Spermophilus_tridecemlineatus Locus EEF1B2
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus EEF1B2
Spermophilus_tridecemlineatus
EEF1B2
scaffold_12301
SNORA41
3051..3185
4680
AAATTTGTGGGAAATGTTTAAGCCTTTAGGCCCAAATCACTGTGACCCAGGTGCTTTTC
CGAGGAACAAAACGGCCTACTCCTGATTTTCCTTGCAGTGGAGAGGTCGCTCACAAGCCC
GCATTCAGGCAAGCGTTTCAGAGGGTCTCCCGACCCTCCTCCTCCTTTCTGCTCCACCGG
ACCAGAAACCAAGACTAACATTCTCACCTGCCGCAACTCAGGGGTTCCCAAGGCGGCAGG
GCGGGAGGCGGTGCCCAGTCAAGGGCAAAGGAGAACGAGTCGCCTGGGCCACATAAGGCA
GTCCCGTCAAAAATTAAAACTCTGGCCGAGATCACTCAGCCTTCTCACCTAAACACTACC
TCACCTTCTGCCCGGAGCCGCTGCAGCTGCTCAGCTGGAGTGTCCGGCCCACACTGACCC
CTCGGAGACCCGGCAACTTATCCAATATGGCGGTCTCGGCTAATTCTGTCAGCCGGGCCT
GGTGAACGGAAAGCAAGAGGGACCAGAAACCCTGATTCGATAATTTCACATTTCGGTTAA
ATTCGGCAATTCCCGTCAATCTGACGAAGGGCTCGGAAGAGGCAGGGCAGACGACTTGGG
ACTGCAGTTCCGCCGGAAGTAGGCGGAACCTTGAGACCTAGCGCCTTCGGTCATCTCCGG
CATTTCAAGGGGCGGTTCCTGTAGTTTTTGGAAGCCGCGGAGGTACGAATTTAAGAAATG
CCCCTTCTGTTTATTTTCAAAGACACCGAAATGTGCGCGGACCACTTGTGGGCCATTTAA
TTCAGAACTTCAGAACTCCCCAATTTTTACGTGGAAGAATGTGAATAGTAACGTAATTTG
ACCTTTAACCTTTAGCCGGGTGCAGCGGAGGGAAACGCCTCCATCTCTATATAAGGAAAT
TTCCGGCCGGCTGGGGCCCTTTTCTCTCTTTTAGCGCTAGGCGCCGACCTCTCGCGCTCT
TTTCCTCCGCTGCTATCCAGCTACCGGTAACAGACAAGGCCATGGGTTTCGGAGACCTGA
AAAGCCCGGCCGGCCTCCAGGTGCTCAATGATTACTTGGCGGACAAGAGCTACATCGAGG
GGTGAGCGGACCCGAGGCGGGGCGGCTAGGGAGCTTCTGGTGCCGGGCGTCCGGGGCCAC
GTGGCGCAGCCACCTCAGGAGCAGGGGAGAAGGAGGCTAGACCCTGGGACAGCTCGAGCA
CCGCCTCCAGGGAGGGCGATGTTATAGAGTAAAGGTCAAAATGTGCTTTATTTCCACTTA
CATGATTCAACCAAGTTTGTATTTTACCTCTTTTCCAAGTTAGGAAGTGTTAGCCTGTAG
ATAGAGCACAGACTTTGAGATCTACCGAAGTGGCAGGTATTTCTCCGGATAGCGTGGTTT
AACCAAACAGTTGGTCTCTGATCTTAAGCAGCTTATAATTTAAAAACTTAAGCAACTCAT
CTCGGTAATAAGTGGGCGAGATCCCATTAATTACCTTCACTGATTAGCTATGTAGTTTAT
TTTCTGATGTTTGTGTCGTTTAAAAACGTATGATTGTTTATCTTTGGCAGGTATGTGCCA
TCACAAGCAGATGTGGCAGTATTTGAAGCCGTCTCTGGCCCCCCGCCTGCGGACTTGTGC
CATGCCCTACGTTGGTATAATCACATCAAGTCTTATGAAAAGGAAAAGGCCAGGTAAAAA
TATCTTTGTATCTATCTGAAGAATAAGACTGCTTTATAAGCTTAATCAGGATTTTCACAT
GACAAAAGTGGACCCAGGCTACTTTAGTCCTGTTGATATATTGTAAGCTAAATTTTTTTG
TGACCTTAGAAGGCCAAGAGACTGAAGTCCTGCATTTTTTCACAGAACAGGTAGAACATG
GACAGCAGCAATTCAACTTTTCCCCACACTGCCCTGCCAATGTGCTTCGACCCTGACCTG
GGGGGGCCACCGATGGGGTGAGAGGGTGGCTCAATCATTCAGTCCTTTGCCATTCTTCTG
AAACTACCAACAAGGGTGGAAGTTTGGGGAAGTGGATTCCAGTTAACTAAGAATGGAACT
GAGCATACTTAATGAAATCTCAAACAGAAATGTTGATACTGAAAGAGTAAATCATAGTGA
GTATTGAATATAACATCTCACATGGTACTAATGTTTGTTGGGTGAGGAGTTGGACTTACT
AAAGTGTTTACCTGGGAGTGTGTTAAAGTGTAAATTCTAACCCTGCTCAGGAGCACAAGT
CTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGGTTTGCAGGTGGAGGCCAGCCCCA
GCAACTTTGCAAGACCCTGTCTCGAAATTTAAAAGGACACCCTGCAATTATAGCTCAGAG
ACAGAGCACTTGCTTACTATGCTTAATGGCCTGGGTTCAATTTTCCAGTAGTGCTAAATG
TGTAAAGAGTGAATTCTTAATACAAAAGGGACCTAATTATATACAATTATAAATATAAAA
TCTCACATTGTCCAGGAAAGGACATTATATCAACCTAATAGCAATTGAATTTTTTTTTCA
AGCCTTCCAGGAGTGAAGAAAGCTTTGGGAAAGTATGGCCCTGCCAATGTGGAAGACACC
ACAGGGAGTGGAGCTACAGATAGCAAAGATGATGATGACATTGATCTCTTTGGGATCTGA
TGATGAAGAGGTATGACAACTTTTTATGTAAAATATATAGGGCAGTGTATCTTTGTGTAT
AAGTATGAATGTTATTTGCCCAGATTACCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNACCAGCTTTGTGAATATATTTTTTCTTTACAGGAAAGTGAAGAAGCAAA
GAAGCTAAGGGAAGAACGCCTTGCACAGTATGAATCAAAGAAAGCCAAAAGTAGGTCATT
TGTCTTCATTCATTTCATAGTAATATGAATGATCTTTTTCAAAACTTGACCTCAAAGTAA
TTTCCTCCACTTTTATTGAATAGGTCAGTGTTTCAAAACCTTTCATAAAACTTCCACAGC
TACTGGTCTGCAGCTGTTCTAATGGTAGCAGTTGTAGCATTCCTCTGTGGGAAATAAACT
GTTATACAATTATATGCCTCTTTCTTAGCCAAAGAGAAAGTGGGCACATGTGTGTGACAG
ACACATGATGTATTGTTTAGTTATGTTTGGCTAAGGACGTCATGCTTCCAAAACCAATTG
ATATTTGGATTATGGTGAAAACATGATTACTTTAAATAATGGTGTTTCTTGTTTTTTAGA
ACCTGCACTTGTCGCCAAGTCTTCCATCTTACTAGATGTGAAACCTTGGGATGATGAGAC
GGATATGGCAAAATTAGAGGAGTGTGTCAGGAGCATTCAAGCGGATGGCTTGGTCTGGGG
TTCCTGTGAGTTTAATTTTTGGGTTTTGAAGTTGAAATCTGGAATTTGCATATGCCCATT
AACAAGACTTTTCTAACTTCAGATTTTTCTTAATATTTTTTTTTAGCTAAACTAGTTCCA
GTGGGATATGGTATTAAAAAACTTCAAATACAGTGTGTAGTTGAAGATGATAAAGTTGGA
ACAGATATGCTGGAGGAACGGATCACTGCATTTGAGGACTATGTGCAGTCCATGGATGTG
GCTGCTTTTAACAAGATCTAAAATCCATCCTAGATTGTTGCACTTAAATAAAAGCTTGAA
AGATTACCCTTGGCTCTTGAGCATTCCTTGTCATTTTGAGGGAAGGAATTCAATGCTATG
TAATTAATAGGTAATAAAAATTTAACATTCTTATTAAATATTTAGCAATTCTGATGTACC
TGTTAGTGAAGTCGTCAGCAGTGTATCATGCTGATGACACAGTCTGTTTAACTCTGCCCT
GCCCTTATTTGTGTTACTGGAAATCCAACTTGGGACCTTGTGTTAGGCAAGCACTCTCCT
ACTGAGTTACATTCCAGACCATTTTTTGGGTGTAGGGGATTGAACTCACATACATCCTTA
TTTTGCATTTGATTTGGAGATGGGGCCTCACTGAGTTTCTAAGCACATTGCTTTTGCCAC
ATCAGGCTTTGAATTCTTAGTTCTCCTGCCTCAGCCAACAAAGTAGGTATGTGCCGCCAT
GCCCTGCCATAAGCCAACATCTTCAAATTGATTTGATGACAAATCTCACTCAAAAATAAC
ATTGAGTATTAAAAGATATTGGACATGTTACAGTGTTAGAGGAGGGAAGTTGGGTTAGGG
AAAGTGCCAAAATTGTCAAAAGCACTTATATGTTACAGATTTAAAATAATGCCTTTATGA
AGTAAACCTTTTTTGGAACAGTACTGGGTATTGAACTTGGGGCAGTCCTATTGGCCATTT
CTATTTTTTGAGACGCAGTCTTAAATTGCCCAGGCTGTTTCTGATTTGAAAAACCTATTT
TACCCTCCTGGAAGATGAATTGCAGGCATGTGATATGTAATACCACCTCACAGAACCTTT
TTTTAAAGATATTTTTAGTTGTCGATACTAATGTGCTGAGGATTGAACCCAGTGCCTCAT
GTGCTAGGCAAGTGCTATACCAGGGCCACAACCCCAGCCCCCCACAGAACTTATTACCTG
TCATGTGATCTGGAATGTGTCCTGGGCCCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1080, 1550..1672, 2522..2630, 2632..2649, 2863..2929, 3299..3424, 3526..3680
1001..1080, 1550..1672, 2522..2630, 2632..2649, 2863..2929, 3299..3424, 3526..3677
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved