Spermophilus_tridecemlineatus Locus RPL7A
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus RPL7A
Spermophilus_tridecemlineatus
RPL7A
GeneScaffold_3235
SNORD24, SNORD36, SNORD36, SNORD36
1246..1320, 1892..1964, 2238..2312, 2770..2836
4185
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCGCAGGCGGGCTCCGCCGGGCGCG
GCGCTCCTCGGGTGCACCTCTCTTCGCCCCAGCACCCGAGGCACCCACTGCCTGCGCCGG
ACCACGCGGACCACGCCGTTTGGGACTGGCATATGCGCCCCGCCGGCGCGGCCGCTCCTT
CTCGGGCCCCCACCCGGGTCCCTCTGACCCTGTGCCCTCTTCCGCTCGCCGCGCTCACCA
CGGGCGACCGCCGGCGAAGGCCTGCGTGGCCTGGCCCGCAGCTCTTGTCACGCCGCCCAG
CTCGATCACACACCGCAGACTCGGGCCTGGGCCGCGGGCCGCGAAGGAGCGGAGCCTCTG
TGCAGTCGCGAAGGAAAGTCGGCCCGGCAACACAGGAGCCCACGCCTACAAGAGCAACTC
CCAGCCAGCTCTCAGCGGACGCCCGACCTGGGGCCGAGAGCGTCAGCCGCGCACGCGCCG
CGCTAGCCCTCCTCCCCCCCCCCGCCCCAGAAGAAGGCTAAAGGATCTCTGTCGCTTTAA
GTTCGAAATCCCGGGAGGCGCGGCTATCGCGATATCTGAGGCGCTTACTTATTACCCACA
ATCTACTCTACCTCTCCTCTGCGACAAGATGTGAGTCGTGTGCACGTCTAGCCCCGGATC
TGGGTCCGGGTTTCATCCGCCGTCATCCGCTTCGTGACACGGCTGCGCGGGTCCGCGGCT
CCGCTCGGCGCTAGTGGAGCCCTACTGGAGCCCTATTGTGCTTCGCACAGAGGAGTTGGG
CCAGCGGGGAGCATAGCGCCGCAGTGCGGGGACTTGGGCGGGCCGAGGCTTAGGCGGCTA
CGGTTGCTGCCTCGGACTCCGCCTCCGAGCCACGCCGCGGAGCAGCCCGACCGTGCGGGT
GTCCTGGGCCGAAGCGCACGTGGGGGGACGGGGGCGCGAGCAGTGCCGTGCGGGCCCGGG
GCGCGAGAGCGCGCCGACTAACTGGCTCTTCCCCTGCGCAGCCGAAGGGAAAGAAGGCCA
AGGGAAGAAGGTGGCCCCGGCCCCCGCCGTGTTCAAGAGCAGGAGGCTAAGAGGTAGTGA
ACCCGCTCTTCGAGAAGAGCGAAGAACTTCGGCATCGGTGAGCGCAGGCGGTCCCGGGGG
GTGGGGCCCCCGCCGCCCCCAGGAGCGGGCTGGTCCGCCGAGTGGTGCTGGGGGAGCTCC
CGCTGTAGAGGGAAGGGGCGCTGTCTCCGGTCCCGAGGCGTGTGCGTGCAGATGATGTGA
AAGAATATTTGCTATCTGAAAAGATGGTGATGACATTTAGACCACCAAGATCGCTGATGC
ACAGCACCCAGACCGGAGGCGGAAACCTGATACCAGTCAGCCTTACTGACAGTGTTGCCC
TTTACTTCCCAGGACAGGACATCCAGCCCAAAAGGGACCTTACCCGCTTTGTAAAATGGC
CCCGCTACATCCGGCTGCAGCGGCAAAGGGCTATTCTCTATAAGCGGCTGAAAGTGCCTC
CTGCGATTAACCAGTTCACCCAGGCCTTGGACCGCCAAACAGGTGGGGCTCTGGGATGTA
CCAGCGTCCCTCCGAACAAGGAGCTGGCCTAACTGAAAAGATGTGACATGTGGCTCTAGA
GTTTTTTTCTACTCAGTTCTTACGTAGTACTATTATTAAGGCATTTATGTTGTGTTACCT
GAGCCTAACTGAAGAATGTTTTCCCAGCCACCCAGCTGCTTAAGCTTGCCCACAAGTACA
GACCTGAGACCAAGCAGGAAAAGAAGCAGAGGCTGTTGGCCCGGGCTGAGAAGAAGGCTG
CTGGCAAAGGGGATGTTCCCACAAAGAGACCACCTGTCCTTCGAGCAGGTGAATGGGCCT
TTCTGTAGAGGGGGCAAAAAGTGGGGTAGGCTGTGCTATGATGCATCAGTTTCACCCGAA
ATCACTGTGAGGGTTGAAATCCGAGCTTTTTAACACTGAGTCACAGCTCATTACAATTGT
TTTCTGTCACCAGAGCCATGTCTGAATGCTCACAGAGTGTTTGTGTTTTGCAGGGGTCAA
TACTGTCACCACCTTGGTGGAGAACAAGAAGGCTCAGCTGGTAGTGATCGCACATGATGT
GGATCCCATCGAGGTGGGTTGGGCATATTTTTAAACAGATTACTGAAACCAGGGTGGAAC
AGGCTTAATGATGAGTCTGGCATAATAAGACCAAAGTGGGTGACAGCACTGACAAGTGAT
CCAGTTCATGCCTGGCTCTTGCAATGATGCAAGCCTTTTGCTGAATTAGACCTTGAAGTG
CATATATACTTGAGCTTTTTAACTCTGAGCAATGACCAACCTAGATCTCTTAAGGGACTG
TTTTGGTCAAAACACACTTTCCAGCCAGTGCTTTCTTCCAGCTGGTTGTCTTCCTGCCTG
CTCTGTGTCGCAAGATGGGAGTCCCTTACTGCATCATCAAGGGGAAGGCTAGGCTGGGAC
GTCTGGTTCACAGGAAGACATGCACCACTGTTGCCTTCACACAGGTTAACTCGTAAGTGT
GTAGCCCCAACCCCCAGTCCATTTGCTCCCTTAAGACATTTTAAGACCATTTTAGATTTT
GGAGGATCATGAGTTCAAAGTCTGTCTGAGCAATGGTGAGGTGCTAAGTGACTCAAGTGA
GACCCTAAGTAAAATACAAAATAGGGCTTAGGGTGTGGCTCAGTGATAGTGTCCTTAAGT
TCAATCCCCATAACCCTCTTCCATTAAAAAGACCAATGTTCTAGCTTAATGAACCTACAT
ATTTCACCTTTTGCCTATGATGGTTAAGAATTTCTTCACCTGAATGAATCATGTGGTCAT
GTTATATCTGAGGCAAAAAGGCTTATTTGGAACTAAAAATGGAATTTGCTAAAGAGTAAC
TAAAACTGAAAGCCCACCTTTTCTCCCCCACCCAGGGAAGACAAAGGAGCTCTGGCTAAG
TTGGTGGAAGCTATCAGAACCAACTACAATGACAGATATGATGAGGTAAGAAACTACCTA
AGTACTCTTCTTGGGTGAATCGAGCTTTCAAGGGAGTGGCTGACTCAAGCAAATCAAAAC
TCCGAAGTGTTAATCCTTGGGAGATGCAGGGCCAAGCTGACTGCTTCTTTTTTCATTTCA
GATCCGTCGCACTGGGGGAGGCAACGTTCTGGGTCCAAAATCTGTGGCTCGCCTGGCAAG
CTGGGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAAAAGGCTG
TATATAGCAGTAAAATGCTCAGAAACCCAGCCAGGGTTTTGTGATTGACCAGTCACTGTC
TTATTTAAGGTAGCAATGAATGTGAGTCTATAAAGCATTTATTTATACTGATAATACATG
ATCCAGTAAAATCAAGTCTCTTGAGATGCCATCTATGCAGGGACCTTCTGATTATTTAGG
GATCATTCTGTATTGACTTCTTCACATGCCAGGTGTCCGACGCAGGAATTTTTTAAACCA
CAGGTATGATGTAGCTGCACACAGTCCATACCTTAGGTTGAAAAAAAATCGTTAGGCTGT
GAAGTGCACTAAAAAGAGGGGACCAGGGGCAGTGCAACTGACCAGGTAATGATGTACTGC
ATGTGTTCATTCCACAGAGTGACTCTGGTTTGCCCTCCGATGGGTCCTCCAGGGACTGTG
CTCTCTGCAAAGACAGTGGGCCCCTGTCCTCACCTCTGCTGCTTCCCAACAGCTAGCTGC
CTTGGCACAGCCATCCTCAGGTTGTTACTTGACCCATAACCCATCACCCTTCAAGTGTTT
CTTGGTGTCTTGCCCCACCCCTGAACACATACACACCCTAGAATACAGCAAAACCGGGCC
AAGAAAAGGCAGGGATACTTATTCTGGGGGAGGGCTGGTCTCAACATACGGAAGTCAGCA
TCAATAAAAACAGGGTCTGCGCCTGTGACCCTAGCCATGGCCTCCAGGTCCCGGTAATGC
CAATGGTTCCTTTCTGGATTATTCTCAGGAACAAAGGGCTTCCTGGTTTCTGTAAGCCTC
ACCATCCCGACTAGGTCCACTTCTCCTTCAACCTAAAAAGGAAGATGAGGTTCCTCTTTA
CAGGGGCTTGCAACAGGGAAATGACCAAAGACTCATATCCATCCCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1024, 1027..1056, 1059..1070, 1073..1096, 1101..1116, 1392..1541, 1707..1847, 2033..2112, 2381..2511, 2915..2984, 3121..3171, 3174..3185
1001..1024, 1027..1056, 1059..1070, 1073..1096, 1101..1116, 1392..1541, 1707..1847, 2033..2112, 2381..2511, 2915..2984, 3121..3171, 3174..3185
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved