Spermophilus_tridecemlineatus Locus BAT2
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus BAT2
Spermophilus_tridecemlineatus
BAT2
GeneScaffold_5883
SNORA38
1288..1417
12884
GGTTACTGGCCCATGTTACAGGGTGTTCTCAAAGTAGCTTCTTAGTGCTTTGGATTTTT
CTCAGTTCTTTCACAGTGCTTTGGTTTACTCAGGTCTACACAGAGTAAGCCAGAGCCCAC
TAGTACTTTTTTGTGAAGGTAGACTTGTTCCCAGGAGCCAAGATGGGCTCAAGTTTAGGA
AAAGGTAGAGTGTTTCAAATAATTGGAGTTCTATAACATGAGAGATGTAGAGTCCAGGTT
GTTCATGAGAATCCTCTGGCACCAGCTCCCATTCTGGTGGAGCAAGCTCATAAAATCCTT
AAACTCCCAGCATACCTTCCTACAAACGTTCCCAGATGGGACTTGAGATTGCTGGGAGTA
GAACCTGGGGCACAGGGCCCTGGGGCATGATTTGGGAGCTGGTGTCTAATCAATTGGTGA
TCTAAAGTTTTCTTTCTTTCATGGTGGAGTTGTACGCCTCTTTCTGGTTTTCTTTGCCAC
TTGGACTTGCTTGCCTCATTTGATTGTAGGTCTCTGAAATGATTTTGGTGGAGAAAAGGA
ATTATTACTTTTGGGAGTAATAAAGAGGCTGCTGCCCTTTCTAGATTGGCACAAAGGGCA
GAGCATTAATACTGGGAAGATAACTAGATTTTTATTTGATTTTTTTTTTTTTTTTCCCCT
TGGCAGAAGGTATCAGGAGAAAGAAAACATGGCATTAGCACTATGTGGGAAATACGTATA
TTGTGGTTGCTTAAAAAGAATGTGGAGTTTACATAGACTGGAGGAAAAGTCACTAAAGGG
CCACATACCTGGGTCCCTAGTGAGAATGAAAGAGAGCATCTACATTTCTGTTACAGTCTA
TGAAAACGGGTCCCTAGTGAGAATGAAAGAGAGCATCTACATTTCTGTTACAGTCTATGA
AAAGGGTAGAGTCTGAGACACTGGTATCTGGCCCACAGGCTCCGGCACGTTTTGGGGGAG
GTGCCTGAAGAACCCAACGTACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTTGATACTTATA
AGGGCAAGTCCTTAGAGATCCAGAAACCCACTGGTGAGGGTCCTACAAAGATGCTACTAA
TGGCTAGGCATGATTGGGGTATACATTTTAGAGCTCTTTGAAGGGGAATAGGTATAGTAG
AGTAAAAGACCAGAGGAACACACTGGAAATCTCCCAGTTTTACCTTGAGTCCTGTAGAGA
GTGTTGAGTTCTGGGTTAACACCAGTTACCCTCCTACAAAGGCGTGTCTTTGGTTCCCTG
TCTTTGGACACGTAAGAACTGGAGGAAAAGAATTGTGGATTTGGGGAAGTCTGGGGCCAG
CTTGCTCCTCGCGGGCTCAGATCAGTCATCCCACATAGAGACAATAAATGTAATATATCT
CAATGTTTTCAAGAGGCATTTTGGAGATTTTTATCAAGGGAAGGGATAGCTTCTAAGAGA
AACTTGGAGTACGTAGGAAACAGGCCGTTCAGGAAGTCTGAATAGAATCAGGTTGGGATG
CTGTCAGATCTCCCATGTGAGATGTTTTTCACCCTCTCTCCACCTTTTCTTCAGTTGCCC
CTCGCCATGGCCTGCAGAGTCTCGGGAAAGTTGCCATTGCCCGGCGTATGCCACCCCCAG
CCAACCTTCCAAGCCTGAAAGCCGAGAACAAAGGCAATGACCCCAATGTCTCACTAGTGC
CGAAAGACGGAACAGGATGGGCAAGCAAACAGGAGCAGTCCGACCCCAAGAGGTAGACAG
AGGTTTGGGGGACCAAAGAGTGATGAGTACCTTAACTTTGAACTTAAAAGTGGATTGGGG
TTTGGTTTGGTATAGTCCAGTCCCATGATAACCAGGAAAAAAAAAAATGAAGGAGTCACC
TTTTGAACCTATTCTGGGTTTCTGATTAGATACTAAGAAATGACACCGCCCATGGTGGTG
CAGGTCTGTAATCCCAGTGATGAGTTCAGAGCCAGCAGGACCAACTTAGTAAGACCCTGT
CTCTAAATAGAATATAAAAAGGGGCTGGAGATGTGGTTAAGTGCTCTTGAGTTCAATCCC
TTGTACCAAAAAACATAAAAAATGGTACTGTAAGCTCTTTGTTAGAGAAAAGAAACAGCT
AACAGCCTATACAGGGTGGCAAAATTAATGGTAGTTTGTCCTAATATTTCTAAGTAATAG
TATTGGACCTAGGGTCTATCCTTACTTTCTACTAATGGGAGAAGTTGGAGAGGCATCTTG
GGTTTTGGGTAACCTTTTTCTATTATCCCTTCAGTTCCGATGCCTCAACCGCTCAGCCGC
CGGAATCGCAGCCACTGCCGGCTTCACAGACGCCTGCCTCCAACCAGCCGAAACGACCCC
CAACAGTCCCCGAGGTATCTGGAGAACTAGAGGTGTTGGGAGGGAAATGGTTTCTATCTC
CCCCAACCCATGTGATCATTTATCTTTTTTCTTAGAACACTCCTTCGGTTCCAAGCGGGG
TAAAGTCCTGGGCACAAGCCAGCGTCACCCATGGAGCACATGGAGATGGTGAGTACAGAA
CTGTCAGGGAACTGTGTCTGAGCATCACAGGAGGCAGGCGCCCTTGACTGTGCCTTAAGT
GTCCTTGGTGTCCTCGCTGAGTCTCAGTCCCTTGTATTCAGTTTCATGGGGCACATGAGG
AAGTTTTAAATCTATCTTCTATGTGGGGGTAGTAAGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NATTCACCTTCCTCCCCATCATTTTCACTTTCCTTGGAACATAAACATGTGCTTTTCTCC
ACCTTTGTCCAAAATGTAGATTCTACAACTTGGAGGGACGGAGGTGGGCGTGGCCCTGAT
GAGCTGGAGGGCCCGGACTCCAAACTTCATCATGGTCATGATCCCCGGGGCGGGCTGCAG
CCTTCAGGCCCACCCCAGTTCCCTCCCTATCGCGGAATGATGCCGCCCTTTGTGAGTCTG
GATTTTTTATTTTGGTTGCACTGAAAGCTAGTGTGTTAGGAATAAGGACTTGACCTTTGG
AGGATGCAGTTACAAAGCAGGCAGCCAAACAGAGGGTGGGTGGACAATAGCAGGTTTAAA
GGACTGGCAGTCTATTTGTGCCTCTTGTCAGCTACTGTTGTGTTGGGTCCTTTTGCAGAT
GTATCCCCCATACCTTCCGTTCCCTCCACCCTATGGACCCCAGGGGCCTTATCGATACCC
TACTCCTGATGGGCCCAGGTAAGGAATCCGAGTCTGAGTTTGTGGTTGGGGGAAGGGGAA
ACCTCTGGGAAGAAGATAGTCTTGTGTGTGGTTTTATAACACATCATCTTTTATCTTGTC
CCATTTTTCTTTCAACACACAGCCGTTTCCCCCGTGTGGCGGGCCCCCGGGGCTCAGGGC
CACCAATGCGCCTTGTAGAGCCTGTGGGTCGGCCTTCTATTCTTAAAGAGGATAATCTCA
AAGAATTTGACCAGTTGGACCAGGAAAATGATGATGGTTGGGCAGGTGAGTGAATATGAA
CAGTTAACTATTGGATCCTAAAAGGGATATCATGGGAGAACAGACATTGAACAGTAGAGA
AAATATATGGAGAAAAACCATGTCTTGGCAAAGTACAGAGAGCAGTGACAGTGACAAGAC
TTATAGTTGATGAACATAAACCTCAGAGGGAGGGGCCAGTATTGGTAATGTGTTTTTTCT
CATCATGTATTTCAGACCACTTCTTGTGTCCTAGGAACACATCTGATTACTACTTGGATT
ACTACTCTTTATTTTTCTCTTCAGGGGCCCATGAGGAGGTCGACTACACTGAAAAGCTCA
AGTTCAGTGATGAGGAAGATGGGCGAGACTCTGATGAGGAAGGAGCTGAGGGCCAGTAAG
TTAGGACTATCAGGGGAAAGGAGGGAGCTCTTTTATTTTTTTTTTCTTTTTGTACACCTC
ATGGTAATATACTCTCAGAGGAGTTGATTTGCAGCTGAATTTAATTTCATGTTTTGCTCA
CAGCAAGGATTCCCAATCAGCTGCTGGTGAGGAACGGCCTCCTGAAGCAGATGGCAAAAA
GGGCACCTCCTCTGGCAGCGAACCGCCCCCTCTCAAGACCGCCTGGGCAGAGACCTCTCG
GCCTCCAGAGACAGAGCCAGGGCCTCCTGCCCCAAAGCCTCCCCCACCCCCACCTCACCG
GGGCCCCACCGGGAACTGGGGCCCCCCTGGGGACTACCCAGTGAGTGTCTACAATGAGGG
TTGAGAAGGGTTAAATTGTGGGAGGTATCAGCTGAGTAATTGAAGCAGTAATAATGGAGG
AAACGGAAGGAAGTCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCC
TAATGACTGACACCCCTGGCCTGCTGGGTCTGCCCATTGACAGGATCGTGGGGGTCCTCC
CTGCAAACCCCCAGCACCTGAAGATGAGGATGAGGCATGGCGGCAGCGGCGAAAGCAGTC
TTCATCTGAAATCTCCCTGGCAGTGGAGCGGGCCCGCCGTAGGCGAGAAGAGGAGGAGCG
GCGCATGCAGGAAGAGCGCCGGGCAGCCTGTGCTGAGAAGCTCAAGCGACTGGATGAAAA
GTTTGGGGCACCTGACAAACGGCTCAAAGCAGAGCCTGCTGCCCCACCTGCTGCCCCACC
TGCCCCAGCTCCTCCACCTGCAGGACCCAAAGAACTCCCTGCAAGTCCAGCTCCACCACC
GGCACCAGCCGCAACACCAGAGAAAGAACCTGAAGAGCCAGCACAGGCCCCTCCTGCTCA
GTCCACCCCCAGTCCAGGTGTGGTTCCAGTTCCCACTCTAGTGAGTGGTGGTGGCACTAC
CAGTAGCACCAGCAGTGGCAGCTTTGAAGCCAGCCCAGGTATGGAAAAGAGGATAGGTAC
TGCTAAGATCTTAAGGGTGCAGGGTAGTAGGGATGGAAGTGAAGTAGAAGTTATTTGTTT
TGGTTTGTTTGTGTATGAGTGGTGGGGGGAAGTCCCATCATTTGCTCATCTATGAAAGGG
AAAGCTCTAAAACTGCTTCTATAAGCCTAGAGTGGAGCAAGATTGAAGAAAATTGTTTGG
GTGATTTCATAGGCCATTAATAGCAGCAGTAGTGGCTCTTGAGGCCATAGTTTGTTTTTA
TGGGTTTTACATGGGATGGGCTTCAATACAGTGGGATTCGGTTGAATACCTCAGTCTCTG
GAGAGAGCGAGCTAGAGTTGGCTGGAATTTCTGATCTTTTCTTGGACGGTCCTGTTGCAC
TAGGTTACTCTGTTCTTTTCTCCAATGCAGTGGAACCACAACTGCCTTCAAAAGAGGGTC
CTGAACCACCAGAAGAGATTCCTCCACCTACCACACCCCCAGCCCCAAAGGTGGAACCCA
AAGGTGATGGGGTGGGTCCTACCCGACAGCCCCCCAGCCAGGGCTTGGGCTACCCCAAGT
ATCAGAAGTCATTGCCTCCTCGTTTCCAGCGGCAACAGCAGGTGAGATCAAGTTGGTTTT
GCTAATTTTATCCATAAGTTGTCTTCTGGGTTCTTTGCCTTTGTTTGGGTCTCCTTCCTG
TGTGACAGTTTCCGTCTACTCCAGGTTTTTGTCAAACTTGTGCAGTAACTTTTTTCTCTG
CTGCTCCCTTCGTGTGCAGGCTTTATAACTTCTTCCATCCCATCTTTTTTGTTCTTCCTC
AGGAGCAGCTCCTGAAGCAACAACAGCAGCAGCAATGGCAGCAGCATCAACAGGGGTCTG
CCCCTCCTGCCCCAGTGCCCCCATCACCACCACAGCCTGTGACCCTGGGGGCTGTGCCAG
CTCCACAGGCTCCACCACCGCCCCCCAAGGCCCTGTACCCAGGTGCTCTGGGCCGGCCCC
CACCCATGCCCCCAATGAACTTTGATCCTCGCTGGATGATGATTCCTCCTTATGTGGACC
CTCGGCTCCTTCAGGGCCGGCCCCCACTGGACTTCTACCCTCCTGGTGTGCATCCTTCTG
GTAAGAGGCCTTTGGAGGGGTGGTAAAACCCATCAGTCCTAGGAAGCGTGGATATCAATG
TCTTAATTTGTTGTGACTGGAATTACAAGTAGGGGTGAGGGGAATGCTTAACGGCAGAGA
TAGTTCTGTGTGAGAGTGGACTTGGGGAAGAAACAAATGTTGGGCCTTATTTGGCAAGGC
TTTATTAGGGGGTTTGGTTCTTTCATATGACAACTGAGTGATTGTTCCTATTTCACAAGA
ATAGGCAAGGTACAGATTTACTGGTATGAAAGATGAAAGGTGCTGACTTAACAGAGAAGA
CTAGATCAGGGAGGTGGTTTTGAAGCGCTGGAAGTCCAGATGACACGAAATGATTTTGTT
CTTTTTTTTGTTTCCTCAGGCTTAGTTCCCCGAGAGCGCTCAGATAGTGGGGGTTCTAGC
TCAGAGCCGTTTGAGCGTCATGCAGCCCCCCTCTTACGGGAACGGGGCACCCCACCAGTG
GATCCAAAGTTGGCCTGGGTAGGAGATGTCTTCACCACCACACCCACTGACCCTCGCCCG
CTTACTTCACCTCTGCGCCAGGCTGCAGATGAGGGAGACAAGGGGGTTGAGGTGAGTCTT
GTTAATGAGGAATAAGTGAGTTCTTAGTTTAAGGGCCTGAGTCTAGGGAAAAGGTACTGT
GGGATTATTGGTGAGATGATGAACATAAAGGGGAATATTTAGCTCATATTAAGGTGTTCT
CTTTCCCCACCCAATTCTTGTTTTCCTCATCCTGAGATTCTTTTTCTGTCTCCCTTTTAG
GAGCGAGACTCCTCCAATACCTCCTCCACCACCTTATCTGGCCAGTTATCCAGGCTTTCC
TGAGAACGGAGCCCCTGGGCCCCCAATTTCTCGTTTCCCTCTGGAGGAGCCAACTCCCCC
AGGGCCCCACCCACTCCCCTGGCCCCCAGGCAATGATGAAGCTGCCAAGATACAAGCTCC
ACCACCCAAGAAGGAACCCCCCAAGGAGGAGACTGCACAGCTGACAGGGCCGGAAGGTCG
AAAGCCTGCCCGTGGAGTTGGAGGGGGAGGCCAAGGCCCCCCACCACCACGCAGAGAGAG
TCGTACCGAGACCCGCTGGGGCCCTCGCCCAGGTAGCAGTCGTCGAGGAATCCCTCCAGA
GGATCCAGGGGCCCCTCCCCGCCGGGCTGGGCCTATAAAGAAACCGCCACCACCTGCAAA
AGTGGAAGAGCTGCCTCCTAAATCCCTGGAACAGGGGGATGACTCCTCCAAACCCCCAAA
GCCAGACCCACTCAAGACAGCTAAGGGGAAAATGGTCCCCAAGGAGACCCCACCCAGTGG
GAATCTTTCCCCTGCACCAAGGCTTCGGAGGGATTATTCATATGAGAGAGTGGGTCCTAC
CTCCTGTCGGGGTCGGGGCCGAGGCGAGTATTTTGCCAGAGGGAGGGGTTTTCGGGGGAC
CTATGGGGGACGGGGACGGGGAGCCCGAAGCCGAGAGTTCCGCAGTTACCGGGAGTTTCG
TGGAGATGATGGGCGTGGAGCTGGGACTGGAGGACCAAACCACCCTGCTCCTCCCCGAGG
CCGCACTGCTAGTGAGACACGAAGTGAGGGTTCAGAGTATGAAGAAATTCCTAAGCGGCG
CCGGCAGCGTGGCTCAGAAACAGGCAGTGAGACCCATGAGAGTGATCTGGCTCCCTCAGA
CAAAGAGGCTCCCCCACCTAAGGAGGGAGTACTCACCCAGGTCCCTCTTGCTCACCCACC
ACCATGAGCCCCCCCTTCACCTGCCCCTGCCCGTTTTCCACTGCCCGGGGTGGACGTGTT
TCACTCCAAGAGGGGTGCCCTCACGGCGTGGCCGAGGGGAGGGCGGCCCCCTCCTCCTGT
TTGCCCAGGCTGGAGCCCTCCATCCAAGTCCTTGGTTCCAAAGAAACCTCCAACAGGTCC
TTTACCTCCAAGTAAGGAGCCTTGAAAGAGAAGCTGATTCCAGGACCTCTGTCTCCCATG
GCCCGGGGAGGCAACAGTGGAGTAGGCAACATGGGTATAGGTGTGGAGGATGGGGAACGA
CCCCGAAGGAGGAGGCATGGAAGGGCTCAGCAGCAGGACAAACCACCTCGGTTCCGGAGG
CTGAAACAGGAACGAGAGAATGCTGCCAGAGGGGCTGAGGGCAAGCCCTCTTCCCTAGCC
CTTCCAGCCTCCACTCCTGGACCTGAGGAAGCCTTGGCAACAGTCACAGTGCCCCCTCCA
CCTCGTCGGGCAGCGGCTAAGTCTCCTGATCTGTCAAACCAGAACTCAGACCAAGCCAAT
GAGGAATGGGAGACTGCATCAGAGAGCAGTGACTTTGCTAGTGAGCGTCGTGGTGACAAG
GAGGCTCCCCCACCAGCAATTCTGACCCCCAAAGCTGTGGGAACTCCTGGGGGTGGTACT
GGTGGGGCTGGACCAGGCATTTCAACCATGTCCCGTGGAGATCTGAGCCAGAGGGCCAAG
GATTTGAGCAAGCGGAGCTTCTCAAGTCAGAGGCCAGGAATGGATCGGCAGAACCGCCGC
CCAGGCCCCGGGGGCAAGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNCAAACATGAAAAATCCTTAGAGGGGCATACCAAAGGACAGGTTTTAATGGGAAAA
GGTTGAAAATTAGAAGTGTATAGAAAAATAGTTTAGTGAACCTTGGGAACTGATGCTCTT
TTCTATTCAGCCGTCCTCCAGAGGAGCGTCCTCCAGGACTCCCCCTGCCTCCCCCACCCC
CTAGCAGTTCGGCTGTCTTCCGCCTGGACCAAAGTTATCCACAGCAACCCTGCTGGCATC
CAACAGGCTCTGGCCCAGCTTAGCAGCCGCCAAGGAAACATAACAGCACCAGGGGGGCAC
CCAAGGCCTAAACCTGGGCCTCCCCAAGCCCTTCAGGGCTCCTCCCCTCGGCCCCCAACC
CGATATGACCCCCAGAGGGCCACCAACAGTGTCAGTTCTGGTAAGCTGGAGAGGGTCCTG
GGTGGGAATGTTTCCATCCCCAGAGAAGGTCAGGTGCTGAAGTGGGAAGAGTGGCCCTGG
GGGCCCTGCTGCTGGGTGTCTTCATTGAGCAAGGGTGGAAGGATTGGGGGGAACAGTAGG
GAGCTAGGGTCAGTGATAGTGAGGCAGATGCTGACAGTTTTCCCCTTTTCCCCAGACCCC
CACTTCGAGGAGCCAGGGCCGATGGTGAGGGGGGTGGGCGGGACTCCCCGGGACTCTGCC
GGGGTTAATCCCTTCCCCCCCAAACGGCGGGAGCGACCTCCCCGAAAACTGGAGCTGCTG
CAGGAGGTGAGGGATGGGGCTGGAGATTGGGCTTTGCTGCACTTTCACTTTGAAGGTTCT
TGGTTATATTTCTCCACTCTTTGCTATTCCCATATTCTTACTCAAAATTCTCACTAGTAG
TTACTGTTTTGTTTCCCGTGTGTCTTCATTGTTGCCCCAATGCCTCACTCTGTCCTGGCT
TCCTATATTCCCCAGTTCCTACCCAATTCGTGTTTTGCTTCTGGCCTTTCTCCACCTTTA
GGAATCTCTGCCAGCTTCTCATACCTCTGGAATCCTGCCCTCGAAGCCTGAGGTCCCAGG
CCCTCAGGGAGAATCCAGAGATGCAGGCACAGAGGCCCTGACCCCCCACATCTGGGATCG
TTTACATACTGGTGAGTGAAGCTGAATGAAGGAAGGAGCTGGTAAAGTGGTGAGAGTGAG
GTGGCTTTGGAACTGTCTTCTCACTGCCTGCATCCTGGTTGGTGCTCTCCTCCAGCCACC
AGCCGAAAGAGTTACCGGCCCGGCTCCATGGAGCCCTGGATGGAGCCCCTGAGTCCATTT
GAGGATGTGGCTGGCACAGAGGTGTGTGAGGATGGGAGGGAGTTGCTGAGTTGGGATCTT
GTCTGAATATTGGCCATATTTCCCCCACCTGAACTGGGTCAAGTCTGGGGCTGTTCTCAC
ATGGTTATCTCCTTAAATTTGTATGTGTGCATCAGTCAGGTATCGGGATGCTCTTTACCT
TGATTTAACTAGCTCCTTCTCCGCTCCTCTCAGATGAGTCAGTCTGACAGTGGGGTGGAC
CTGAGTGGGGATTCTCAGGTGTCATCAGGTCCCTGCAGCCAGCGAAGTTCCCCTGATGGA
GGACTCAAGGGGGCAGCAGAGGGACCCCCCAAGCGGCCTGGAGGCCCCTCACCCCTGAAT
GCTGTTCCTGGTGAGGGTCCACCTGGCTCTGAACCCTCTGAACCTCCTAGGAGACGGCCA
CCTGCCCCCCATGATGGGGACAGAAAGGTAAAAGACCAAAGGAAAAGATAAGAATGTTTC
AAATAATCTTTTACTTTGGCTTTCCCTTTATCCTTCTTTCTGGGTGTTCTGGGAATTCCC
TGATTTGGGTTCCCTTTCCTCCCTACACCTTCATTTTACTATGTTCTGCAACTCAGGAGC
TGCCCAGGGAGCAGCCTCTGCCCCCTGGCCCCATAGGCACAGAACGAACACAGCGTACGG
ACCGAGGCCCAGAGCCTGGCCCCCTCCGGCCATCCCATCGACCTGGCCAAGCAGTCCAGT
TTGGAACTAGTGACAAGGTGTGTGTGAACTAGACTTGGGAATCTTCCTATGCTGGAAGGA
GAGAGGAGGGTCTAGAGATAGGACATGGAAAACATGTCTGAATCACAGGATGCTCTCCTG
CCTTATTATCACAGGACTCGGACCTGCGCCTAGTGGTAGGAGATAGTTTAAAAGCAGAGA
AGGAGCTAACAGCATCAGTTGCCGAGGTAGGTGGAGAATTCAGTAGGAAAACCCAACATT
TCTGGTGAGAATTTCTGAGAGTGACCTGGGTGTCCAGGACATCGGGCATTCTTCTTGACA
AGTTTTCTCCTGCCCAGGCCATTCCAATATCCAGAGACTGGGAGCTACTCCCCAGTGCTT
CTGCCTCAGCTGAGCCACAATCCAAGAGCCTGGGTTCTGGGCACTGTGGCCCAGAGCCTA
GTTCCTCAGGCCAGCGCCTATATCCTGAGGTCTTCTATGGCAGCCCTGGGCCTCCCAGTT
CCCAGGTAAGCCCCAATTTTCATCCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1614..1791, 2314..2413, 2495..2567, 2887..3030, 3259..3410, 3598..3677, 3802..3944, 4224..4314, 4443..4659, 4903..5377, 5790..5980, 6182..6196, 6215..6479, 6859..7066, 7068..7070, 7260..8223, 8227..8255, 8258..8276, 8279..8314, 8317..8421, 8424..9020, 9171..9274, 9550..9631, 9633..9819, 10015..10145, 10381..10510, 10615..10700, 10893..11126, 11276..11416, 11534..11605, 11717..11884
1001..1112, 1614..1791, 2314..2413, 2495..2567, 2887..3030, 3259..3410, 3598..3677, 3802..3944, 4224..4314, 4443..4659, 4903..5377, 5790..5980, 6182..6196, 6215..6479, 6859..7066, 7068..7070, 7260..8223, 8227..8255, 8258..8276, 8279..8314, 8317..8421, 8424..9020, 9171..9274, 9550..9631, 9633..9819, 10015..10145, 10381..10510, 10615..10700, 10893..11126, 11276..11416, 11534..11605, 11717..11884
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved