Spermophilus_tridecemlineatus Locus ENSSTOG00000000889
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus ENSSTOG00000000889
Spermophilus_tridecemlineatus
ENSSTOG00000000889
scaffold_116532
SNORA11
5472..5600
7774
CAGGACCAGGCTGGAGGAGCTTGGGTGAAAGGTCAGGAGCTAGAAGCATTGAGCAACAG
TGAGGGGTGTGGGTTGAGAACAGAAACTTGGGTGCGTGGAGCTGTACTGTGGGGTACAGT
GAGCTCGCCTGCGGTGGGAGGAGGAGGGGTGAAGGGGCATCTGGCGGGAAGAAGACCCCC
ACCCCGCCGCCCCCCTGCCCACCCACCCATCCGCGGAATCGCATGCGCACTGGGGACCTG
GAGGAAAGGGCTTTTGTTGGGAAAGCGGGAGGGCTGGAGGGGTCCGCGCATGCGCAGGCT
CCTCAGCCGCCGGGGGTGCGCGGAGAAAAGGGGCGGGGTGGTCCGAGCTGCTGTGCTGGC
AGCAGTAGACGAGGGCGCGGCTGCGGGGTCCTGGTGCCCAGGACCGACGCCATTGGAGCC
CCAGGGAAGGGAAGGATCCAGCCCCAGACAGGACTTGCGAGGGCGAGTGCAACCCGACAC
GCTGCGCCCTGCCCTCGTCCCTCCGGATTCTGAACAAAGCCGGAGCGCTCGGAACCGGGA
CCTCTTCAGACCCGAGGTGGAAGATAGAGCACCCCTCGCTATGACNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTC
AGCTCGCGAGAGATCCCGCCTCCCTGAATCCCGCACCCTTCCCCTGAAGCTGCCTCACCC
TCCCTCTCAGGCTGAGCTGTCTCCTCCTTGGGACCCGCGGCATGGCTGAGAGAAGCCGCA
GCGGGCAGTCGGGAAACTCCAACTCTGGAGACATGGATGAGGGGAGCCAGCGAGCCAGGG
AGGAAGAGATGGTTGGAGGCAACGACTATGAAGAATTTGGTGCTTTCGGTGGCTATGGCA
CCCTCACCAGCCTTGACATCCATCTCCTGAGAGCCTTTGGGAGCTTGGGTTCAGGCTTTC
GCTTCTTAGCGGTGAGGCCCCTTCTTGGGCACCTGCTTGCCCTGAGCCTTGACCCCTGCC
CAGCGGGGTGGGTGAAGGAAGGGGGAGGGCCGAGTGGGCAAGGCATGGCCAGCTTTCCCG
AACCTTCCCTGTCTTGCTGAGGGGTGGCCAGGGCCAGCTGGTGGGAGGAGGCGGGGCCAC
CAGGGAAGCACCATGGCAGTGTGTAGAGTTGTGTGTGCCCTCCCCTCTCGCGCCCCGCTC
CTCTGGCCTTGCAGAATGAGCCCTGGGAACTGGAAAACCCCGCGCTGGCCCAGACCCTGG
TGGAGGCATTGCAGCTGGATCCGGACACCCTTGCCAATGAGACGGAGGCGCGCGCTGCCA
ACGTAGCCCGCTCTGCCGCCTCCAACCGAGCCAATCGGGCTGCTGCCTCTGCTGCCCGCA
GGTCCTTCAACCAGGCCATCTCCAACCAGATGAGGGCCGCACAGCAGGCCCTAGTAGAGG
ACGCCCAGCCAATGACATATGCCGAGGCTCAGGGGGCCACCCCTGAGACCAGCCATGCCT
CTCAGCAGACCTCCCAGACGCTAGTCGCCAGTGAGGGGGCTGCCCCTGGGGCTCCAGCAC
CCTCCACACAGCCCCAGACAGCCTTCCTGGCGCAGGAAGCCGCTGCAGAGGGCCCTAGCA
CCGCCTGTGCTTTCACTCAGGCTCCAAGTGCCAGCGAGAGGGATGCCACCCAGCCCCAGA
CAGCCTTCCTGGGCCAGAAGGATGTCTTTGATTTCACTCAGCCGGCAGGTGTCAGTGGCA
TGGCCTTCCCTCGTCCCAAGAGACCTGCCCCGGCCCAAGAGGCCCCCACACAGGGTCCCA
GTGCTGCCTGTTGTGTGCCCCAGGCAGCACCTGCCAGGGAGGGGTCAGCCACCCGGCCCA
AGACCACCAAGTCTGGGAAGGCGCTGGCCAAGACTCGGTGGGTGGAGCCTCAGAATGTGG
CTGCAGCTGCTGCTGCCAAGGCCAAGGCGGCCACAAGCATCCCCGAGCAGGAGGGGGCAG
CTGCCACTGCCCAGCACAGTGCTGAGCCCTGGACCAGAATGGGAGGCAAGAGGACAAAGA
AGGTATGGACTCCTGTGCCATCGACACAGCCCCTTGCTCCCCTGCCTTGCCCCTTCTCTC
CCCCTTCTCCTCTCCCCACCTCACCTCTCCTCTCCTCCACACCCTCCCCCTACTCCCATC
CCAGCTTAGTCCATGCTTCCACAGCACAAGGCTGCTTGCTGAGTGTGTTTTGACTCCACG
TAGTTCCAGCCCTCGGGGCTGGTGGGAGAAGAGGCTGGCTCAGAGCCTGGCACTGAGCAA
GCTCTCAGCACGTGCCAGCCACTGCTCATACTACTCTCGCCTCCAAGCGCCTGTTGGGGG
GAAGGTGTGTGGCGGGGGCTTTGGCACGGGAATTCTGCTAGTCCCGCTTGTCTCCTCTCT
CTCTCGTGATACAGTCCAAGCACCTTGTCGAGGACTATGAGAGCAGCGAGGAGGAGAGAG
AGCCCCCCGCCGTGCCACCGACCTGGAGAGCATCGCAGCCCCCCTCTTTGGCACAGGCTC
AGTCGGCCCCTCGGCCCCCGGTGGCCCCAAGGTCCCAGATACCTTCGAGGCATGTCCTGT
GCTTGCCCCCTCGCAATGTGACCCTTCTGCAAGAGAGGGTAAGATAAGAAGTCCACACTC
TGCGTCACCATGCCCTCCTACCCCACGGGCCAGCACTGTCTGGCCACCCATGCCCTGTTC
CTCCTCCTCCAGGCAAATAAGCTGGTGAAATACCTAATGATTAAGGACTACAAGAAGATC
CCCATCAAGCGCTCAGGTGGGCGGCAGAGAGGGGCCCCGACCCGCTGCCTTCAGCATGAC
TGGCTGAGGGAGCTCGGCTATGAGGACCCTGCTCAGCCCGGGTGCCTCCCCTAACTGCCC
CCCTCCCACAGACATGATGAAGGACGTCATCCGGGAATATGACGAACATTTCCCTGAGAT
CATTGAACGAGCCACCTACACTCTGGAAAAGGTGGGTGCGGGGACAGAAGCTGCTCCGCG
CGACTGGATGTTAGAGCTGTGGAGCAGTGGGATGGCCTGTGGCCCCTGGAGGCCCAGTTC
CCACCCTGCCTGCTCTGGGGACCTCCGCTAGCCCTCCACCTGTGAGTTTCCACTGCCCCT
TCCCAGGCCCTGCTCTGAGAGTCTGTCTCCTATGGTGGGTCTCCTGTCCTCAGCCCCCAC
CCCCCACCGCCCTCACACACAGGTTTGGATTAGGGGAGGAGGACGTGTCTCATGGGGCTT
GACTGGCTGGCTGCACGGTGCCCGGCGTGGGGGTAGATCTCACTCTGTTTTCTCACCATG
TAGAAGTTTGGGATCCACCTGAAGGAAATCGACAAGGAGGAGCACCTGTACATTCTCATC
TGCACCCGGGATTCTTCAGCTCGTCTTCTCGGGAAGTAAGGAGGGGAAAGAATGTCGTGA
CCTCCTTGGGGATGTCTTGTCCCTGTCTGCATCCTCTGAGGGTCCAGGAACACAGGGCTG
GAGGGCCCCCTGGCAGGGCCCACCCTGGGAGGTCGCAGTGCCTGGGGACCGCTGTATAAA
CTGAGCAGCGTCCTGGGGGGCGAGACCTTGTTGCTGTCGGGATTTTTGCCCCTGGGTGGG
AGGAAGGTGGTTCATTGCATCCCTGCTGGCATGGGTGCAGCAGGGTGGCCCTCCAGGGAG
AGCTTCCTGTAGAGTGCAGATCCTGAGGTGGGCATGGCCCACCTGAAGGCGCCTCTGGAC
ACCCCATGGCCACTTGCCCAGCTCGTGTTCCCTGACTCACCCCATGCTCTGCAGAACCCT
GGGTGGAAGGGTATCAGATGCCCCAGTTATGGGCAAGGCAGTTAAGTCTCTTTCCTCAGG
GTGCGAATTGCCTGTTATCCATGGGGCAGCAGGCTGTGTATCCCTGCCAAGAATTTCCCC
TCCCCATGGGCAACCTGGGAGAGGGTGGATGGTGAGCTGGATGCATCCTTGAGGGCAGTG
GCCTCTGCACAGCATCCCTTCCCTCTTTCTCCACCTGTAGGACCAAGGATACTCCTCGGC
TGAGTCTCCTCTTGGTGATTCTGGGCATCATCTTCATGAACGGCAACCGTGCCAGCGAGG
GTGAGTGCTGGCTCTGCACCTGGGGATTTGGTCACGGTCTCATCTTTGGGTGCCAATCTC
TCGTCCCCCGTCTCCCCTCGCAGCTATCCTTTGGGAGGCACTCCGCAAGATGGGACTGCG
CCCTGGGTATGACTGGCTCCTCGGCCCCTGCCCTTGGGTGCTGTTCTATGGCAGAGGAGG
TCCCGGGATTAGAAAGGAGTGGGGCGCCCGGGCTAGCTGGAGAACAGAGGGTCTCCCTAG
GGATGGATGCGGTAATGATGCCAATCTCTCAGCCCCCTCAGAGCTCTGTCCACAGAGGAC
ACCTCAGAGAGACAGAGTTAGGGGATCCACCGGGTCACCTGGCCTCTGCTGTGTGCCCTG
TCCCGGGAAGGCAGTGCCCACGGGCTGGGAAGCCAGTGAAGGTGCCCAGAAATGCTGCCG
CCCGTGTCTGCCCCTGCAACCCTCACTGGTCGCGGATGTCTTTGCTTGCCTTCAGGGTGA
GGCACCCTTTCCTTGGTGATCTGAGGAAGCTGATCACAGATGACTTCGTGAAGCAGAAGT
AAGTATTGCTGAGCTGACCTCACGTCACTCTGGGGTACTCCACAGTGCCAGTCCGGTGGA
GAAGACATCCACATCCCATTTTGTAACCCAGCACGAGCAGGGCCCAGCCTGGGTGAGGAC
AGGGGGAGAATTCTGGGGCTGTCTCTGGAACAGGGAGCCTGTGTTGACTGGGAGTGTGCT
GAGGGCGTGTGTGTTAGGGCCACCGTGTCACTGAACACCTGCCCTATGGACCGCCACAGG
AATTTCCCCTACTCTTTGTACACCTGAGGAGCCAGGGGCTTGGAGAAGGGAGGTCTCCAG
GTATGACCCACAGCCAGAAAGGCTGGGAGCCCAGCTCTCCTGGGTTCCAGGCCTAGACCC
AACCTGCCCTTGTTTCTTGGAGGACACACAAGCAGGCACACAGGCAGGCAGACGGGCAGG
CATGTGCACAGGCAGGTGGGCAGGTGTGTGGACAGGCACACATGCACACACACACAAAAG
GGTCAGGGATTTAGACTAACCATGGAGATTCTCTTGGCTGACTCTTTTTTTTTTTCCCTT
TATTTCCCGCCATTGTCAATGGTACATCTTTCGGGGCTCGGCAGTCTTTCTTTGTTTGGG
GCCACTAGTGAGGGGGTGTGCTCAGAGCAGGGGGCCCGAAGAATGGCTCCTCTGTTTACA
ACACACCCAACAGGAATTCTGGAGCTATGATGATGAGAGGCACAACACTTGTGGCCTCCC
CGTGAGCATAGCCCTACACACGTCCACTCTTGAACTGCACGTGGCCCATTGCTGTGAAGC
TGTGAGAGCCACGCTGTTGGGGGCGGAGGTCCTGGGGGTGAGACTGGGGGCAGGCGGGGC
AGCCCTCCTCTGCCAGCCGAGCTGCAGCTGTGGGGTAGAGGAGGACCCCGACGGGACCCA
TGGGTTCCACAAGGGGTCTCCTGGGAAAGAAGCCAAGGACATTTTCCTCTCTCGCTCAGG
TACCTGGAGTACAAGAAGATCCCCAACTGCAGCCCGCCTGAGTATGAGTTTCTGTGGGGC
CTGCTAGCCCGCCACGAGACCAGCAAGATGAGGGTCCTGAGATTCATTGCCCAGGTACCT
GGGAACCTGTGTGGGGTGCCAGGCCTCGGGGGCTGGCACTTTGCATGCCTTGTTCGTTTC
TTGGTCACGGCCTCCTCGTGTGGATGCTGAGCGGTTCCTAAGCCGATAAAGACAAGTTCA
CAGGGGTCGTGATTGTGCCGGATGTGGCCGGCAGCAGGTGCTGCCCGAATTGTGGGGTAG
CCCTGGCACTGAGGCTGCTGTTTCCCACCTCAGAACCAGAACCGGGACCCCCGGGAATGG
AAGGCTCACTTCTTGGAGGCTGTGGATGATGCTTTCAAGACGATGGATGTGGAGATGGCC
GAGGAACATGCCAGGGCCCAGATGAGGGCGCAGATGAATATCGGGGACGAAGCTCTGATT
GGGCGGTGGAGCTGGGACGACATACAGTCTGAGCTGCTGACCTGGGATGAGGACGGGGAT
TTCGGCGACGCCTGGGCCAGGATCCCCTTTGCATTCTGGGCCAGGTACCATCAGTACATT
CTGAATAGCAACCGTGCCAACAGGAGAGCCACATGGAGAGCTGGTGTCAGCAGCGGCACC
AACGGCGGGGCCAGCACCAGCATCCTCGATGGCCCCAGCACCAGCTCCACCATCCGGACC
AGAAATGCCGCCCGAGTTGGCGCCAGCTTCTTCTCCTGGATCCAGTAAGATTTTCCCAGG
GCCTTGAGACCTGCGGGAGGGCTGAGGGCTAAGGGGAGGGCTAGGGGCAGGGCGGTGGCA
AGCCTGATGGAAACATGGAATGACACCCGTTGCCCTGTGTATTACCCCTGGCTGGTTGCT
GTGGGCCTCCATCCATCCGTTTCCGTTTTATTCCTCGTGTTCCAGACAGCGTTGAGGACG
TGCCGTGATGTTCCTCATCCAGCCAGACTGCCTCTGCAGAGTCCCTCTTAAGCAGCACTC
CAGGCGCTTCTCCCTGTGGGTCGGAGGGGCCATGCAACGCGAAGCTCCCCTTGCTGCTCC
TGCTTTTGTTGTGTGCTTTTTTGTGTGTGTGTTCATGTTTTGGTATCAGTGTTACATTAA
AGTTGCAAAATGAATTGGGTTGTCTCCTGCTTGACTTGTGCACGTGTGGCTATGATTGGC
CTTTGGCTGGTCTGGTAAGGAGGTCGCTTCTGGTTGTCCTGGATCTGTGGCCCTCGCCCC
TGCAGATGAAGCTCACGGCTACCCTTACAGGTGGAATGCAGGGAGGTGTGGCAGTTCCAG
GTGAGAGGGGGGACAGTGAGTTGGAGGAGGCCCCAGTTTAAGTGCTTTTGTGATGCCCCA
CGAGGGCAGCTCAAGTAGCAGCAGCTAGTAGGCAAGAGGCGGCAGGAGAATGGAGGGCCT
GGAGGTTAGTGCCACTGTACCGCAGAATGATTGTGCCCGTGGGCAACCACAGGGTTCACT
CACCGGAGCCCCCACTTTTGTGGAGACCTGGTCCCATAACCCTTCACTCAACATGAGGCA
ATTCAGGACCCTCACCCCGGGACGGAATCTTAAGCCCAGTGAGGAAGGACCTGGGTATTG
ATGGCCTCAGCCCTGCAGTAGAGGGTAAGAGTGAAAATTGCTGACCAATGAGGACAAATT
GAGAAAAGCTTAGTCAGCCCATGGCCAGCGAGGGATAGGGGCTTCACTGCCCCTCTCATC
CTGAAGCAGGCCAGTCCGTTTCCAGCAAGATGCGGAGGGAAGAGACAGGCTGGTTCCCTG
GGAAGAGCTCCATCCGTGGCAGAGATGGTGCCCTGGGCTTCCTGGGGTTCTCCAGTAATG
GCCATCGCCAGGTAGAACACAGCCCAGAGGACTAGGAGGCACGCAGTGGTGTCAGTGTCC
TTGCCGCCCCCTAGCCTCTTTTGTCCCAGTGAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1210, 1454..2281, 2654..2857, 2952..3015, 3131..3210, 3543..3634, 4240..4319, 4403..4445, 4795..4857, 5819..5933, 6153..6583, 6765..6774
1001..1210, 1454..2281, 2654..2857, 2952..3015, 3131..3210, 3543..3634, 4240..4319, 4403..4445, 4795..4857, 5819..5933, 6153..6583, 6765..6771
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved