Spermophilus_tridecemlineatus Locus RPL39
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus RPL39
Spermophilus_tridecemlineatus
RPL39
scaffold_82076
SNORA69
3458..3588
4283
TTGGCCCCACCCACTCTCCCCCCCCTCTGCTTTCGGACGAGGTTCTAATTTGGCACTTA
TCACAGGCTGTCTACCTCACTGACGAAATGGAGTGCCCCTAGCACACCGACGGGCTCCTG
GGAAACCCACTTACGGAAGTGAAGGCAAGTGAATTTCATTCCTCACCAAGACGCGCAGAT
GCCCAGGACCCCATGGGAGGCTGGGCTGGCGGGTAGGGAGGTGCTAGTCGCTGGCTGCCG
CAAAGCGTCACTGCCTAAGCTCCACCTCTCAGTGGCGCCTTCTAAACGCGTTCTTCCGCC
CTCTTTCCTCCTCTTCGCCTTTTTTCGGCCATTGTGGTGCGAGCACCGAATCTGGTCCCT
CACCATGGTAAGTCTATCGGCCGCCATCGGCTCGGAGATGGCTTTCCTAGACACAAAGCC
GCCAAGGGCTGGCCGGGGCCGCGTGAAGTGTCGAGGGGCAGGAGTATTTTAAAGGTATTT
TCAAGGGACGGTCCAGTTTGGCCGCTGCTCTAACCCATAGGCCTAGCAGGAGCACTCGGG
GAGGGGCGGCTGCGCCGGCGCGGAAGAGTCCAAAGCGCGCTAAGAGTCTGGCTGATCCCG
GCGACCGCAAGGATTTTTGCTTCCCTGCTGGTGCAAACTGATTATCGAGGTGCACCCCCG
CTGCCGCCCCGCTTGCCTGAACTTGGACCAACGGCAGGCTCAGCATCAGAAGGGGCATCC
AGGAGTGTTACCCATATCAAGATTGCAGGGATTTTTAGTCATTTGTTCAGAGACTTGAGC
TTAATTGCCTAGAATGGGGGTTTTGTGTGATACGGGATTTTAGTAAATGCCATCACTGCG
TTTGTTGGTTACTAGGTATGGAGGGGATCGGTATTTGATGTTTTCTAGTTTATTGATAAA
ATATACAACTGCTACTGCGGGCTGGGAGAGAGTTGTAGTTATTCATTTATAATGGCCCTT
ATAATGCAAAGGTATGTTGGGCTAAGTTGCCTAGGCTATAGATCTGCAATTCTGCCGGAT
TGACCTTGAGGGGGTGGAGGGTACGCTGGATTTAGATGACCTCAGCCCTTCATGAAAGCC
CAAAAGAGGTATGATTACCAGTTTGGGCACACCTAAAATCCCAACAACCTGGAAGGTTGA
GTCAGGAGGATCAAAAGTTCCAGGCTAGCCTCCACAACACTGAGACCCTGTCTCAAATTT
AAAGGGGGTGGGGGCAAGAAGGGCAGGGGATTTGGCTCAGTGGTACAGCGCCCCTAGGTT
CAGTCCCCAGTACCAAAAGAAGAGGTGGGATTAATACAAAATGGTGAGTGGGGCAAAATC
TACCTTCACAATGACACTCGAAAGTAAATTTCCCCAGTTTTACAGTAGGCCACTGAGGCT
CATTGACTTACAAGTGATAGGTATTCTGGTTAACCTAAAGCTATGGTCTTTCCATTAAGC
CAAGTTCCTCAGCCCTAGTCAATTACCAATTTGGTTGCCTGAGTTTTCTGATGCCTTTTG
AGAACTCTTAGGATTTGAGGGCTGGATGATGATTTTTAATTTTTTTTTGTATATCCACTG
AGATGTTTGTTGGATTGAGGAAAAAAATTTTGAGAATCATTTTGGGCTGGCTCTAGTATC
ACTAAGTTGTTTGCATTTCCTTGCAGTCTTCTCACAAGACTTTCAGGATCAAGCGATTTT
TGGCCAAGAAACAAAAGCAAAATCGTCCCATTCCCCAGTGGATTCGAATGAAAACTGGTA
ATAAAATCAGGTAAGACACCACACACACAAACACACACTATTCTTTGTTTCAGATTACTT
TTAGGGCATAAACATGCAGTTGAAAGTTACATGTAATCTAATCTGTCATCTATCAACATT
TTGAAGTCCTTCTTTATTGTTTTTGGATTTGTTTGTGAAGTTTTTTTGTTTTGTTTTTGC
TAAGGCTGGCTTTGAACCTGCTATCCTCCTGCCTCAGCCTCCAAGCTGCTTGAATTACAG
GCATGTGCCACTGTGCCTGGCTTATTTGTTCATTTTTATGTGGTGCTAAGGATCGAACCC
AGTACCTCGTATCCCACTCTGCCACTGAGCTATAGCCCAGCTCCCCCCAAATCAGTTTTT
GAAGTGGTCAGCTTTTTTTTTTTTTTTAAGATTGCAACACTGCCCTCTACTGCAGAAATA
GTTGAATTGATGAGTTTGGAAGAAAGACATCACTAGAATTGTTGTCAAGGACCTCCAAGG
TCATCTAGGACTAAAACTCTGGTTTCCTATATGCCTTTTTCAGTCTGCTTCTCATACTAA
GTGGGCTTTAAGACAAATCTTGAAGGGAGGAAAAGTAAGCATCAGAAATGAGTGAAATTT
GCCCCAAGATAGCCAGTGACAATCACAGTCCTAGAGTGTTAAATAAAATTCACAATTTTT
GTTTGTTTAAAATTAAGTACCAGGTTCACTGGCTTTTCCAAATAACAGCTCAGAAGACCA
CATACAGGAGGTAGAGTGTTGAAGATGACAGTAGAGGGTGAGCTTAGCAAGTGGGTCCCT
CTTGAAAGAGAAGACCACAAAGCTAGTGTAAACTCTGGGTTGTACAGCATATCTGTTGAA
AGAGAAACTGGGACCCTTTCCATGTTCCTATCAACTGATGATATCTGTGTTTTGGGTTGT
GGGAATGAACAAAATGTATATAAAATGGAGTGCCTAATTCAATAGATAATCCTGATTCTC
TGGTCTCATACAGTTGGGGAGACATTTGCTATCTTCCAACTTTTATTTTGTGTGTGCCTG
GTGCCCGGGACCTCATGTAGCCACAATCTCCAGTCCCTCTTTCAACTTTTAAAATTAATT
GAGAGCAGGTTGCAATTACAGTGCTTCATTTTGTGGAAGTACTGCCATTATCCTGCTGAA
AGAAAAGCTATGTTGATCATTTTTGATTTTGCCTTCTGGGGGTAAAATCATGACAGATTG
ACATGGACAATTCAGACATTGCTTTAGCTCTGGAATACACTATTACTATGGGGTATTAAT
TTGTTGTAAAGATAAGGCAAGAGCTTTTGTGTATGTGTGATCCATTAAGAGGGGGTTAAA
GATATGCTTGCATCTACCCCCATTGTGTGGGTACCCACGGAGGGGAGGAGAAGGAGTTTC
CTTTCTACTTGAGTCCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
AATTCCAAGAGGAGACACTGGAGGAGATCAAGCTGGGTCTATAAGGAATGACGTGAAATG
GCGCACATATTTATCAAAGCTATGATCATTTTGTCCCATCCACCTGAAAATGTCCGCCCT
ATCTGGATAGTGTCACATAAGCTGTAGTACTGGTTTGAGTTGGTTTGCTAATAAATATGT
GAAACATTTGAACTGCTGTTTTGGTTTTTAAGGTTATTGGATTAAAGAGAGGGAATTTTT
AAAAATATTTATTTAATTGTAATTAAATAGATCCCTATGGCTAGTGGCTCCTAAACCTGC
TGTGTCGTGCACATATCATCACAGACCTGAGGGTGAAACAAGAGATTGGCAGGATCTAGG
CACAAATCCGTTTTACTTTTTTATAAGATGGTCTCGCTGTATTACCCAGGCTAGTCACAA
ACTCCTAGAGTGGACCAGTCGTCTTGCCTCATTTGCCCAAATAGTTGGAACTATAGGTGT
GTGCCCTCTATTTTTGTATAGCTGCAAACTAAATATTTATTGCTTTGCATCAGGGGTACT
GAGGATTGAACCTAGGGGCACAGTCCCACTGAGCTACATCCCGAAGCCCTTTTTGTTTTT
GAGACTGGGGCTATCCACAAGCTTAGTGATGCTCCTGCTTCAGCCTCCTACATCGCTGGG
ATTAAAAGTATGCACTCCATCTAGCCTATTGCATTTTTAAGTGGTTGAAAGAAATCAAAT
ATTTTATTGGATACCTGAAAATCAAAATTTACATTTTAAAGTTTTTGAAACCAGGGATAC
ATAACCACTGAGCCACATCCCCATTGAGGTGATAGGGCCTTGCTAAAATTCCCTGAGGCT
GGCTTTGAAATTGTGATCCTCCTGCCTCCGCCTAGCCTCCCCAATTTGGGAATAANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2283..2386, 3873..3903, 3906..3920
1001..1003, 2283..2386, 3873..3903, 3906..3917
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved