Spermophilus_tridecemlineatus Locus KCNAB3
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus KCNAB3
Spermophilus_tridecemlineatus
KCNAB3
GeneScaffold_4471
SNORA54
4277..4395
8465
GTCCCTATATCTCCAACTCGTCCTCTTTCCAGTTTTTAACCCTTATATGACTCCACGAG
AAGCCCAGAATAAACTTTTTGTCACCTTCTGCAGCCTGAGCATGTCTGTTTGAGTGGGCC
GCCTGGTCCTGCCCCAGATAAAAGCAGAAACTAGGGCGGCTGTACCCATCAAGCCTGCAA
AGAGGTTTTGCCCAAGGAATTTTCAATAGCCGCACTGCTGACACTTTGAGCTGGAAATTC
TTTTTTTGTGTTTTTGTAGGATTTTAGCCGCAACCCTTTTTGCTAAAGGGTACTAGTAGT
GGTACATCCTTCCCCACCCCCAGTCGTGACAATCAGAGTGTCTCCAAACCTTGTCACATG
TTTCTTGGGGGACATATTCCTCCCGACAAAGAACCACTGAGTAGAGGGAAGGCTGACATG
CGTCGGGTCCAGAAAGTATGGCAACTACGTGCCTAGGATGGATCTCTCTTCTGAGCACAC
GGAATAATCAAGTCACTGAGCCTTCAGCAGGCGGGGCTCATGCAGATGTGCCCCTGGTCT
GGCTGGGAGGTGGGCGGTTCTATGCAGAAGAGGGGGCGGTGCCTGCATGTTGATAAGCTG
GGCCGGCTGCCGACGCGGCTGGGAGCCCCAATAGGTCCCGCTGCGGTTCCGGCTAAAGTG
GCATCCCTCTCCCGCCACCCTTTGTCCCTGGGTCCCCACCTTCTGAGGATCGCCCTTGAT
CTTACCCTCATCCACTTCCTACTCCCTGAACAGCTCCCCCCGTATCTGAATATCTCCACT
CCTGGAGCCCCCAGCGTTTCTCTCTTCCCGCCGCAAACCCCACGACCTCCAGCAGCCCGC
CCCCGCGGGCCCCATCTGCCAGGCGGCTCCCGCCGCAGCCACCTCAGCCTTCCCGCTCTC
CCAGGGATCACCTTATTACAACCCCAGGTGTCCGCGCTGGGGTGTCCCTGCTTCTTCCTC
CTGTCCCCTCAGAGCCCCCTCCCTCGCCCTGGCCAGCCGGCATGCAGGTGTCTATCGCGT
GTACCGAACAGAACCTTCGCAGCCGAAGCAGTGAGGACCGTCTGTGTGGACCCCGGCCGG
GCCCCGGGGGCGGTAATGGAGGGCCAGTCGGCGGGGGGCATGGGAATCCTCCGGGGGGTG
GCGGGTCCGGGCCTTAAGGCCCGAGCCGCTCTGGTTCCCCGACCTCCAGCACCCGCTGGG
CCCTGCGCGAAAGCACCGGCCGAAGCACTGGCATGAAATACAGGTATGGGTGGCCGGGCA
GCCTGCCCATTTGCTCCGGTTCGGGACCCTACGCGTCTGGATGCGCAAAACCTTCAAACT
TTGGTAAAAATGTCCTGCCGGTCACTGACACTCTCTTACTTGGTCCTTTTCTGTTCTCCA
TCAATACTCCCAACAGGATCAAGTTTAGCAAGGTTGAGTCCTGTCAAACCCAGGGGATGC
TCCTGAGTTTCCCTCCTTACCCCTAGGAAGGTTGTGGATGCACAGACCTCCAGGCTGCGC
CCCCTTCCAATAGTGTCCTTGGGTCGGTGTCCTGGGGAGAGGAGGGAGGGAAACGACTTC
TCACTCTGGCCTGCTCTGAGTGTCTGACCCAGATATTGCCCCCCACCATCCCCGAGAGCT
GGGTTTCTTTTGACCTCTCAGGGGTTAGGAAGGGGAGGGGACTGGGGCCTGTGGGAAGTA
AGGACTACTATCTTAAGTCCTCAGGATAAAGGACTGGTCTGGATGGAGGGCGGGCTTAAA
TTTGACATTATCTTAGAGAACTGAGAGACAGGGGCTCCTGATTGGTAGTGAGTAGAGGTC
ACTGATCTGACCTGGCTTTGTCACCTGAGTAATCTCATACCCTCCATGTGTCTGTCCCAA
TTGGGAAATTGAGCTGACTACCTGGATGGGACCCCTTGGGAGGAGAAATGGGCTCACTGG
TTAGGAGATAGTCTCCACAAGACAATGGGAGCTGAGAGATGGAGAGGGGAAGAGGCTTTC
ATGTCACATTCCCCGCCAGGTCTCCTGTTATGTCTTTGTGGGTATAGCCAGAGACCCTGG
ACTGAGTACCTGAACTTGACTTGGTTTACCTCTGCCATCCTGGAGTCAACCTAAGCATGC
CACTCTCTGAAGGGTCTGTACTCACCACAACTATCCACATTCCCTGAAACCCCCTACTCC
ACACATCCCACAGATGATTCAAATACAGGCAAGAACTCACCCAGAAGAAAGACAAACCAG
ACAGCACATCTTCAATACGATAAGAGGGAATAGAGGCATCCAGCCATTTATTGTTCACTT
GTTCTTTTAATAATATTCTTAGGTAATCTGCTATGGTAAGTACTGCCCAATCCCACAGGC
CTACTGGGTCTAGTTTCTTTGGACTGAGACACCTTGAGGGCTTCTCAGTCTGGAAGGAAA
GGAGCTGGGGGCTGATGACCTAGGTTCATAATGGAAGAGCCAGTCTTTCCCTCTGCTTCT
GTATCCTACAGGAATCTAGGAAAGTCTGGTCTTCGAGTGTCCTGTCTTGGCCTGGGTGAG
TCAGAACAGGAATTAAGGGAAGGGGGCATTCTTTCATGGCCCACTTCACACAGTTCTCAT
GTATTTGGCTTCTCTCCTGCAGGTACCTGGGTCACAATTGGTTCTCAGATCTCAGATGAG
GTATAAGTGATGGAACCTAGAAGCAGGGTGGGGGTGGTGGTAAGGAAATCAGAAAAAGGG
ACCTGGGAAGGGGTTTGAACAGCAAGCATGGGGAAGGAGGGATGTGAGGCTGGAGACTGC
AGAAAAGGGAAAGAATATAGAAATAAGGGATGAGGTGCCATGGGTTGGAGTACAGCAAGG
GAGGTTACTGAGGGGCAATGGGTGATCTTCAACTCTTTCTCTCACCTTCCTAGACAGCAG
AAGATGTGCTGACAATTGCCTATGAGCATGGTATAAATCTGTTTGACACCGCTGAAGTGT
ATGCAGCAGGAAAGTAAGGACTGGGGAGAAAGAACTAAGTTACACTTGGAAGGATGAGGG
AACATCAGGGTTTCTTATTTCCCACTAAAGAACTCTAGGATTTCTGGGAAAACTAAGGTC
CAGCCTTTCAGGACATGGGCCCCCAAAGCATTATAGGAGTTATAGTCCTAGCATCCATCC
CTCTCTAGCTTACAGGCCAGTAGGCATACTGTGTAAGTCACATTAAATAAAACTAACAAA
ATTTTTATCTTGAAGGAAAAAAAAAAACCCTAACAGCTAGGTGCAGTGGCACAACCCTGT
AATCCCAGCAATTCAGGAGGCTGAGGCAAAAGGATCCCAAGTTTGAGGCCAGCCTCAGCA
ACTTAGCAAGACCCTGTCTCAAAATAAAAAAAATGAATGAGAATGTAGCTCATCCCTGGG
TTTTACCAGTAACAAACAAAGAAATAAACAAAACCCCAACAAACATATCTTGAGTATCAT
TATGTACAACTACATATGAACTACAAAGTTGTATTTTCATCAGGCCAAATAATATACCTG
TGGCTTCTCACTAGGAATAGCCAAAACCTAGAATGCCTATTCTGCCTCTTCTCCATCTTG
CAGACCCTTTTGCTCATCTTTAAGACTTAGCCTAAATATCAGTTTCTCTAAGAAGCTTTT
ATCCAACTCCCTAAAATTGGTCACCATCCCCTATAAGCTTACTGCCTTCTGACACAATTA
ATTACTGGTTTAACTATCTATATTTTCTGCTTATATCAGAGGCTTTTCCCTCCATGGAAC
TTGTCTTGCTTTTCCCCAACTCCCTTCACAGAGCCTAGCACAGAGCAGGCATTATTCTGC
TATAAAATCAACATGCTCTCAAAAAGTGCACAGTGTAATCCCAGCAGTTTGAAGGCCATG
GCAGGAGGATCGAAAGTTCAAAGCTAGCCTCAGCAACTTAGTGAGGCCCTAAGCAACTCA
GTGAGACCCTGTCTCTAAATAAAATACACACATAAAAAAGGGGCTGGAGATATTGCTCAG
TGGTTATGGGCCCTTGGATTCAATTCCCATTAAAAAAAAAAAAAAAGTACACAGTGGGCC
AGATATATAGCTCAGTGGTAAAGTATTTGCTAGCACACATGAAGCTCTGGGTTCCATCCC
CAAGGCCAGCCTCAGCAACTTAGCAAGACCCTGTCTCAAAATTTAAAAAATGAATGAGAA
TGTAACTCAGTGGTAAAGTGTCCCTGGGTTTTACCAGTAACAAACAACATTGACATAATG
TGTATGGTCTAAGTGGTTACAACAAAAAATACAGGAAATCAAACAATAGTAAAACATTTC
AGTAAGAGTTCACTCTATTGCACTGTTCGTAACACGTCGGCCTGGTTGTAGCTGGCAGAT
TCCATTTCAGTGCCACAGCATCTCCAGCAATACATAACTGACCAGTGGCTTTCAGTTTCA
GGTCTTGGAGTCAGTGTTTTATGAGGTGCTGTGGGTTAAAAAAAAAAAAAAAGAAAAAAA
AGAAAAGAAAAAAAAAGAGTTCACCATAACAATTTAAGATTTGGGCTAGGGTTGTGGCTC
AGTGGTAGAGCGCTCGCCTCGCATGTGCAAGGCCCTGTGTTTGATCCTCAGCACCACATA
AAAATAAATAAATAAAACAAAGGTATTATGTACAACTACAACTAAAACATTTTTTTTAAA
GAAAAGCAACTTAAGAATTGACACAAATTAGCTCATAATTATGTGCTAAAGAATTGTGTA
ACCAATTCAAATGAAGCTAACAAGAAGGACTGATCCATAGACTGTGGCCATCAGAGCACC
TTCTATGAATGAGGCAGAATCTGAACTGAGCTTAGAATGAATGAGGCAGAATCTGAACTG
AGCTTAATGGTGGGAAGTTCTGAGAAGGGGGAAGGCAACCCAGATGGTTGAAACCAGACA
AGGCAGTGTTCTCCCTAATTCTACCAGTCTGTTCCATTTTTTCTCATCCTATTCTTTCCC
TTTAGCACCACAATAGGGCTGATACATAGTGATACACAAGAGGTATCTCGTCTCGCACTG
ATAAATGAATATTGTATGACTATACCCCTAGCTCAGAAGCCACTCTTATTTAGTCCAAAA
GAAATTGAGAATCTAAATGAGCTTCTGTTTTTTGCTTTACAAAAGAGCAAAAGGTGGGGA
GGAGGGGAAAGAAATTGATCACCTTGGAGAGATCAGTGTCTTTGCATTGTTTTTCTTCCA
GAGCTGAAAGAACCCTAGGTAACATCCTCAAGCACAAAGGATGGAGGTGAGACCATGTTT
TGGAGGGTTTCTGGGGACATGATCATCCAAACATCCTTTACTTTTTGCTTCTCCCATTTC
TCTTTTGCCAGGAGATCAAGCTATGTCATCACCACCAAGATTTTTTGGGGAGGACAGTAA
GTGACTATTCCACCGTGACTGGGGAGAAGTGTATGGGGCGGGTGAGGACTGCTGTCCCAT
ACTTGCTATTGTAGGTTCCAGTCCTGCCTGTGAGGACTCATGCAATCCTCATGACTCCAG
GCCAACCCTGGTCCCCTATCTTTGTCACACCTCTTCTTTGACTTACCTTTTTCCTATAGG
GCAGAAACTGAACGAGGCTTAAGTCGCAAACACATCATTGAAGGTGAGAGTTAGAGACTG
GGGAAACTCAAGTGGATGGGCATAGAAATCAGAGGAGTTGGGAACATTTTCGAAAGCTTT
GAATTGGAGGCTTTAGGTGGCCATGGCAATGGGGTAGTCAGAATTCATAGGAATCAGAAA
CTGAGGAACTTACCGTTTTCTCCTCACCCCCTCCTAAGGCTTGCGAGGATCCCTGGAACG
CCTCCAGCTGGAATATGTGGATATCGTCTTCGCCAATCGCTCAGACCCTAACAGTCCTAT
GGAGGGTAAAAGTACCATTCCCAAACCTGATAGCCCTTCAAAACTGGGCACTTCCTTAAA
CCCTCAAGAAGTTAGCCCCAGCTCAGAAGGCCTCCCACACTCCACAGCAGAAGCTTAGAC
TCCAGGACTTGGACAAGGGAGGGAGGTGGAAAATAGATATACCTTTTTGGCTGCATGGAG
ATACCTGGGGGGATCTTGGTAGGGCAGGCAGAGGTCTGCAGATCTGGTAGATTCTAGGGG
TCTAGCAGTGAAGCTCTTCCTTTCCTGTGTGCCTAGAGATTGTGCGAGCTATGACCTACG
TCATCAACCAAGGGCTGGCCCTATATTGGGGGACATCCCGATGGGGGGCTGCAGAAATCA
TGGTGAGTCTGTGACCCCACTTCCCCCATCCCAAAACTGGTTCCCACTTTTCATATGGCT
ACTCCAGACTCCACTGCACTGGAGGAGGAAGTGAGGAAGAAAATGGAAAGGGTATTCTGA
CTCCCATGTCCTCTCTACCTCACCCAGGAAGCCTACTCCATGGCCAGACAGTTTAATCTG
ATTCCTCCGGTGTGTGAACAAGTGGAGCACCACCTATTTCAGAGGGAGAAAGTGGAGATG
CAGCTGCCTGAGCTCTATCACAAGATTGGTGTGCAGCCCCATATCCCTGCCTTTCACTCA
GCCTCACTTGTGGCCTAGGTACCTTTCTCACACCCAATCCTCTTGCTCTTAGGTGTTGGT
TCAGTCACTTGGTCTCCTCTGGCCTGTGGTCTCATTACTAGCAAATATGATGGGCGACTC
CCTGATACCTGCAGGGCCAGCATCAAGGTGAGATCTGAGATGGTGGAACTGGGGCCATCT
GGCATGCTATGGGTGGTGGTAAAGTCTTTTACTGATACTCCTCGTCTTCCAGGGCTACCA
GTGGCTCAAGGATAAAGTACAGAGTGAGGATGGCAAGAAACAACAAGCCAAAGCCATGGA
CCTTCTGCCCATTGCTCACCAGCTGGGCTGCACTGTGGCCCAGCTTGCTATTGGTGAGAC
ACTGCCAGTCCTGGACCCCTGTCTTCTCTTGAAACCTCAAACCCCTGTCTTCTCTTCAAA
CCTACCCTAAGACTGGTTTGTCCCTAGGAATTACCCTCTTCTTCAGAAATACCACTGAAA
CCAGTGTGCTCACTCATCCCCATCAGTTCTTTTGTTTTTGTTTTTTCCTCCTCTGGCTCC
AGCCTGGTGTCTCCGCAGTGAGGGTGTCAGCTCGGTTTTGCTGGGGGTGTCCAGTGAAGA
GCAGCTGATGGAACACCTGGGCTCACTACAGGTGAGTTTGGAGACTAAGTGGCAAGGTTC
ATCTCTGTCCCCTTCCCCAGGAGTCAAAGCTACACTGTCCAACCCAGAATAGCCCGATGA
AGTTAGCCACTACAAAGTCCTCACTTTGCAGGTGAGAGGTCCAAGATGACAAAGTGCGGC
AGGGTCACAGCTGTGACTTGCTTTTTGCTAATGGTCCCTACTGTGGTGCTTCCTCGGGTC
TCTGAACCTCTTGACTTTCCTCAATACCCGGGATGTACGGCCTTGTCCACCACCCCATTC
TCCTCCAGGTGCTGAGCCAGCTTACACCGCAGATGGTGATGGAGATAGACGGGCTCCTGG
GGAACAAATCACATTCCAAGAAATAGTCCCTGGGGAGTGCAGAGACTCAACCTGATGCCG
CTGCAACCGCCCAAGAATCGCATCTCCGCAGCCGCCCCTTTACTCCACCCCCGATATCCC
TCCACCCAGCGGCAAGAACCAGGGTAGCCCCGCCCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGC
TAATGAAAGACTTAGCTCTAGGTACCCCAGGCATGGGTCTTAGTCCTTCCTTTTTTAGCG
CCTAGTGATCTGGCTTCCTAGTTTTGTTGCTCCTCTGGTTGGCCCATTCATCCAGAATGA
AAGTCAGTTGCCTGACCCTCTTGCCCTTTTTGTGTTTTTAAAGTTTTATTAGTTATACTT
TTTACTTGACTTGTACTTCTTTCTCACCCCGTACCCACACATCTAAAGAACTATAAGAAT
AGTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1147, 1149..1196, 1199..1242, 2471..2514, 2602..2639, 2873..2952, 5161..5205, 5291..5335, 5519..5562, 5738..5824, 6096..6181, 6327..6447, 6532..6626, 6712..6832, 7022..7110, 7388..7465
1001..1147, 1149..1196, 1199..1242, 2471..2514, 2602..2639, 2873..2952, 5161..5205, 5291..5335, 5519..5562, 5738..5824, 6096..6181, 6327..6447, 6532..6626, 6712..6832, 7022..7110, 7388..7462
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved