TAAACCGCACTGGGTAACTTCCCACACAGGGGGACTTCCTTAAACAGTAACTTCACTGAC
CACCTCTGTGCTCACGTTTCCTTCCTCCTGGCTGCTTTTGGCTTTATATATCAGACGTTG
AAGAGGGTGTTCTTTTACCAGTTGTAAGTTCTTTCCTTACTGTGTCCCTTTGAGGTGAGG
GGAACCCAATGCATTCAAGGAAATTAGAGTTCCCTGGCCATTAGCATTTACTCTGTTGAA
ATACTTACTTAGACACTTTTTCCTTTTAGGTTTTCTGACTCTTCATGGTTTATTTTTATA
AGATATCAAATATGTTTTCTGGATCAAAGCTTTTTGTACTTGTTTGTACTTGGTAGCTTA
TCTAACTCTCTTAATATCTTTTACTTATTGTGGTAAAATACACATAACCTAACATTCACC
TATATAGCCTCTTAAAAGTGTACAATTCAGTGGCATAAAGCACCTCATAATGTTGTATAA
AATCACCACTATCTAGGTGCAGAACTTTTTTCATCAACCAAACAGAAACTATCCTAGTAA
GTTGTCAATTCCTCATTTCTCCCAGGAAACCATTAACCTACTTCCTGTCTATGAATTGGA
CTGTTCTGGGTATTTCATAAACATAGAGTTGAACACATGTTACCTTTAGTGTCTCTGGCT
TCTCCCACTGAGATGCTCTTCATGGGTGTTGTGGCATGCATCAGCACTTCATTCTTTCTT
GTGGCCAAATACTCCACTATCTGGATGTATCATAAGTTTTTTGTCATGTTGATAGATATT
TGGGTTGTTCCACCCTTTGAATATAGTAAATAGAGCTACTATGAATATTCATGTACAAGT
CTTTGTGTGGACATAAGTTTTCATTTCTCTTGGGTATAGGAATTGAAATTGCTTTGTCTT
TTAACTAGCTTTAACCTTTTAGAGAACTGCAAGCTTGATTTTAAAGCAGCTATATTATTT
CACCTCCCCACTAGTAGTGTGTTAGGGTACCAGTTTCTCCAAATCCTGCTTCACTTTTGT
TGCTCTTGCTGTCATAGAGGGTATAAAGGGGTAGCTCAGTGTGCTTTTGTCTTGCTTTTA
CCTTAGGATAATAAGGTTGAGCATCTTTTTCCTATAACTTAATTATTTTTAAAATGCACG
TAGGCACATCTTTTTTTGATTCTCTAAATGAAGGGAACAGTGGCATGCAAGTAAATGTTC
AGGAACTGGGAGAAGCCCTGATTTTTAGTTTGCCAGTTTCCATAGTGTAAGTACTCCCAC
TGTGTCAGATTGCTGGTGTCCAGCATGACATGGAGCCCAGCAGGCTCTCATGAGCTGGCT
GGCTCCTGCACACCTGTGGGAGGGAGGGAGGAATGGGTGTGATGAGCTTCTCTGGGGCCG
CCTGGTTTTGTGCAGATGGGGCACTGTGAAACTAATAGAGGATGCCATTTGCATGTTAGT
TTAAGGAGAAAAGGACACAATTTTTATTATCTACCACTTAACTCTTTACCACAGTCTTCT
GAGGCAGGTTGTACTATTTTATTTTCAGAAAAATCTAAGGTCTGGAGAAACTAGCTTAAT
GATTCACAGCTACTAAGGGTCAAAGTTGGGACTTAAACCAAGTCTTTCTTACTCCAGAGC
TCATTCTAGTTTGCCCACTGTTTTAGGGGTTGGGCAGCTCCAAGACCATCCCTGGGTTCC
GTGACTTGCTAGGAAGAGACACAAGATTTAGTGTATAGTTGTGCTCATGATTATCATTTA
CTACGGTGAAAAGATGCAAAGCAAAATCAGCAAAGGGGAAAGGGATGTGGGATGAATGTT
GAAGAAGCCAGGTGTAGGCTTCCAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGACTCACTTTTACATGAGTGAACTTTGACTACAAGATGATAGAGAACTGTT
TCTTCCGGCTGGCCACCTTGGTGTCTGGGTCACATGTTGGGGCCACACCGTCCTTTGTTC
TCATGCACAGGGGCTGACTGAGTTGTCTGCGTGTATTCAGTTATCACAAGCACTTTCCCG
GGAGTTCTGCTGTCGCAGTTCTGGGAAGGAGCAGACCATGGCTACCACGAACTGATGATA
ACCTAGGTTCCTTTTATGCTGAGTTCCTATGACAGACTGACGAAAAGAAAAGAAAACACA
AAACAACTTACTTTTTTTTTTTTTTTTTTGGTCTGACGAGTTCAATCCATTCTCTCCAGT
AAATTCAGACATTGTTTTCCCATCTGTCTTTGCTTAGTTATTTTTCCATTACTTACTTTA
AGGTAATGGCCAGCACTGGTCTTCTTTAGAGTTGGAAGAAGCACATGTTCTGACTAATGC
AAGAAGCACTGGTTCTAACCTCAGGTGACCCACTTTCAGATCCTGGGCTCTGGCATTCAC
TAGCTTTTATGAGACCAGACAAAAAGCAACCACTTTGTGCCTCAGTTTCCTCATCTATAA
GATGGACACAATAATAGTCTCCATAATAGCCCTCACTGGGCTGCATGGGGTTGTTTGAAG
TGATGCATCTAAAAAGGTGCAGTAAATGAACCTGGCATGGAGTGGGGCTTGAAGGAAAGC
TAATAACATTGCTGTTGCTATTAACTCTCAGGATATCAAAATCATCCCCCCCCCTTTTGA
TAGCAGAGATTGAACTCAGGGTTGTTTAACTGCTGAGCCACATCCACAGTCCCCCTTTTT
TCAAAAATTTTAAATTCTGAGACAGGGCCTTGCTAAATTGCTTAGGGCCTTGCTAAACTG
CTGAATCTGGCTTTGAACTTGTGATCCTCCTGCCTCAGCCTCCTGAGCTGCTGGGATTAC
AGGTGTGCCCCACCGTGCTCGTCAAAATCTATTCTTTTTGATTGCTGATACTGATTTGAA
TAAATAAAATTTCTTACTCTCTACTTCACACTCCTTTAAAACTTTAACATAAGAATGCTT
CATTTTAGTTAATTATGTAATATTTTTACTCAGCAATAAAAATTTTAAGATAATTTATTT
GAAAAAAGTTACAGTGTGGCAGGTGACAGCCTGTCCACCTTAAATCAAGCCACAGTGCTT
TGCATTTAGGCAGCCTGGGGCTCCACCCTTGACTCTCCCTGATGTTGTGAGCTGAGCAAC
CACTGACCCCACTCTTGGTTGTTGGGGGGAAAGAGAATGATTTCTCTTCCCTTCACTTGG
CAGGGGGACCCTCCATAGTCTCCCCCGCCACCAGCTTGTCTCAGCAGGTGGAGGCCAGGT
ACACGTACCTGTTCATATTCTTTTAAAAAGACTTTTCCTGCCAGGTGTGGTGGTATGCAC
CTGTAATTCCGGTGGCTTGGGAGGCTAAGGCAAAAGGATCATAAGTTTGAGACCAGCCTC
AACAATGCAGTGAGACCCCCTCTCAAAAATAAAAAGGACTGGGGATGTAGCTCAGTAGCT
GTAGCTTGAGTGCCCTTGGGTTCAATCCATGATACACAAACAAAACAAAAAAATTCTCCC
CCCTGTGCAGATGATAAAAACAAACCAATGGCTGCAGCATAGATCTANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGGCAATCAAAGTAGTGTATAATTTAAAGCATTCGTTATCATTCTATGTTAACTGT
CTGAATTTTACTCAGTTAAATCTAATTTAAATTCCAACATTTTCCTGGGTTGTCAATGCC
AAATATCAGTTAAATTCTGATAGTGTGGGGAGCCAGAGGTGACCACACCAGGTGGACAAC
ATTCTTGCACCTGTGAATAGTGGAGTCTGTCGTGGGCAAGGGGTATTCCACAGAAAGTCA
CACAAATAGTAACTGCAGTCATCACATGTGGAAGTTTGGAAGAGTATAGGCTACTCATGT
TTCAGAGGGTGAGTAGGACCCCAGCATACTAAACAGAATGATCTGAAATGATCAGTTTTG
GATCATTTTTTTTTGTCCTACAAAAATGGCAACTTATTATGATTTGACCTAATATTACCT
TAGTGAATTGATAAGAAAAGCCACTTCTCTTTCTGAATCTTCTTAAAAGCTAGTGCTTGG
TAATACCGAGGTTTCAGACATACTCACCGGTGTTACAAGCTAACCCACACAGTTCCTTCA
AGCCTTCCAAGGCCTTGTGTGGGGGAGTTGAATGTGATGTCTCTGAAGCACTGGAAGGGA
GGTGAGGCCCAAGGAGGAGAAGCGCATATAGTGCTCCCACTGCGGGTGCTGGTGGTTCTC
AGTGAGTGGGTGCCTCTTGACCAGTGGGGACCTGTATCTGAGGGACGTCTCTCAGAATGG
ACAAGGTGTTTTGCAATGAGGATTAATTTTTACTAGAGTAGTTGAGGGTTAATTGCATTC
ATAGCAGGGAATAAGAGCAACATTTTAAACATACTGAGAGTAGAAGAATAGTACAGAGAC
CCTTGTGCTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGATACTACAGTGCATCACTTTCT
GTTTTGTTAAAGAGTTGACTAAACTCTTTACCTTTCAGTTTTGACCCATTTGAATTTTTC
TTATGAATATATTATCCTCTCCTGAACCTCAGCAAATGTCTGGTTGTAAATTTTTTAAGG
TCAAGGAATTTTGTATGCTTTTATCTCTAACATGGTACTTTGGTGTTTGGATCTTGCAGA
AGGTGGAAGGATGGAATATTTGATGAATGTGACTAAATGAATGACCAAATCTAGTTCCAG
ATTAAATACAAATAAAAATTGTCATGAAGAATGCAGTGAATGTTGGCCACAACAGTGCTT
TGTGTGTATTGAGGACTGAAAGTTCTAGGAATTTAAAATTTTGTCTTCTTTTATCCCCTT
CAGTAACATTTTATGTGTGTGGATATGTGATTTTTAATTTTTATTTTTTGGCTTTTCCTG
GATGGTCTCTCATTTCTAAACATGCTGTATCTGTAGTCCCAATTTGGATTTGAATTTGTG
GTCTATTTTAACTGTTGTGGTCTACTGAGAAAGAACAGGAGGCTGATTGAATATCAAACA
ATTTGGAGGTGTTACACAGGATCTAATGAGAGGATAGGAGTAAGTGTACAGAGGTTCTCC
ACAGCTGGAATTGAGAGGAGGGGCAGGAGAGAGTGTCACATGAGGATAAGTGGCTACAGT
CATGAGGATAAGTGGCTGCTAAGAGAACTGAGGTAGAGGGCTTCCATCCCAGCAAGCACC
CCATTCAGCACATGCCAATAACATTAATTTCGCCTTATTTGTTGTGTAGTTTTGTTTGTA
TAAGGGCTATAGGCATAAGAAATTTTCACTGAGTTTATGTTTATACATAGTTAAGTGGCC
CAAGTGTATGTGGCACTTAAGAATTTAGGATTGGAATTAGGTAGAATTCAAACCCTAAGT
TATGGGGCAAGTTAATATGTTCTCCAAGTCTTGAGTTATTCATCTGTAAAATGGGGTGGC
AGCAGTTCTCGTGTTATAATGCTGTGAGATTATCCATATAAAATGCTAAGACAGTGTCCA
GCTCATCGTGACTGCCCTTGTAGTTGTTAGCTTTGGTCACAGCATAACTTCTTTAATAAG
AACCCATAAACATTAAAGTTTGAAAAGCCTGGAATTAGGTAAAAGGTTTGGTTTTTTGGG
GTTCAGTTTTGGCATAGCCTTTTATGATGTTTGGCTAATCTTAAAAACTCTCAGATGCAT
AGTTTCCTGACAGCTTCTTACTGCTTAAAGTTATTGTAAAAACTAATAGGAAATTAGGAA
GTGAGTTTGCATTAGTCAGGGTTCTCCAGAGAAACAGAACCAATAGGATAATGTCCATAC
ATCATATATGTATATGTATGTATATGGAGGAGGGGGAGAGGATGTATAAGAGATTTTTTA
TGGAAAGAGGCTTATATGATTTCGGAGACTGAAAACTCTGACAATCTGCTGTCTGAAATC
TGGAGACCCAGGAAAACCATATACTGTAGTAGTTCACCCAAGTCCAAGGCCTGAGAGTCA
GGCAAGCCAGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGAGCTT
CATTCTAATTTCCAGGCCAGCAGGTTGGACAAAGATGTTAGAATAGAAAAGAATTTTACA
CACGCAAAAAATAAAGACTTAGCTATTTCTCCTTGGATTACACTATTCAGAATAATTTAT
CTCGTGAAGTAATTTTTTTATATTATTTTTTTTTTTAGTTTTAGATGGACACAATCTTTA
TTTTTTACTTTTATGTGGTGCTGAGAATCGAACCCAGTGCCTTATGCATGCTAGGTGAGC
CCTCTACCACTGAACCACAACCCCAGCCCATTAATTTTGTTTTTGAAAAACATTCCGAGG
AATAGTCTAAGGTGGAGAAAAACCTGCACGTTCCTTCTCAAGGTGGAGAAAAACCTGCAC
GTTCCTTCTCAAGTTACTTCCCAAAGTTCTTAACAATTACTTTTATATGGCCCCTCTGGT
GTGGCTTTGAAAGGCTTTATGCCAAAGTGGACTATGGAAGACTGTGCATGGGACCAGAGG
TGAAAGGAGCATATGGCTCTCGAAGTAACTTGGGGTTCCCTGTGGTGAGTCTCCTTCACC
ATGTCTTGCTTTCAGGGCCACCGAGATGTGGTCCGAATGAGGTACTACTGTGGATACTGT
AAAGCAGAATTACCTCCATCTCTAAATAGGTGCCATGCATTTCTGAGCCCTAGCCCCGTA
TTTTCAGTTCTCTCCCCATATTTCCAACTGGTTCTGTCATCAAACATTTCCCAGCCTTGC
TCCCTCAGACCTGGTTGTCCTTTGGTATTCTCTATCATGGCTTGTGGTATCAGGGCCTGC
TGCTCACTCCAACTCAAAATCCCTGAGCCTGCCTAACTCCTTTGCTCTTCCTTCCCATAC
TTAAGGTCACAAAGTTTTGTGGACTCTGCCTTCTAAGTCCTCCGACCCCTCACCCATACA
CTGTCCCTGCTCTCCTTACCTTACTTACGGCCATTGAGTTGATGCAGATCCTTATTATCT
CTCACCAAGAGTTAAAGTGGGAGAAAGTGCATGGGGTCAGGTGTAGAGTATGGCAGTGGC
CAGCCTCCCTGTCTCTGCCCATTCTCTGCACTGCCTGAGTTATCTTTTCAAAAACATGCC
TTGGCATAGGCCTCCTCATTCCCTACCCTACAGCCACTCAGGATAAATCTAAGCCCCAAA
GTTTGGCATATAAGCCTCTTTCTAATTTGACCTTAAACAACTTTTCTGATGTCATTTTCC
ACAGCGCCCCTGAGCCATCCTAAGCCTTAGCCACAGTGAATTTCTTTCAGTTCTCAGAAT
ATTCTATGCTTTTTTTTTTTGGCAGCTTGGAACCCTCAATTTTTTTTTTAAACAGGGAAA
CTTATCCTTTAAAAACCAAATCCAGATGTCATTTCCTCCCCCAAACCCCCAACTTGCCCG
TCATTGCCCACAGTGCAGTGACATACATATCATACCATAAAAGCACACCACTTTATCATT
TCTAGATTATGACTCATGCCCCCACTTTCACCGTATTATTGTGAAATCCTCTTGTAGAGA
CCCTTACTTGGCTTTCCTTAACTTTGAAACTAGTTGGTGTCCGGTGAGTGTTCATTAGCA
GAGTAGATGAAATAATGAATGAATAAAATTTTGGACATTTATATGCTAACTATAAAGGAA
AATGTTTGGGTAGGAAAGCCCAAATGTTAATATATTGAGTGACTGTACATCACAAAGCAC
GAGTCTAGGGTGAATGAGTCAACCCACTATCTAAAGCCATCTCAAAATTTTCTGTACAGA
TTGAGCAACATCTGACATCTGCTTTCAGTAGCTGGGGCAGGCGGTGGGTGGCGATGGGCA
TTTTGTAAGCAGGCCACAGCCTGCTCTCAACAAGCTGGCAGGTGAGATATGCCACCTCAG
AGCAATGTCTGGATAACCTCATGATGCCAAGTGATTTCCTTCAGGGCTGGGGCTTAGGTT
ATTAGATTCTTCCTTGTGCCATTAGTGTTTTCTAAGGTTTCTACAATGACCTTGTGTGTC
TTGTTCTTAGGTGAGTGTCACTCAGACAGTTTCTTACACTCATTAACTGGGTCAGAACTC
AGGAGCCAGGTAGGTAGCACTGTCTGGGGAGACCCTTGAGTGTCATGCAGCAGGTTATTT
ACAAGCTGGCTCTCTGCTTACCTTTCCATCCTACTTTAGTCACACTTGTCTTTTTTTTTT
TTTTGCTTTTAATTTAGCAAATATTAGCAGGTCTTGCATTATGGCTCAGACTCTCTTTTA
AGTGCTTTGCAGTATTAGTTCATTTAATTGTCATAATAAATCTATGGAATAGGGACTAGT
ATTATTCCCATTTTACAGATGAGGAAACTGAAGTCATGCCCGAATGTGTTTTTTTCTTTT
CATATGTTGTTCGTTCTGCAAGATGTTTTTCTCTACTGTCCCTTTTCTGACATGTAAATC
ATAATTCATTTTTTTCTATATAGCACCAACTATATTACATAATTGTTTCTGTATTATTCT
TTCCCTCAGGAAAACCAGGAAAAGTTATCTAATTTTGTATTTAACTGTGCTATGGGCATC
ATAATCCTTGCCTTGCAAGGTAACTGTGAGGATTAAAAGCTCCTGGCACAATTCCAAGAT
GACATGTGCAGGAAATGAGCTTTTCCTATCTTGTCTTTTTGTGCCCTGTGACACAATCAT
TGACACAGGCAGTTGACAATAAAGCCAGGGAAAAGGGGAGAAAAACCAGGATGACCCAAA
GTCAAGGTCACCAAGGGAGAAGGGTCAGAAAGCAGATGTCAACTCAGAAAAGACCGTTGG
GCTTGGTCATTAGCGCTGTTTTTGAGAAGAGCTTTAGCAGTCTGTGAGGTGAGAGGCAGA
TTGCAAGTGGTTAAGGAAGAGTGGGCGGGAAGGAAATGAAAGCTGGGGGTGCAATCCTTT
TGTCTTTCAGGAAGGGAGAAAAAGAGTTAGGGCATTAGCAGGACCAGAGAAGGGATCTTG
GTTTGGGTGGGGAGGTTGAACAAGTCTGTAGACAGAAGTCAATCCTTAGAAGAGAGCAGC
TGGGGAGAATGCACTTCTTCCTATCCTGGGGCACTCCCAGAATCCCTGTTGACCCTCCTG
GACTTGGCTCCGTTCATTCTCTTACATCCTTGCAGCTGGGGCATCCCAGGGTCCAGTGGC
GTTGGGGTCAGTTGAGGTCCTTGGGAAATGTGTGTAGCTTGTCTGAGCTGTGATTTCCTC
ATCCATTACAACAGTCTTGGTGCCTACCTCCCAAGGATTTTGTGAGCATAGAATGAAGTC
CTTCTGTTAAATGCCAGCTGTAGGGTCTCACCTGTTGTGTCCCTTTAACCTTCTCTTGGA
GACAAGATGAAGGAGAAGAGAAAGGACAAAACCTTAGAAGACTGTTGAACTGCAGGGGGA
GGAAGTTGGGAAGGTGCTCTCAGAACGGCTGCTGTCTTCTCCACAAAGCAGGGAGGAAGA
CGGTCCACCGAGCTGAGGGGAACAGGAAGGGTTTGCAGTTCTCACAGAGCTGCTGGTCTC
CCTGAGGCCTCCAGGTGCTCTCCACTAAAGATAAATAAAAAGGACTGGAGAGCCTCAGTG
AAGGTCTGGCTAGGTGTAGAGAGAGCAGGTGAACTTCTGCAGCCAGGTGAGGAGGGACTT
GGGAAAAGTGTGGACACAACAGGAGCTGATAAAAATGCCAGGGGGTGGGGATATTAGTTG
TTTGTGTGTGTGTGTGTGAGAAAGAGAGAGAGAGAGAGAAGAGAGTAACAGAGAGACAGT
GCGCCCGCCGCATCAGTACCAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGGGCTCGGCAAAACAACAAAGAAGGGTGAGAAGGAGGTGGAGGAGGGGGAGGAGGG
GGAGGAGGAGGAGGGGGAGAAGGAGGAGGAGGATGGGGAGGAAGGGAGAGGATGCCCTGG
TAAAATGGCCACTGGGATAGTCCAGTCAATGGGAGCTGCTGATGGCCGGAGAGTGGGGCA
GGTCTGAAGAGGTGTGGTGACACTGAGGGTGCAGACTGGGTCCCTGCGAGTGGGTGGTGA
GCCCAAAGGTTACAGAGGAATTTCACAGAATTAGGTGAAACAGTTTTCAGTGATGGAGGC
CAGGACATGGCTGTCAGCCTCAATAGACAATGATTTTACTTCTCTTTTTTTTTTCCTTCT
GTTATCATATGAACATCTACCACAGGGAGGGGGGAAGTAACCTTAGTCTTTATACAAAAT
TTAGTGTGGGATGCGTTGTTATTCAGCCAATTTTTAAAATTTCTATATTGTAATCATGAT
CATTTAAATGGGTATATGATATCAGATTATCCTCGCAGATACTACTTGGTGTTCTTTTGG
ATTTCTCCCTGGAACAAATTCCCAGATGTGACGTTACCATGCTCAAGGGTGTGGATGATG
GTGGAGGGGAGGGGCCTCTTGGTCTGCCATTCGCTAATTGCTTCAGGCAGATGTGCAGTG
AGCAGGGAGGGAGGCCACCAGGGAAGTAAAGGAGGGCAGTCAACCCTAGAGTCCCAGGGG
AGCTATCTGTGAGCACCGAGGTCCACCTTGCTGAGCTCCCTGTGCCACCTCTACGGGAGG
CATCTAGAGGCATCTATACCGGAGGAGGAGACACAGCTGGCTGAATTTGCATCTGTGATT
GCGTCAGTGGAGTTTTGATTGGTTTTGCCTTTGATACTTTTCTTTGGGGACACCACTGTC
AAGAAGCTGAAGAAATCAAACAAGGCATGTGTCTGGGAGGGAAAGGCAGTGAAAGGGAGT
CTATTTCCCTGTTCTGGAGGTTTTTTGAGGCAATGACAGAACAATTTCATCTTTTAGAAA
TTAAAGGATTTAATGGTTTTGATTATAATCATCACAGTGTCTTTTATTGGTTACTTTTAG
TTATACATAACATTAGGATTCATAGTTATAAAAGCATAGAGTATAATTTGCTCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGGAACTTAGGTCAGATTCATCCCAC
TGTTCTTCCCTTATTGCTTCCCTCCTCCCTCTTCCTCAATCACCTTCTTTTACTTCACTC
ATCTTTCCTTTCTCTCCCCACCGACCCCTTATTTTGGACTGGCTTCCACATATCAGAGAA
AACTTTTTGACTTTTGACCTTTGGGGTCTAGCTTATTTCATTTAACTTGATAGTCTTCAG
TTCCTTCCATTTACTGGCAAATGCCTTAATTTCATTCTTCTTTATGGCTAATATTTCATT
GTGTTTATACACCACATTTTCTTCATCCATTCACCTGTTGAAGGGCACCTAGGTTGGTTC
CATACCTTGGCCATTGTGAATTATGTGGCTATAAGCATTAACGTGGCTGCATTCCTACAG
TATGCTGATTGGATATATACTGGGGAGTGAGATAGGGTCATATGGTGGTCCTATTCCTAG
TTTTTTGAGGAAGCTCTATACTGCTTTTTAGAGTGGTTGCACTAATTTGCAGACCCACCA
GCAATGTATGACTATATCCTTTCCCCCGTATTTCCCCAATACTTATTATTATTTGTATTT
TTGATAATTTCCATTCTGACTAGAGATGAAATCTCCATGTAGTTTTGACTTGCATTTCAC
TGATTGCTAGAGATAGTGAACATTTTTTTTCATATATTTGTGGGTCATTTGTATTTCTCT
TTTGAGAAGTGTCTTTTTAATTCTTTTGCTCATTATTAATTGGGTTATTTGCTTTTTGAG
TTCTTCTTATATTCTGGATATTAATGCCCTGAGGAATAAGTGACAAAGATCTGTTATTCT
GTATTGTCTCTCTTCACGTCATTTTTTTCTGTATTAAATGAATTTATTTATATGCGGTGC
TGAGAATTGAACCCCGTGTGTCACACATACTAGGCAAGTGCTCTACCACTGAACTACAAA
CCCTCTCTTCACGTTGTTAATTGTTTCTTCTTTGCTGTGCAGAAGCTTTTTAGCTTGATG
TCATCCCCACTTACTGATTTGTCATTTTACTTTTGAGCTTTAAGAATCCTGTTGAGGAAG
TCGGTTCCTCAGCAGACATGTTGGAGTGGTGGGCCTACATTTTCTTCAAACAGTTGCAGT
GCTTCTGGTCTAATTTCTAGGTCTTTGATTCACTTTGAGTTGAATTTGTGCAGGGTGAGA
GAGAGGGGTTAAGTTTTATTCTTTTACATATGAATATCTAGTGTTCCCAGTATTTCTTGT
TAAAAGGTTACCTTTTCTCCAGCATGTTTTTGGCATCCTTGTCTAGTATCAGATAACTGT
ATTTATGTGGGTGTGTTTCTGTGTCTTCGATTCTATTCCTCTGGTCTATTCTACCATGTC
TGTTCTGGTGGCAATACCATGCTGTTTTTGTAATGATAGCTCTGTAGTATAATTTGAGGT
CCCTTATTGTGATGCCTCCAGCATTGCTCCTTTTGCTCAGGAATGCTCTGGGTCTCTTGA
TTTTCCAAATGAATTTTAGAACTGTTTTTATTAGTTCTGTGAAGAATGCCATTGAAATTT
TGATGGGAATTGCATTGAATCTGTATAATGATTTCATTAGTGTGGGTGGTTTGACAATAT
TAATTCTGCCTATCCAAGAATGAAGATGGAGGTCCTTCCATCTTCTAAGGTCATCTTTAA
CTTCTTTATTCAGTGTTGAATACTTTTTTAAGAGTTAAAGGGAGATATGACTTAGTTCAT
TATTAAGGACATTGAAATATTTTGAATCGGTTATTTCATCAGCAAATATTACCATTAAAA
CATTTTTCTTATATCTTATGATTATAATGCTTTTCCCTTTTTTTCTTTCAACAGAAAAAA
TACAGAAAGGGGTTTATTGATATTTCAAAAATCAAGTGTGTGGAAATTGTTAAGAATGAT
GACGGTGTCATTCCCTGTCAAAATAAGTATCCATTTCAGGTAAGCTGGTATGTTTTTGCA
GTAGTACGACTCTGGGCTTTCTGTCATCAGTTTTCCTGTTTGTCACTAGTTTGGTGACTG
ATTTTTAGGTTTATTTGCCACTTTAATAGTAATTGCTTTTCTTCATGGACTACTCATATC
ATTGTTGAAATATTATCTTCTTCTTTTTTGGTTGTTAGATTATACCAGGGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGGGGGGGGGTGGCAGGCAATGGGGATCAATGGGGCGGTGGGGACTGGACTAAGA
ATTAGGATTTTTGATAATTAGACTAATAGAAAAAGAAAAGAGATCTATTCTGCAAGCTTT
GGATTCATTTTAAGAAGGATGATTAAAAAAAAAACAGGAAAAAATAGAACAGTATTCCAT
CCCTGAGCCATTTTCAGTAGTTGAGATGAATAGACATAAGAGCCGTTTAAAAAAATCTTT
AAATCAATTTAGAAGAGATAAACTTGAGCTCTGACTATGTAATTTAAACCAAGTGGATTT
GAAAGTCAAAAGAAATCCTCTTGTAACTTAAGCATAACTAAGGAAGTGGAGATTCTAGTT
TCACATCTTGATAGTGAAATTTTCTACAAAGTCCAAATGGGGGAAAAATAAAAAAAGAAG
AAGTGGACATTTTCAAAAGACACCAGGAGAAGAAAGGAAGTTGCTTCCTCTCTGAATATT
CTAGCCCAAGGAAGAACAGAGGAAACAGCTTGTGCTTTCTGGTGGCACTTGAGGGTTCCC
CCAGGAGGTGGCATGTCCTTCCCGGGTTTTAAACCCAGATCTACCTGCTACATCTGTGCT
GTTTCTCCTGCACTACACTGTAGTTAAGTCTGTTGAACGGAATGTAAATTTAAATGGGAG
GGAGGATAACTGTCAATGTACTGTGAGTATTTCTTCCCAGTTGAAAATGGTTTCTGCCCT
TCAACAAGGGAAAGGTGGCCAAGCTCTTGCTTCCTGACAACCTCTACTACTGTACAATGA
CTCACCAGAAGTCCTGAGGCACCTGAGAAACCTAGTTCTCACCCTGCCACAGGTGCTGTC
CACAAGGATGACATGGAAGATGAACCTGATGTTTGATCTGGGCTTTGATGAAGGGAGGAC
TCAGGCCCCTAAATATCTCTCCTTCCTGTCAATCTATCAGAGATGCCCAAATTAGATACT
TATTATTTGGGTTTAGGGTGGTATTTATTTATTTATTTAGGTGGAAATTTCTAGAACAAA
TATAAATGCCCCAAGGAAGCGAGGTAATACATCAAGCTAGTTTTAATTATCGGAACTCTT
TTAAATTTGGATTAACTTTACTTGGATTAGCTGGTCTTTTAGTTTATTTTTTATTTATTT
TTTTTACTTGTAGATGAACACAATACCTTTTATTTTATTTATTTATTTTTATGTAGTGTT
GTGGATTGAACCCAGTGCCTCAGGTGTGCTAAGCAAGTGCTCTACCACTGAGCTACAACC
CCAGCTGGGATTAGTTGGTCTTTAATGAACTTTAACAAAGTTACAAAGCTCATGGTACAA
TATGAGCTCAGTTTTGTGAAGTAGTTAGTCTGCACGGAGCCTGGAAAGACAGACTTTAGG
AGGGAACTATCAAGGGGCCATTTGAAGTGTTTGGGAGAAAATACATGAATAAGAAAAATA
TCTGGGAGTGTGTAAGTTGGTTTTTGGCTGTAGTGACCAAAATGCCTGACAAGAACCAAC
TTAGAGGAGGAAAAGCTTACTTTGGCTCACCGTTTAAGGAGTTGCTGTCCATGTTGGCCA
ACTTAATTGCCCTGGGCCTAAAATGAGGCAGAGCACTGTGACAGAGGGTGTGGCTCAGGA
AAGCTACTTATCTCATGGCAGCTGGGAAGTAGATGGGGAGAGAGAGAGGAGGAGAGGAGC
AGAGACTGGGAAGAAGATAAAATCTTCGAGGGCATGTTTCCAGCAACCTACTTCCTCCAG
CTAGGTCCCGCCTCTTAGTAGTCCATCCAACCGTCAGATGGATTAATCCACTGATAAGGT
GAGAGCCCCCATGGTCCAATCATTGCCCCAAAGCCCCACCTCTGAACTTTGCTGCGTTGG
GGACTATCTCTTTCAACACATGAGCTTTGGGGAACATTCCAGATTCAAACCACTATTGGG
AGTTAGATCTTATTCGTATGACTTAAGCTCAGCCACTTTGGTTTTCTCATCTGGAAAATG
AAAATTCTAACACTTATAAAGACCTGCGTTGCTCTATGGATAAAACAAGGAAGTGTATAT
AAAGTACTTGACCCCATGTAGTGACTCCGTAAAGTACGTCATTATAATAAAATAAATCAT
TCTTATAATATCCCACAGGATTCTGGAAGTTCCAAAGTCTTTGTACTTCTTTCCAGACAC
ATCAGTGAGAATTCAGAATAATTTCACTGGTGCATTTTAATCTCATTCTTTGTGTACTAT
CGGTTGTCTGGGCAAATCTAGGTTAGGTGTGAAAATATGTAGCAAATAAAGAAACATCTT
TCTAGCATCTCCCTCTGTATTTTATCTTTCTTTTATCATTTCTCGCCTTTACTTATTATT
TTTTTTCTTTCTCTTTTCTCTTTATGGTACTGGGGATTGAATCCCAAATGCTTTATCACA
GAGCCACATCCCAAGTCACTTTTTGTGTTTATTTTGAGATAGGGTCTTGCTAAATTGCTG
AGGTTGGCCTCAAACTTCCAATCCTCCTGTCTCAGCCTCCTCAGCTACTGGGATTACCGG
TGTGCACCATTGTGGCCTGCTCATGTTCTGCCTTATAATAAGGTTTTCTAGACATGTCTT
GGAATTAGCCTTCATGTTTGATTCATTTTTGTGTCTTAGTCATACCAAAGAATATTCTAC
AACTATTTGTCCCATGGTGTTCACATGCTGTCAGAGTGCATAAATTTCACTAAGATGGAT
AAGAAAGGACCATTTTAATGAAATGGTCCTCAGGTTTACTGACCAGGGTCAAGAACAGCC
ATTTATCAATAATTGATATTACTTTAGGGTCAGTCAGCGTTTTTCAGCTTTGTGATTGTT
CATTAGGGGTAAAGTGAAGAAATTCCTGGATTAATTTCCAGCCTTACTTTATTATTAATA
TTAAAAGTATAAAAATAAGACTGATTACGGGGCTGGGGCTGTAGCTCAGTGGCAGAGCAC
TTGCCTAGTATGTGTGAGGCACTGGGTTCAATCCTCAGCAGCACCACATAAATAAATAAA
TAAATGAAATAAAAAGTATTATGTTTACCTATAACAACAACAACAACAACAACAACAACA
ACAAAAAGACTAATTGCCAGACAGCCTACCTCTGAAAGAGGTGCTATGGTTAAAAGCTTG
GCTATTGGAGTCAAAATCCTAGCTTTCTACATTACCAGCCAAATTACGATGGGCAGGTTA
GGTAGCACACCATTAGGGACACCATTTCAGTGCCTCCTGAAGTTTTCCAGATGAGCCTGT
AGATAACCATATCTTTCCTAATTCCGTAATGGAAATAGTTTGATGGGAGGACAAATTGAG
TTAGTATCTATAGAGCATCTAGCTGAGAGCCAAGATTGCCAGTACTAATGAAGTTGGATA
CCACAATTTTTGATAGTGGCAGAAGGAAACTCTAGGAGTGAATCTGAAGGAGTAGTCAAC
TTATCTAAAATATTATTTAGAAAAATATTGGATTAGAGTAATAATCCTGTTCCATCAAAT
TTATCTAAAGAATCTTAATTAAATTGAAAGAAATAACAGATTAATGAAACATCTTGATCT
CTGCATGTTTTTTTTTTATAAAAAATTAGTCTTTTGCAAAATGTGTGCTCCATTTGTTGT
AGAAATAAAGAAATAAATGTGCTTTTATGAGAAAGGAGTTTAGGTTCTTTGGATCTGAGG
TAAATGACTTTTTTTGGTACTGGGAATTGAACTCAGGGGTACTTGACCACTGAACCACAT
CCCCAGCCCTATTTTGTATTTTTTATTTAGAGACAGGGTCTCACTGAGTCGCTCAGTGCC
TTGCCGTTGCTGAGATTGGCTTTGAACTCATGATCCTCCTGTCTCAGCCTCCAGAGCTGC
TTTGATTACAGGCATGCCCCACCAAACCTGGCTTAAATGACTTGTTTTTATTTTATTATT
TTTATTTTTGACACAGGGTCTTGCTAAGTTGCTGAGGCTGACTTTGACTTGTAATCCTCC
TGCCTTAGCCTTCCAAGTGACTGAAGTAAATAATTTCATTCTGTCACTTGAAACTCATTT
ATTGGTGCCCATGGTTCCAAGGACTCGGACAGAAGTGCTGTGTTTAAATATTTATCACTG
ATTTCATTTTTTATTTTATTTTAGGTTGTTCATGATGCTAACACACTTTACATTTTTGCA
CCTAGTGCACAAAGCAGGGACCGGTGGGTGAGAGTTAAAAGAAGGTAAAACTCATGTAAT
AAAATATTATCTGCACATCATTTAGACTGTATTATGACTAAACAGAAATAAGCAATAATT
TGCATTCTATTCTCTTAACTGACCTACATGTTTCTCAGCAGTCAGCTACCGCAATGATTT
AAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTTGGACCAAAGT
GCAAAGGTGTAGTGGCCTAACTTTCAAAAAAAAAAAAAAACGAGGTGAAGAGAAGCATCT
GGCCTTTCTGAATGCTGGGTCAGAAAAATGCTGGGTCACATGATGTTATGAGGGTGTTTT
CATAATCAACATGGTATGCAAGGAATGATTGGCAAATGTTACTTAGCAAACATTCTGTAG
TCTGTTTTATTTCACTAATCATTAATGTGTCTGTGAATTACAGAAATAAAGAACAACAAT
AATATTATGATTAAATATCATCCAAAATTCTGGGCAGATGGAAGTTATCAGTGTTGCAGA
CAAACTGAAAAACTAGCACCTGGATGTGAAAAATATAATCTTTTTGAGAGTAGTAAGTAT
TCATTTTATTCTATAATTATATTGTGCTCACAATGGGCATATCATTGGTACAGTGGCATG
AATTTGATTTGGATTAAGTTCAACACACTTTCTAGAAAATGCAAGGGTGTAGGTGTGTTT
TATAAGAGTAATTAGAATAATGTGTTAAGTTAGCAGTAGGACCTTTTCATGGAATCAAAA
GCAAAGGTCCCTTACAGGGAGCCTGTAATCTGTTTCCAAGTCATGAGCCTAATATGTCAC
CATCAACAGCTTTTCTTCATTAATGTTTATGTATTTGTCAGCAAGTAAACTCTTCCCAGA
TGTGTTGCTAGAAACCTCGTGTAGCAGTGCATCTGCAGCTAAGTTAGTATCATTCTCATT
TTGATGGGGCTTTGAGTTATGGACTTTAGTAATGGCTTCACAGTCTGTCAGAATGATTAA
CTGTCACAATGCTACTCACATGTAAATGTTCAGATGAATAAAAATGTCGAGGGTTAATCT
TGACACCTTATAAATCCTGAAAATGAGAGGCCTTTAGTCATAAGTTAAAAACACACAAGG
ACTCAAAATTGCTAGTGTGATAGGACAGTGGGTATTGTGCTTCTGTTTTCCTGCTGGCAC
CATACATGGTGCTTGCCATATCAGTCAGAACCCATCAAGCTTTTAGATATAAGCAGAATG
GCTATTTGGTAGGGATGTTGGCTTATGCAAAAGACTGGCCTTGATTCTGTAAGTCTCTCC
ACCTGATTGTCTTGGGGTATCCTGACATTGATTTAGCACATTAAAGAGAAGGTCCAAGTT
TCCAAGTCTGTTATTATTTCCTAATTTTTCAATTCTTAAGGTTTAGTATTAGTGCACAGT
GTAAGCTGCTGTTAAAATAAAACAATAAATGGGATGGTATCAGCTAAAAAGTCCCTTCAC
AGCAAAAGAATCAATCAAGAACGTGAAGAGACAGCCTACAGAATGGGAGAAAATTTTTGA
CATCCGCACTTCAAATAGGGTGTTAATTTCCAGAATATACAAAGAACTTAAAAAGCTTAA
TACCAGAAAACCAAAAAACCCAATCAGCTAATGGGCAAAAGAGCTGAACAGACCCTTCTC
AAAGGAATAGGTATGAATAAACAACAAATATTTGAAAAAATGTTCAACCTCTTTAGCAAT
TAGAGAAATGCAAATTAAGACTACACTGAGATTTCATCTCTTGCTAGTCAGAATAGCAAT
TATCAAGAATGCAAGTAACAATTTAATATTGGTGAGGATGGGGTGGAAAAAGATACACTC
ATACATTGCTGGTGGGTCTGCAAATTGGTGTAACCCCTCTGGAAAGCAGTATGGAGATTC
CTCAAAAAACAAGGAATGGAACCACCGTTTGACCCATTTATCCTGCTCCTTGGCATATAT
CCATACACTTAATATCAGCATACTATAGTGACACAGCCACATCAATGTTTATAGGAGACA
ATTCACAGTAACTAAGCTATGAAACCAACCTGGGTGCCCTTCATCAGATGAGTGGATAAA
TAAATTGTGGTATATATACACAATGGATTTTACTCAGCCATAAAGAAGAATGACTTTATG
ACATTTGCTGGTAAATGGATGGAACTGGAGACTATCATGCTAAGTGAAATAAGCCAATCC
CCCAAAACCAAAGGTCAAATGTCTTTGCTGATATGTGGAAGCTCAACCACAATAAAGTTG
GGAAGGAGAACAAGAGAAGTTCAGTAGATTAGAAAAAGAGGAACAAAAGGAAGGGAGTGG
GGGAGCAGAATAGGAAAGACAGTAGACTAAATCTAACATAATTTTCCAGGGTACATATTA
TGAAAATGCCTAAGTGAATCCCACCATTGTGCCCTCTTACAAGAATGAGGTCCTTATTAG
AAAAGATATATCTCATGCTTATATCATTTTATAAAAATGGATTTGATTGTCATATACAAC
TAAGAAGAGCCAATTAAAAGAGGGAGACAGAGGCGGGAGTGGGGAGTGAGGAAGAGAGAC
CTGGAAGTTGCAGTGACTTAAATAAGAAGTTCATCTCGGTTTCATGGTGTCATCCCAAGG
TAGGTGCTGGTCCAGGGCTGGCAGGTGGTTCTGCAGGTAGTTCCTGGGGTTGTTCCACTT
CCAGTGTTCTCTCTCTTCCTGGTATCAGAAAGGGGTAAAGAGGCCAAGGATGCCTGTGGG
AAGACCTTTTAGGGACCAGATCTAAAATTGGCACACCCCATTTGTCCATAGAGCTCTTTG
ATTAGAATTTCATCTCATCTGTGTAGCTGGATAGTCATGTGCCAGCAGAGCTCTGGCAGA
GGAAGGGACAGACTGACAGACCTTCTTAATTTCATAGTGTTGTCATTACAACACTCCCTC
TTATCCACCGGGATATTTCCAAGACCTCTGGTGGATGCCTGAAATCATGGATAGTATCAA
ACCTTATATATACTATGATTTTTTTCTATACATACACACTTAGGATAAAGTTTAATTTAT
AGATGAGTCACAGTAAGAGGTTCCCAACCACCATAATAAAATTGAACAATTTAGTGTAAT
AAAAGTTATGTAAATGTGGTCTCTCAAAGTATCTTATTGAATTGTGGATCTTAGTAACCT
CAGCATACAATTTTTTTTTCTTCTAACTCAAGAAATTTCAGCTTTTTCTTAAAGGAAGCC
CTTTACGGCCTCTCTTTGGCATATCCAAATCGCCAGCATCACTCATCACTGCTGTAGCAC
TTTGAGGCCATTATTAAGTAAAGTAAGGGTTAGTTCAATATAAGCCCCATGACATCACCA
ACTGAGGCTGCTCAGTGATTAACGGGGCTGGGAGTGTATGCAGCGTGGATGTGCTGGACA
AAGGGGTGATTCATGTCCTGGGAGGGACTGAGTGGGGACTGAGATTTTATCATACTCCTC
AGAGAAAGGTTCGATTTAAAAAATTAAGAGTTGTTTATCTCTGGAATTTTCCATTTAATA
TTCCGTATTGTGGTTGACTCAGAACAACTGAAACTGTGGAAAGTGAAAGGACAGATATGG
GGGACTACTGTAATTCAGTTTATTTTTAAATTGAATATACATTATGGTGAACCCAGTTTA
ACAGTGGTGGGGACACAGAGGCAGAGGTACTGGCAACACCCCCTTAGTCAGGCGGACAAG
TCCCTTGCCTGTGTGTTCTGTTTTCCTTGAAGCCACCAATATCTTTATCGATCATTGCTA
CACAGCATTTTGACCTATATTTGTTGTTGACATTTTCAGGTGTAAGAAAAGCACTACCTC
CAGCCCCAGAAACGAAAAAGGTAGGTGATCTCTTGCATTGGGCAGTTACATCTAAATTTT
CAGCCTTTCTGTCCTTAGGTTTTGGAGGGATTTGCAGTTTATTAATTATGTTTAATATGA
ATAAAATATTAAAATGAATATTAACAATAAATAAAGTGAGTTTTAAAATATTAAAATAAG
TAAAAATATTAGTTTTATGATGTGGTTTTTCCCCCACGACCATCTTAGAAGCAGATAGGT
TATGACTTATTTGAATTGTCCTTGATGTGAAATAATATCAATTTAATTATATAGATTTTA
TCACTGGGAGTCCTGTTCTTATCTGGCATTTTGTCTGTAGCTGGGCTGAAAGAGTTGTAT
CAGAAGTGTGGGACTTTTTTAAAAGGAAATTTTGGTTTCAAGAATACAATATGACAGTGG
GGTGCAGTGGCGCACACCTGTAATCTCAGCAACTCAGGAAGCTGAGGTAGGAAGATCGAA
AATTCAAGGCCAGCCCCAGCAATTTAGCAAGGCCTAAGCTACTTAGTGAGACCCTGTCTC
AAAATGAAAAAAAAATTTAAAGGCTGGGGGATGTGGCTCGAGGGTTAAGTTTCCCTGGGT
TCATGAGTTCAATCCCTGGTTAAAAAAACAAACAATCAAACCAAACCAACAAAACCTACA
ACAAAACAAGGAACCCCCAGTATGATCCATGAGTGATTTTAGTGATTTAGTCATATATTT
GAAGACTGGCATATGGTGGAAAAGCATGGACTTTGGACCCAGTCCTGAACTGAGCTGATG
TGAATCTGATATGAGTGACTTTGGAGGGACTGTGTAAACCATTCTTGCCTCACTGGTAAC
ATGGGAGTTACTATGCTGTATTTCATGGTAGCAATATTAAGAACAAAAGAGAAAAACTGT
TAGATCCTAAGCATGTGCCTTGAGCAGTGTGGGCATAAAGAAGTGCAAATCCCTTTGAAT
GGGAGGAAACCTGTTAACAGACTCCATGGTGGGCTTTCCCCACTGCGGGACATTTCAGTG
ATGGGTCTCCCTTTAGTTCTCCTGGTCTCTATTCACGTATTACCCCTGCCTCTCCCTGGA
AAACTGTTCCTGACACATAAAAATTGTTTCCATGTTTCAAGATGGTTTTTGCTCTTGTCC
TGTATTCTGAAAACCCATAAGAGATGTGGTAGCATCTACTGCATCTAAGATTGGAGGGTT
CTCTGGTTGCTATCAGGTGACATATTTGATTAGAGGGCTCTGCCTTATTCTTTGATAATG
TGTGAATCCTTCAGTGTTTTACTGTTTTATTTCAAGATCAGTTTCAGATAGAAGACTAAA
CTTTCACATGTTATCTTGTTTGCTCAGAGAAGGCCTCCCCCACCAATTCCTCCTGAAGAA
GATAGTAGTGAAGAAATAGTTGTTGCAATGTATGATTTCCAAGCAACAGAAGCGCATGAC
CTCAGATTAGAGAGAGGTCAAGAGTATATCATATTGGAAAAGAATGATGTCCACTGGTGG
AGAGCAAGAGATAAATATGGGTAAGCATTCTCTCCCTGGCCCTTGCATGCAGTGAGTGGG
TAGGAGTGAAGTATTGAGTGAAGTATATGTGCTCTATCTGTCATGTAATGAGGTTGTAGT
TTGCCAGAAGTCAAAGTATTCATTATTACTTTCTAGTACCACTGTGTATTCTTAGTAGTC
ACTCAATAAATGCAAACTGATCAATCACTTCTTCCCAGAGGTTGGAAGAGATTATACTCA
TCTCTTTCTCATCCGCCATATGTTTTATTTGACTATTTTGACCTAAGGAGAAANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGAGTCAGGAGCATTACCTGAGCCT
AGGAGTTTAAGACCAGCCTGGGCAACATAGTGAGACCCCATCTCAAAACACAAACAAAAA
AACCCTAGCATTATTTGCACCAGATAACGTAGGATTTAAGTGTAACAATTCTTTTAACCT
TATTTTAAATATATAGGCAGATACGGTTAAACACAGAGGATGAGTCTCTCTTGGGCTTCA
TTAAGTGAACTATATCCTGTGCTCACCTCTGAAATACTATGCATTTACATTATGAGTTCC
AGTGGATAAGAACAGGGGTCTTCTGTCCTGAGAAAGTACCTTCTCTTCCATCTGTTCTCA
CCTCCTTGACCCATCCCCAGTTCCTCTCTCTGTTCCTCAGTTCATTTGGGGGAACAGTGG
TAGCCCCTGGGTGAGGCAGGGTCCCCTCTTCTATTCAGGTCTTGGCACTTCTGGTCACCT
GGGTGCTGGTTTGTTGAGCATTATTACCTTCTTGGGAATCTTAACCTTTTGTGTTTATAA
GAAGTTCCTGCTTCTCTTTATCAGATATTTTATTCATAATTTTATGCAGTTGAAGCAACA
TTAATCCAAAAACCTAAATCCAAAGTACTTTGTTGATATTCTGAAAGTTTTTGGTTTTGG
AGTACTGGGTTTCAGATGATAAGTTTAGGGATGCTTAACTGGTAGAGTCTATGTAAATAT
TCTAAAATTCAGAAAACTCTGGAACACTTTTGGTCCCAAGTATTTCAGATAAGATATATT
CAACCTGTATTGTAGAAATTTCCAAACATCTACAAAAACATATAATAACATTAATTAACT
TAAAAAATTACCAACATTTTTACCATCTTGATTTACCAATCTTCCTGGTGTGTTTTTCTT
GGGCTATTGGAGTACGTAGGCCTTCTTAATTCCTGACTTGGGGTGTGATTCAAGAATTTG
CCTTTTTGCTTTTTGTGGGGCTGAGAATAGAACCCACGGCCTTGCTCATGCTAGGGAATT
TGCCTTTTTAACAAGTACCTCAGTGAAGCTATATTATAAGTACTGTCAAGGTGTTAGAGT
GGTGTGTGCCTTTATTTAGCACTTTTGCTTTTGTGAATATTCTAGTTTCTTTAAAACATC
CCAAGAGCATGTATAAATATGTAACAACAAATCCCAACATTATATGCTATTATAATACAT
AAATAAAAAATGTGGAGGAAAAAAAAATCCCAAGAAATTGTGCATTCTGGAGATTTCTAC
ATTGAACCATAAGTCTAGAGTATCAGCTCTGGTCTAGTTGCTGGCTAGCTTTGGGACCTT
GGGAACATATCTGAATCTTTCTAAGCCTTGCTTTTCCCACCAGAAAATGGGGACAGTAAT
GCCTGCCTGCCTCAGGACTCTTGTGAGGATCAAACGTGGTAGTACTTTGTAATGTGTCAA
ATGACACAGATATCCTGAATTACTGACAGTGAGCTTATCTTTCTTATGAGCTTTGGGCAA
TATGCTTTAACTATCTTAGAACATCTTTTATCTTCCTTTCTTTAAATAACCTCTCAATAA
AGTAATATCTGTTTACCCACAGTGTTTTTCTTATTTCTAGGAGTGAAGGATATATCCCAA
GTAATTATGTAACAGGAAAGAAATCAAACAACTTAGATCAATATGAGTGAGTAGATGTTT
ATTTTATAAATGGGAAAACCCAGAAAATGTTTTCATTTTCTTCATTATGTAAGGTGTTTT
GAAAATTGATGGGCTTCTTTCAGAACCTTTAAAACATGGTACCAATATATTCTTACCACA
CCAGACAACTGGTGTGGTAAAACACTGAGAATTTGTATCTATAAGGCATTTTTCCTGAAG
GTTCTGTGTGTGAATGGAGTTATACAAACAGATACAATTGAATTGATTTTAAACAAATTA
TAGCTTAGCTGATTTTGAAATATAGATCTTTTGTTCATTCAAAATATGATATAATATTTC
CCAGAGTAGTCTTTAAAAAAAGTTTGTTTCCTTTTTCTAACTAAAAGTTAGATTATGCTT
ATTGTTTAAAATGATTTGTTCAAATACAATATCTGTTTAAATATTATATATTTAAATATG
ATTATTGTTTAAATATGACTATTATTTTAAAAACTGTGAAAATAATTGGTTCTGAATCAA
GACACATGTTTGCGGTAGCTATTGGTTTCAAACAGGAGCCAAGAGTGATAGCTTCCTTTG
GTCTTTTGGCTATTCACTATCTTGGTGGGAATGGTCAATTCATTCAGAAGAAACATGATA
GAAACAAAATTTTTTTTAAAGAAAAGGAAAAAAATAAACCCCTGAAAATAGGAAAAATGT
TAATAAGAAAAAGTTCTCAAAGACAAATCACAGTTGACCTCTGTCAACATTAGTATTAGT
ATTAGTATTAGTATTAAAAAATATTTTTACTGTCTTTTAAAAGCAGACTCATGCTGTATA
TATTGTTTTGTATCTTTTTTCCCCTCTGAACAGTATGAGTGAATATTTGCTCCTGACACT
GAATACTCTTTGAAAATACTCTTTGAAAATATCTTCATAGATGCATTATGTTTTACTCAG
TCATAAATTCGCTTACTGAATTCTTAGTATGTCTCAGGTGTTCTGCAAGGCCTTGGGACA
CAAAGAGTTTATTGCACTGGATGTGCAGCAGGTAGTCACTTGTGGGGCATTAGGTTGATT
CAGGCATCTTAGCTATGTAAAAATAGCTGGGATAACCTCTTCTTGCGTACTGTCCTAAAT
GAGAGCTCTAAAATTGACACCTCTAATGTTGAAAGGCTGTGTATTTGAACTTGTTAAGAC
CTCTGCTGAGTACTGTCAGAGAAGTTGTCCTGTTTCTGCCAGCTAGCAGTGTGTGACTAG
CACACACAAAGTGTATGGCTAGGCCTTGATGCAAAGCTTGTACACACCACACACTCTTGT
GGTCATTTTGAGATAATGTATTCATGCATCATTAATTTCCTTAAAAACAGCAGCAAGCTG
TTGCCTCTGTTCATGTCTTTTATGGTAACATAAATCTAGATGAGGACAAATAGTTTCGAA
GAGTCACAGTGCTCAGCAGTATGATCCCTTAAGGAAATTTTAGAAGTTGGTGGAAAATAT
AAACTAAATACATTTTGTGATGTATAATGACATTTTGGCTAAAATTGATTGTGTATCGGA
TAGTGGTTTCATAAAATTAAGATAAAGCTGAAGTTTTTTTTTTACTAGTATTTTACTGTA
CCTTTTCTATGTTTAGATGTGTTTAGATGCACAAATACCTACCATTATGTTATAATTGTC
TATTTTTTTTTTTTTGGTACAGGGGATTGAACCCAGGGCCACTTAACCATTGAGCCACAT
CCCCAGCTCTTTTTTGTATTTTATTTAGAGACAGGGTCTCACTGAGTTGCTTAGCACCTC
ACTATATTGCTGAGGTTGGCTTTGAACTCGCCATCCTCCTGCCTCAGCCTCCCGAGCTGC
TGGGATTACAGGCGTGTACCACTGCACCCTGTATAGTAGCATGCTATACAGGTTTGTAGA
CTAGAAGCAATAATCTGAAGCATGTAGCCAGATATGTGTTAAGCTGAACCATCTAGGTTT
ATGTACGTACACATAGAAATTGCATAAAAATACGTTTCATTGTCATTAAGTGATGCATGA
CTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTATATCCTATGT
TAGCTTCATGTTACTCTGAGAAAATGTCTGAGACTATTATTTTATAAAGATAAAAGGTTT
TAAAAAAAAAGATAAAAGGTTTATTTTGGCTCACGGGTTCTGGAGGTTCCAGTTCATGAT
GGATTAGACCCATTGTCTTGGGCCTGTGGTGAGGCAGCACATCATGGTGGGAACACATGG
CAGAGCAAAACTACTTACATAATGAGCAGAAAGCAAAGGAAGGAAGAAGAAGGGGCCAGG
GTCTCACAATTTCCTTCAAGAGCATTGCCCCCATGGCCTAAGGATCTTTCATCAGGCCTC
CCTCCCAAAGGTTCCACAACCTCCAACAGTGCCATCCTGGGGACCAAGCTTTTACACATG
GGCCTTTAGGGGGCAATTCAGAGCCAAATGATAGCATATCACAAGGATGAAAGTATCCTT
TTCAGAGAACCTGCAAATGCATAAATGCATAAAAATTGACCCTTTGGAAGAGGAGTTCAA
AGAGCCCGATCCCTTTTCTTTCCTTATTTCTTTAATTCCTTCCCATGAGCTAGAATATAG
TAGATGAGGAAGGCGCTTCCCTAATTCTCTGAGTATTTTATGTCTAGTCTCCCTTGAGAG
CCACAGTTTACCTTTCCTGATGTCCTGCATATGAATCCCCATCACTTATTCTCACTGTGA
AGACATGGAACTGGATCTTCTGTTACTAATAAATAGAATTTTTCCAATCCCTCACACCCT
ATTTATATTGTGTATTAGAGTTCCCATTATCTTTCTTTAGCTAATTTATGTGACTGCTTT
TGGCATCTGACAAATGTTTCTCATATGAGTGGAAAAGCTTTAGGGACAGAATTCATTCTG
TTCTCCTAGTTTATGTATTTCTCATTTGCATTCAGAAATGGATTTATCAAAATAGCAATT
TTGTTCCACTTGGTCTCATTTTTAAAGTGAGAGCCACAGTAATGAGATGTTGACAATTCT
GAGGTCTTGTTCACCACCTCAGATTCTAAATAAAATATCCAACATCATTCAGTTCACATT
GAGATTACAATTTGTGTTTGGCTGCTGTATAAAAGAATCCAGATAGAAAAAAGTCTTGTA
TTTTATCTTTCTATTTTTGCCTTCTTCAATCAGGGAAGGCCTTTGTATTCACTGTCCCAG
GGTATTTGCTGGACCAGTCAGGTGCTGGTTCTTTTAGGAAAACCTGGTCCACTGGTGAAA
ATTTCAAAGGCCGGAGGATCAGGCTGACTTCATAGCATTCAGTTCAGGGTATTTGACTAT
GGTGGAAGATTCCTTTCCAACTAAAAATCATTTAATAAAACAAATTTAAAACTGAAGGCC
AAATGATCTCGGTTCATGTTATTTTGAACATTTGCTAATAGTTGTATAGAGGGATTGTGC
TGGGAACGAAGGGAGGGGAGAGGACCCCTAGGGATGGGGTGGGAGATGACAGTAAGAAGA
GAAAGGTACAAATGGAAGAAATGATTTACAGTAGAAGGGGTAGAGAGAGAAAAGGGGAGG
GGCTGGGAGAGGGGGGGGGATAGTAGAGAATAGGACAGATAGCAGAATACATNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAGAGCCACCATAATGACTTAGGATGG
AATCTGCAATGTTGGTGTGCCGGGAGCTTAGGATAAGATTTAATTTGAATTTAAGACAAA
AATGTAAATTGACATTGTCTGCAAGTTTGAATCAGTGAAATAAAATTCATTCTCATTATG
ACTGGAACAGCAAAAAATTGCAGACGATTTTTCATATTGTATAATGAATACCTTAAATAA
ATTATGGTACATCCATATCAAGATTTATAGAACTATATTGCTATGAGCTGTCATGTGACA
AATTCATGTTATGATGTATCAAGTAAAGTTTGATCCCACCTTAATAAAATAATGCAGGCA
TAGATGTGTGTTTTCATAAAAACATGGGTAAAAATATCTGAAACTACATACATCAATATG
TTACTGGTTGTCTATTTAGATTATGAGTGACTCTTGCCTAGTTTTTACTTATTGTATTTA
TTATTGGGGAGCTTTATTATCTAATTAATCCTACTAAGAATAAAAACATAATTTTAAATA
ATATGAGACCTTAAGTGTATCTTTTTCTGTTCAGATGGTATTGCAGAAATACAAATAGAA
GCAAGGCAGAGCAACTCCTCAGAACTGAGGTAAGTTGTTTGTGCTTATCTTATGGGTTTG
ATCTCAGTACAGCTTAATTTTAATGAATCCCTAATAAATGGCCCCACACAGTTGTTTCTA
AAGCCTAAAATGTCTATGATATAAATATGTTTTTTTCCACATCATTTTAAAGAGATTATT
TGTGTGTTAGCGCACTGGGCTTCAGTAACAAAGGGCCACGAGCTGAGGGGCTTAAACAAC
GGAACTGTGTCTCGTGGTTCTGGAGGCTGGAAGTCAAAAGTAAGGTCCCAGGAGGGCTGG
TTCTTTCTGAGGGCTGTGAGATGAGGATTTCTTCTAAGCCTCTCTCCTTGGCTTGGAAAT
GGCAGTTACTTCCCTCTGTGCATGTCTGCCTCTGTATCCAAATGTCCTCTTTTTATAAGG
ACACCAGTCATGTTGAATTAGAGCTGACCATAAATACTTCATTTAAACTCAGTGACCTCT
GTAAAGACCCTTGCCTCCAAACAAGGTCACATTCTGAGATACTGGAGCTTAGGAGCTTCT
TTGTCAGGGAAGAGGGATACAATTAAACCCATAACAGGAGGTAATAGCTGTACATGAACA
ATTTTTTCTTTCTTTCATACTGATTTATCATTTGCTACCTTGCTTTCAGCATTTTATTGT
TTTTTCTTTTTTCTCTTGAAGGTATTCATTTTAGAATAATTCACATTGATATACATCTTT
ATAAATGAAGCTTATAAATATTTGCCTATAGAAATAAATGTGCTTATATTCTCACATCTT
AAAAGAACTAAAAGAATGCTCTAGACGAAATGGTACTAGGCTAAGGAAGGAGACCTGAGT
TTAGCTGTAGCTTTTCTAGTCCACTTTTTGCATAAGATAAGAAGGTTGGGTTAGAAGATG
ACCCCTGCAATTCCCTGTGTTTATGATCTAAACACATAGAGTTATTCTATTTAGTAATAG
TTCCAGGTCTTTTAAGCAGTTTTTTTTTTCTCATTTTCTCTCCTGCTTTTTGTTACCAAT
CAAGGTTTTATTGAACACTTGTTTCTGTAGTATGTGCTGCAAAAACAGTGGCAGGTGGCT
TTGCTCATTTGGGTTCCACCTAACCATGCCCATCCCCACAGGACTGTTTGTTTTGGTACC
AGGGATTGAAGCCAGGGGCACTCAACCATTGAGCCATATCCTCAGCCCTTTTTTAATGTT
TTATTTAGAGACAGTCTGGCTGAGTTGCTTAGGGCCTCGATAAGTTGTTGAGGCTGGCTT
TGAACCTGCAATCCTCCTGCCTCAATTAACTACCATAATTATTGTTCCTAATTATTCTAA
TCAGATATATTTGTGGGACCTGATTTAATTCTATTGTCTTTCTAAGAATAAAATTTAAGG
TATTAGGGAGTGTAGCTTAGTAAGCTTGCACAAGGTCCTGGGTTTGATACTGGCTTAAAA
GAGAAAGAATACAATTCATTTTACTTTTCAACTATTAAGCACATTTTTCATCTTAGAGCA
ACATAAATACTAGAGATTGACATGGCATTAGTGGTAGAGTACTTTAAAGTCATAGCTTCT
GTTTCTTGCTCTTGGGACCTGCTGAAGGTTTGTCCTTTATTCATTTAGAATTGTAACTGA
CTTTTTGAATTTCTCCACTTTAGTTACTTGTGTTTTCATTTCTCCTTTTGTAAAGATTGG
CATTTAACATGAAATTCCAGGGGAATTAAGAATATTTAAGTACATTCTTATAAAGAGTAT
GAGTTATTTACAGGAAAAATGCTATGAGGATGGAAAATGATTTGAGTCAGGATTCAAAGC
TTACAGCAAATACGAAAAAAAATGTATGAAATGAAATCTAATTGTTAAGCAACACTCCTT
TCTTTCTTTGTTTTGTACCAAGGACTGAACCCAGAGGTGCTTAACTCCCAAGAAATATCC
CTAGCCCTTTTTTAAATTTTTTTTTTATTTTGAGACAGGGTCTTGCTAAGTTGCTTAGGG
CCTCACTAAGTTGCTGATGCTGGCTTTCAACTTGCGGTCCTCCTGCCTCAGCCTCCCCAG
CCCCTGGGATCACAGGCACGTGTGACAAGCAAGTCATTTTTTCAGTGACTGTTTTCCTAC
ATGTTCAGGACTTACAGGCTCTGCAAAACCTTGTCTGTTAGTTTTGTAAGGGCTCTGAGA
AATGATCTGGTTGAAATGTCTGCCTTAGTGTGTGTGAGAATTTGCAGTTGTGGGGAACTG
TGAGCATGCTTTTCTTTAACTGGTCTCATGGCTCAGTAGTGTGAGGTAGAAAGCCATGTA
GATGGGAGAAACCAAGGACCTCTACTGGTAAATTGCACTTCTCCAGAGCACATTTTCTCA
ATAAAGGATAATATTCATAAAATTTTAAGATCAGGTTCTCACATCTTTTCCTTGACATTG
ATATTAGTTATTAGAGTAAAAAAGCAATTTCTTAACTTTTATTTTAGGATAAAGAAGGTG
CTTTTATGGTAAGGGACTCCAGTCAACCAGGCTTGTACACCGTCTCCCTTTATACAAAGT
TTGGAGGGTGAGTAATCCTGCTCCACTTAATTAATTAACTAATTAATTAATTTTTAATGT
AGAGTTTTATATGAATTTTCCTATATTTTTGTATGTATTCCTCATTTCCAAAAAAAAAAA
AAAAAAGATTCTGCATTCAACAGTAAAAAAAATAAATAAATAAAACTTGAACTTTTTTTC
TAAAGTCTCCTTTTTTTTTTGCCTTTATATTTTCAGGAATTTATACCATAGTTTTCCATA
AGTATATATGTTCAGCATGGCTATAGAAACCTTAGTAACATTCAAAAAAATAATTATTGT
ACACAGAGCTAAGCACTGAGCATGCCTCTGTGAGCAGAGTAGGTGCAGACTTGGCCTCCT
TCCTTCCTGGCTCAGTGGGGGCTGTAGACAAGCGAACGAACGGGCTGGGTGGGGGAAGCA
CTGCGACAGGAAGGTGATATTGGGGCCGGGGGTATTGGGGTTACAGAGCTAAGACATATC
TGTTGTCCTCAATTCAAGTTGAGACCTCCTAGGTAAGGCAGAAAACACTGTATGGAAAGG
AAAGAGTGTTTCTGACCCAGGGTACTGTCCAGACCCAGAGGTGGGAGAGGATATGGTGAA
TTTCAAAGAACTGAAACAGCGTGTGTAGCTGGACTGTAGGGAGAAACCCAGAAGGGGAGG
AAGAGAAACCTGAGAGGTAGAAGCCGAAGCCAGGTCATTTCAGTGTCCAGGACTATCTTG
AAAGCATTTTTATCAAGAGATGACAAGAGAAGGTCTGCATTCTAGAAAGACATCTAAAGT
GGAGTGTGTACATTTTTTAAGCCTAATTTATTTACTTTTAGAAATGCAAGTACTCTGAAT
CCCAGTGACTTGGGAGGCTGAGGCAGGAGAATCACAAGTTTGAGGCTAGCCTTAGCAACT
TAGCGAGACCCTATTGTAGAATAAAAAATTTTTAAAAAGGGCTGGGGATGTACTGCAGTG
GTAAAGTGCCTCTGGATTCAATCACCAGTACTAAACCAAACCAAACCAAATCAAACCACA
ACAACAAAAAAACGGGAAGTGCAAATGCTCTGAAAATTCTCAAGTTTATGCTAACAGCAA
GGACAAAATGTGGTAGCCGCTGATGGCTTTTTTGAGACTTTTAATTGTTGTTGAATGGAG
CTGGGGAATGTTATCTTTCTCCATCTCATGAAAGGGACCAAGTATGTTATCAGTGACCAC
TTGCAGAACTTCCACCTGTTAATGTGAAAGGAAAAACTAAAGAACACGGAGAAAGAAATA
AACTTCATGCCAGGAATAGAAGGGGCCACAGAGAAAGGCTGAGGGTTCACCTATAGAAGA
CATCTAAGAGTGAAGTTACGTTATCCCAGCTTGGTTGTAACACATTTCAATTTTCCTTAT
AGAGAAGGTTCATCAGGTTTCAGGCATTATCACATAAAGGAAACAACAACATCTCCAAAG
AAGTATTACTTAGCGGAAAAGCATGCTTTTAGTTCGATACCTGAGATTATTGAGTATCAC
AAGCACAATGCGGCAGGTAAGTGACCTGTTAACACTTATTTCAAATGTTAGGTATTGGTG
CAGATGATCAGACATCCCAATGAATTCTTCTGTGAGAAGTTTTATTTTGTAGTTAGTTAG
TTGTAAAGTGTGATGGGTATAAAATCAGCGTATGTTAAAGAAGTGATATATCCAAGAAAA
ATCAGAAGTAATACCACGGTTCATAAAAAGTTCTATCTTGACATTAGGACATGAGTTATT
TCAATGGATTATGGTATTGACATTTCTGTGCTTTGTATCATTAGTACTAAACTAAAAAGA
TGTCTGTTTTAAGCCAAGCATGATCACATGTGCTTATAGTTCTAGCTACTTGGGAGGCTG
GGGCAGGAGGATCCCTTGGGTTCATGGCCAGCCAGGGCAACATGGTGAGACCCTGTCTCA
TAAAAAGATACTGTAGTCACTGAAGGAGCTGCCAGATGTACCAGGATTTCATCCCATGCT
GTAGGCTTCCAAAGAGTAGATGATAGACACTCCTTTCCTTATTTATGTTTGATAAACCCA
TCGTAAATTGAGAATATCCTAAATCAAAAGTGCATTTAATCCACCTCGCCTACCAAACAC
ATAGCTTAGTAACTGTGGAGAGTCCACTGTTGACTGGGAGCTGTGGCTCACTGAAGCTTC
CCATCATTGCAAGAGAGTAACTTCTTATATATTGCTAGCCCAGGAGAAGATCAAAATTCA
AAATTCACTAGACATTCAGAAATTGAAGAATGCTTTCTAGTGAAATGATATAATTTTTGC
ACTATCATAAAGTTGAGAAAAATTCTAAGTTGAACCTGCATAAGTTGCAGACTGTCTGAG
ATCACATCCTATGCATTCTCTATCTTCCTGAATCTCTGCTAAACTCAGCACCAGAGTGGG
AACAAAACAAACACCAAAAAAAAAATACAAATGGAAACTAAATTTATGCCATTGAGGTTC
TATGGGATCGATGCAGCATGATTTCTACTCCTGGATTTTAAAGATGGAACTGAACAGGGA
ACAGACAAGCATGGAAAGTGAACTTTTATAATTTCATCAAAGGCCCTTTGTAAAACTTGT
GTTTTTGTGTGAGTCCATTTAATTTTTTCAGAAAATGGTAAGAACAGTTACTATACCACA
AAACTCATCCATTTAAAGTATACAGTTCAGTGGCACTTAGTATATTTTCAGAGCTGTGCT
GTCACCATCATCTAATTTTAAGAACATTGTCATCATTCCCCAAAGAAATCACCCATTACC
CCTCCTTCACCAGCCCAGCCCCAGGCAACCACTAACCTACTTTCTGTCTCTGTGGATTAG
CCTATGCTGAACATTTCACATAAATGGAATACAATGTGTGTTCTGTTATGACTTGTTTCT
TGGATACAGTATAAGGTTTTTGAGGTTTGTCCATGTTATACCATGCGAAAGAATTCTTTT
TTTTTTTTTTTTTTGGTACCAGGGATTTAACCCAGGGGTGCTTAACCATTGACCTACATT
CCCAGCCCTTTTTATTTTTGACTTTCGGACAGGGTCTTGCTAAGTTGCTAAGGGTCTCGC
TAAGTTTCTGAGGCTGACTTTGAACCTTCCATCCTCCTGAGCTACTGGGATTACAGGCAT
GTGCCACTGTGCCCACTTCCATTCTTTAAATAAAACAAAAACTATCACAAGTTTGTTCAA
ATAATTAGGTAATATAAAAATGCACAGGGCTAGAGACATGCAAAGCCTAGCTCAATATTT
GTGTAATATATAGGTTCTCAGGCCAACATACAAGTCTACCTTTATCTCTTCAATAAAAGT
TTTAACTTCAGTGTAATAATGGTCAGTGGTGAGATAGAGGATCCACCCCTCTAATTCCAA
ATCTGGGGAGTTATGTTAACACTCACCTGTTGTGATAGAAAGTCATATCTTATTTGCTTA
TGGAAACCAACACACAGCCTGGGTATGCACAGACTGAAGTCATGAGGATAGGAGAAAAAT
TGCTGGCCAACATAAATACCTGATAACATTTTCTGCCTGATGGACTTGCTACACACGTCC
TTGGAAATTGGCTTGTATATTCTGCTGAGATCTGACATGTAACAGGATAGAGGTCCTGGG
GAATATGGAATTTCTAAATTCAGGCAGCCTGCTGGATAAGATATCAATTCTTTTTTATTG
ATGAAAAATAATCCGTCATATGGATTTTATTTATTTATTTTTCATCTGATAGATTTCATT
TGCATAATTTTAAAGGAAATATAATTATTACATCTAATAACATTTGGGTTGCTTCTACAT
TTTTCATGAATAAAGCTGGTGTGAATAGTTGTGTACAAGTGTATACATGAAAATATGTCT
TTATTTCTCTTGGGTATTTACATGGAGTGGACTTGCTAAGTCATGTAGCAATCCTGTGTT
TAACATTTGAGGAGCTCATTCATATTGACTTATTCCCAAATACTTTATCTGTTTGTTCTG
TTTCTTATTGGTGTTCCCATTCCTCTATTTTTTTTTCTTTTGTAAGTTTTACTTTTTAAT
CACTATCTCAACTCATTCAACAAACATGTATTTAGTGTCTACTGCATGCTAGAAGCCAAG
CTAAGTTTTGGGGAGAGTGCTATGGATCAGATAATCATTGATTCTGATTCTCTCAGATTT
TATCCCCTGAGAGGAGATAGATATACATAACAACTTTAAATTACTGTGAAATGTGCTATA
AAAGAGCAAATACAGAGTGCTTTTGGTGTTGATGGAAAGGCATCTCCTATTTCTTATTTA
GTGCTAAAAGCAACTTAGGTTAAAAGATTTAACTTACTTTCCTGATTTCCAACAGTTGAT
ATTCCCAGTGGTTAATCTTTTCAGCCTATTTTTATGCTAAGATTGCTAGCATTGAGTTAT
ATCAGGGAAATCACTTTAATTTTTAGCAGCTCAGTATAATTCTCTTTCCTAGTTCAGCTT
TCATATTGGAAAGGAACATGAAATACTAACAGAAACCTTTTAATATCATTTAAAATGTTT
GTGAGGAAGCTAGCACAGTGCCTGATACACACTAATATTTAGAAGGAGATTGTGGAATGA
ATGAAAGCCTATGGCATAGAGCTATGTGTATATGCAGAGGGAGAGCAGTACATTTATAAA
TGAATGAATTGTACATTTCTAGATTAGCATTTGGTCATGTGGAGTGGCTAAGAGCGATTT
CACCTGTGATACTTTCTTTGATTTCTAGGACTCGTCACAAGGCTGCGGTACCCAGTTGGT
ACAAAGGGGAAGAATGCCCCAACCACTGCAGGATTCAGCTATGGTAACTCTCATTTTGTA
GTTGTATCAGCTAATTTTCCATGAAAAGAATCCACTATCACATGACAAATTTAGATGTGT
AGAATTCCTAACAGTGGAACCATTCTTATAAATTTGTACTCTGAGTTTTTAGATGGTTCT
ATTTTATAACTATAGTTACCCTAGATTTCCTATTTTCATGATTGTTTGTAATTCAATGGA
AAAGTTTCTGTTGGTGAAAAATAAACATTATCCTGTTATATCTAAAATAAATCATAGCCC
TTCCTGGTTCTCACTGCTGTTGATTACTCTCAGGGATGTAAGGTTAGAGGTAATGGAGAA
CTCTTCCAATGCAATTGTTTTTTGTTGCTTCTGGAAAAAGCCTTTTAAAGAGCAGGTTTA
ATTATTTTTTAACTTGATGGAACTAAAATAGAAAAAAAAATCCAGAGGGAAGAGTGGTAA
GTGAGGAAGTATTTGTCTTCAAAAAAGTACCTTAATCTTCAGCTGTTATTTTCCTATTAT
GCAGCATCTTGATTCTTCAGTTCACTTTGCTTGTATAGTGATGGTCAAGCAGGAACATTC
TCCCCAGAGGGTGGAGAGCCACTTTGAGCTGTTTAGACAGATTGCCATTATCCTAGGACT
TGGAGGCAGATCTTGGTTACAGTTTCTTTTCAACACTGATTCATGCTGTGTTCTCTTTAT
AAACTGCTCTCACTTTTCCCTTCTGTCTGCAGAGAAGTGGGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCCCTGTTTTGTATTAGAAAGTGGCTCTTCCTCAGCTTA
TACACTGCTGGTTTCTTTTCCTGTTGTAACCCTGTGTGTGTATGTCTCACTCCCAGGAAA
CTGACACACCCCAAGTTGGTGCAGCTGTATGGTGTATGCACCCAGCAGAAACCGCTTTAC
ATTGTTACTGAGTTCATGGAACGGGGCTGCCTTCTGAATTTCCTCCGACAGAGACAAGGC
CCATTTCAGTAGAGACATCCTGCTGAGCATGTGTCAGGATGTGTGTGAAGGGATGGAGTA
CCTGGAGAAGAACAGCTTCATCCACAGAGACCTGGTAACCACGAGTCACTGTATTCCCAT
TCACGGGCCTTTGTAAACAATAAGCAATGATGTATTAGTATCCAATTTTTGTTCATAATA
ATGTTTCAGCATTGTTTTTGAACCTGATAGATTTCATTTGCATAATTTTAAAGGAAAGAT
AATTATTAAATCTAATAATTTATGGAGTTGATATCTCTGGGTAAGTTTCTGTGCGTTAAA
TATTAGGTCTCTGTTAGAGTTCCATGAGATAGCAAGTCATAGCAGATTTATTACCCTCAC
CGTTTTGTAGATAAGAAAGTTAGCTTCAGGGAAGTGAAAACCTTGCCTAATGTGGTAAAC
AGAAAAGCTAGGGTTGGCCTTGACCTTCTGGCTAAATCCTAAGCTCTTTTCCACCTCACA
CACTGTAAACAGAAACTATCAGAGAAATCTCTTAGTTCACTCCCTTTATCCAATGTGTTA
ACCTCTGACAAGACCAGAAAAGAAAACCTATTACTGGTTCTAAAGACGCTCCTTAACTTT
TCCTTTCTTATTCTACTTTCTCTCTCTCTTTTTTTTTATTCTTCTTTTCCTTCTATTTTT
ATTTTCCACCTGTTTTCACAAATGTGTCTGTTTTCAACATATCAGTCACACTATCACTCT
ACTTTGACTCTTTCACCAAAATAAAAATGATTTGCATGTAGGACTTTCCGTCATATTTTA
GTTCTAGCTTTTTTTTGTGATAAAGTATGGACACATTTCTTCTAGAGAAGCAGAAAGGCA
TTTTTAAAAATTTAACAGTCACCTTAAAGAGGCCTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTCCAGCACTTAGAAATCTCCACATCTGCAGCATTTTTATTGT
TTTAATATTTGTAATTATAATAGAATGTAGAAAATATTTTTTGAAAGTATATTATTTATC
TTCTCTCCTTCCCTCTATTCTTTGATCTGTTCATAAAAATTAGGTGCCTGCTATGTACAT
GCCGGACACAGGTGTATGAACCAAAGCAGAGACTAAGCCACATACAGCTCATGTTCTAGA
GGAAGGAAAATGCAAGATCTGAGAATAATTCATGTGATAGAGCAGGGGTCAGCAAATGAC
AGCCTGTCAGTCAGTCTGACCTACACTTTTCTGTGTGTGTAAACCAAGAATGGCTTTTAT
ATTTTTAAATGGCTAGAAAAAGTTCAAAGAGTATTGAAACCTGAAAATTATCTGAAATTC
CAAAGTCGGTGTCCATATAAATAGTGTTATTGAGGCAGAGCCTCATTTCTTTGTTGATGT
GTCATCTGTCACTGGTCTCGCCCTGCAGAGGCACAGCTGGGAGTTGTGACAGGGACTGTG
TGGACTGTGAAACCCAAAGCATTTGGGTGCTCAAATAACTGTCCGTCTTCAGAAAAAGTC
TGTGTACCCCTCGAGAGATAACTTGGGGTAGAGCAGAGGTGAGGGAAGCTGCTTTAGATC
AGCTGACTGGGAAGGCCTCTCTGAGATGGGGATAGTGAGTGGAGACCAAAAGGCAGGAAG
TGACCAGTTAGGTGAAAATCTGGGCATAAAATATTCCAGGTGGAAGGAACAAGTGCCAGA
GCTTGAGGTCCGGGATGAACTTGGGCCAACTTGGGGAACTGGAAGAGGGCCAAGGAAGGT
GGCCCATAGGCAGTGCTAGGAACAGTTAAAATGGCAGGCAAGGCCAGGTGCTGTGAGGCC
ACAGTCAGGGACCAGGTTAGCTCCTAAGGAAACTCAGGCCTAGGGAGGTTAGAAAGATGT
TGCCATCAGCTTCTGACTCTCGAGGTGTTAAGCGTTCTCTGTTTGCTTTGCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATCCAGCCCATAGTGGTATCGTTCTCA
TAGCTACCATCTTTATCTGTCTAGTTGCACAAAGAAAGTTTGTTCTTTTATTCGAATATT
TCCTCATGACAGCTTTTAGAAATCAACTTTATATGTACATGTAACCTATAAATACATATA
AATATGTACTGAACATATTATAGCAAAGGATGAAGTTCTCACATCTACCACCTCTAGTCA
GCTATTCACCCCAGAAGCAGCTACTGTTACCATTGCTATATGTCCTTCCAGAAGGGCATA
ACTGTGTTCACATAGAATAATAATATGGTGTTGTTTTGAGTATGTGTGCATGTGGGGATG
TCATGGTATATAAACATACATAGTGGGCATAGTGGTACACACCTATAATCTCAGAGCTTC
AGGAGGCTGAGGCAGGAGGACTGCAAGTTCAAAGCCAGCCTCAGCTACTTAGTGGAGCTC
TAAGCAATTTAGCAAGACCTTGTTTCCAAACAAACAAACAAACAAATAAAAAAATAAATA
GGCCTGGGGTGTGGCTCAATGGTTAAGAGCCTCTGGGTTCGATTCCGGGTACCAAAAATA
TTTAAATAAAATAAATATACATGCCACCATTTATATACTTTATTTTTCTTTTTTTTTTCA
TATGCTGCAGTTTTAAATTGTGTTCTGTGGAATTATGGGGGCTCAAAACATGTGTCTCTA
GAAACTTTTCACCACTTCCTTTAGAACAGCTCTGCTTTAGATCTTTCACATATGGAGCCT
TTGAGTAAAATTTTGTTTAAAGAACAAAACTGCTTACCAGAAAGTTTTCAAACTATCCTA
TTGTGTTCCGCCTCTGTTGCCTAATAAAACAGAAAGATGAACAGAAAAACGAAAGTTCAG
GTACTGATATTGTGATATACCCCTCTCATCCCCTTAAATTACGCTGAGGAAGATGGAAAT
CACTAGGTGTGGTCACTGAGGTGAACCTTTAGCTTCAACCGGATGCTTATAGACTTCAAT
CAACTGTGTTTTTTTATTCTAAGGGGGTAAAAACGAAAGCACACATACGAAACAAAGATC
GTACTTCAGAGGTGTAAACCCACAGTGTGTCTTACTCTAGGTATGTTCTGGATGATCAGT
ACACAAGTTCTTCTGGTGCTAAATTCCCCGTGAAATGGTGTCCACCCGAAGTGTTCAATT
ACAGCCGCTTCAGCAGCAAATCTGATGTGTGGTCATTTGGAAGAGCGGGGCTCCACATTG
CTTCTGCTCTGGGGAGGAAGTGGACACATCATGGACTAACGCTTAATCTTCCCAAGTGTT
TTGATGTGGGAGATATCACTGAGGGCAGATGCCCTTGGAGAGAACACCAACTATGAGGTG
GTAACCATGGTTACTCGAGCCACGCTTCTACCGGGCGAGTTGGCATCCCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1138, 37194..37298, 42264..42329, 42331..42343, 42823..42951, 46179..46219, 47547..47719, 49660..49725, 54274..54328, 56747..56826, 58202..58335, 61528..61602, 62312..62321, 62416..62425, 62517..62638, 62640..62733, 67554..67618, 73840..73958, 74035..74054, 74057..74065, 74068..74082, 74085..74117, 74122..74136, 74139..74147
1001..1138, 37194..37298, 42264..42329, 42331..42343, 42823..42951, 46179..46219, 47547..47719, 49660..49725, 54274..54328, 56747..56826, 58202..58335, 61528..61602, 62312..62321, 62416..62425, 62517..62638, 62640..62733, 67554..67618, 73840..73958, 74035..74054, 74057..74065, 74068..74082, 74085..74117, 74122..74136, 74139..74147
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved