Spermophilus_tridecemlineatus Locus RPS13
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus RPS13
Spermophilus_tridecemlineatus
RPS13
GeneScaffold_1440
SNORD14
3367..3456
4423
TGTTCATCTTCCCGGATCTGGCAATCTTTTCTTTCCTGCCCGCCAAGCTGTCACTCCCT
TGGATAAGCCGCTCAGCAAGGCTTTGCCTAACCCACTTCTCCACCAGCCACGCTTCCTGC
AGGCGGACGTAGGGAAAAGAGCGCTGCTGAGGACCTTCGTCCTTCGAATATTCGGTTTGG
TCCTTTACTGTTAGTGGTCTCTCCCGAGACTAGATCAGCATCTAAAGAAGTGGAAGAACT
TGACAGGGCGGCGGCTGCCAACCATTCCAGTCCAGCATTCATAACACAGTATTGTTATGT
GAATAACAATTCACAGTATTGTGCCCTTGAATGAAAAGATGGGGCAGCCTTTAAAGGAAT
GAAGAGGGACGATGCAAAGGAGCGCTGGTGAAGGAATGAACCCTCTGTTATGGCTGAGCC
CTGCAGCTCTATCTAAGTTCTCCCCACTCCTGCCCAGTATTTGAATGTGTACGAGTTGGG
CGCTGGCAGCACCGAACTTTGATTTACTCGATTTCCCGCTCTGGCTGCAAAACAGGTCTC
ACTCCGATGGTCTCTGGGCTGCGTCTCAAATGCGGACGCATGCGCACGCCGAAATGCATT
TTGGGATATGTAGTCACGCCGCCGCCGGTGGCTGTGAAGCGTAGACACGCTCTCTCCCTG
CGAGGAAGTGGGGACGTATGAGGTCACTTCCTGCGTGCGGAGTGATTTCCTGCGGCGTTT
CCACCCTCACTCTCTTTTTGATCCTTGACTGCCGCCATCATGGGTCGCATGCATGCTCCC
GGGTGAGCGCGTGGCTTGGAGTCGGATTGCGGAATTGGGTCGCAGGGATAGGGGAGAGGA
GAGAGGGTGGGCTGCAGTTTGAGGGGATGATATTCTGGGGTGCTGTGGCACGGGCCGCCA
CCTCACCCCGTGTGCTTCTCTCCCCAGGAAGGGCCTGTCCCAGTCGGCTCTGCCCTATCG
CCGCAGCGTCCCCACCGTAAGTAGCACTGGGACTGGGGAGAAGGTGGGGAGGAGAGTGGA
ATTCGTTCCTCGAGGGAGGCGACTCCGGGGTGTGGAGACGTGTGCACAAGTCTTGAGGGT
GGAGGGGGCCATCGTGCTTCGGCGCCATCCTTCGTTTCTCATCCTAAGGCTGTTTTTTGT
TGCATAAATAGTGGTTGAAGTTGACATCTGACGACGTGAAGGAGCAGATTTACAAACTGG
CTAAGAAGGGTCTGACTCCCTCACAGATCGGTGAGTGTGTTCGTGTCTAATGCATACTCT
ATGGCCTTTTTTGACTTGTAGAAAAAGGTTCCTGCGCAAATATGCCTCATAAGTGCCCTC
AAAATAATTTACCCGGTTTTCTGGCTTTACTTTTTGTTAGTTTTCAAGTTAAAATCTGAT
GGCAGTATTTTGAAGTAAATGTTAATAGTTTTTTCTATTTTACACTTGCAGAAGCTGAGG
CATGGTGAAGCTAAAAAAACTTCCCTCCAAATCTTATAACTATAAAGAGAGAACTTGTAA
CTGGGCTACACCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAAAAAAAAA
TATTGGTGGACTTTTTTTTTAATGTTTATTTTGGTATTGGTGCTTAACCACTGAGCCAAG
TCCTCAGTCCTTTTTATTATTTTGATAGGGTCTTACCAAGTTGCTGGGGTTTGCTTTGAA
TTTAGAATCTCCCTGCCTCAGCCTCCCGGATTGTTGGGATTACAGGCATGCGCCACCACA
CGTGGCCCAGCTGTGATTTTAGTACAAGAATATTGGGATAACTTTTCATTAAAGAAAGTG
CATGGCAGCTCTACATTCCCTTGTGAAATTAATTATTTGCACTAGGTTTTTTTTTTTTTT
TATTGAATTTTATCTTTAGGATAAGGATGCTAAATTCCGCCTGATTCTGATAGAGAGCCG
AATTCACCGATTGGCTCGGTATTATAAGACCAAGCGGGTCCTTCCCCCAAATTGGAAATA
GTAAGTATCTATCCTTCCTTAACTGGAATCAGCCTGATAATAAAGATTCTAGCTCTTAGA
GCTGGGGATATAATTTAGCTCAGTTGGTAGATATTTATAAAGACAAATAGAGGGCCATAG
ATTACAGGCTTCTTGCTTTGGACCATGAGTAAGTCCTTTGTCCCCCCTTGTTTTGAGAGG
AATAGTAATTCCATTTCACACTTCTCCCAGGTTTTTAATGTAGTTTTGATTTTTGCATGA
ATTGCTCACTATGATGATTGCTATCCAACATTCGCAGTTTCCACCAGAAAGGTTTTTCCT
CATGTTGGCCATTCCTTCCTTGGATGTCTGAGTGAGCAATGTTATTCATTATGCTTGAGC
ACAATGAGCTTATTTTGAAACTCAGTTTGGTCTATTTATTTGGGTTTATTTTAGCTGTTT
TGAAATAGTCTCATTAGCAGTGAGAGTCTATGAATGGATACTGAGGACCAATATTAATCC
TAATTTTCTCTTCCCTTTTTTCCTTTTCAGTGAGTCATCCACAGCCTCTGCCCTGGTGGC
ATAAATTTATGTATGTACTCAAACAATAAAAGCATTGTTTAACTAAAAGTATGTTTTGTA
TTTCTTTCTCTGAAGAAAACGAAAATCCAGAAACTAGTATGTTTCAGTGGTTATTATGTG
TTGATCTTCTTGTTGTTGTTGACTTTATTATAGGAAAGTTTGTTAGCTTAGTATTATGAT
TCCAAAGGAGCAGAGTGATGGCATCCATGTATCTCATTCTTTCACTGGCTCCTTAAACTA
ATTGAGCAGCTTGTAACCTGGTGGTTGATGCTGTATATGTACAGGAGAACTAAAAGAGAC
CAGGAAGTAAGGACTGTTTATTTTTATTGGTTATCAATTTTTTTTTTAACCACTGAGCTA
TATTCTTAGCCCTTTTTATTATGAAATGGGGTCCTGCTAAGTTACCCAGCCAGACCTCCA
ACATATAATTATGTGTCAGTCTTCTCAGTAGTTGGGTTACAGGCATGTGCTACAGTACTT
GGATCAGAGTATTTAGTTTACCTAATCCTTAATAATGTACATAGATGTTAAAAGAGGCAA
ATATAAGTTGGGCACAGTGGCATATACTGTCGTGTATAACTAAAAAGTACAAATAAGAAA
AAGAAAAAATTAGAAGGGCTAGGAAATGTAGCTCAATGGTAGAGTGCCTTTGGGTTCGAT
CCTTAGTACTAGTGGGGCGGGGGAGAGGTACATCTCAGAAACTCGAGACAGAATGACAAA
TGGCATGTCTGGATGTTATTAAAAATTCAGAAAAAGCAAAAGGTAGTTATAGACTGAATC
AGTAAGTTTAACAAGTTTAGATTTCAACCTTTAAGAAATTCTTTTAGTTAGGTCTGTCAC
TGCAACAAATTTAAGGATGCTGAACATGAAGAAAGTGACCCATCCAAATATTTAGGGACT
ACAGGTACATTTGTTCCTAGCATTACTTAGTAGCTTTTTACTTCAGCATTACTCTAAGCA
CTAATAAAAATTGTTCAGATCAGTAGGTAAAACCCCATGTTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1169..1217, 1393..1471, 2138..2307, 3021..3121, 3632..3665
1001..1023, 1169..1217, 1393..1471, 2138..2307, 3021..3121, 3632..3662
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved