Spermophilus_tridecemlineatus Locus Mono:125:SNORD89
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:125:SNORD89
Spermophilus_tridecemlineatus
Mono:125:SNORD89
GeneScaffold_3694
SNORD89
1001..1112
2112
TGTTCTTTTCTCACTTCTTGGAGGTGAAAATCAAGAACTATGTAGCAGTTATTTCTTTT
AAAATGTAGATTATATAGACCTTTGTTACTTTTTACTTTGTTTATTGAGGAAAATATGAT
TTAAAAAAAATAATTTATCTTATAGCTATATCTTGAATATTAGGGTTTATGAAGCTTATT
TTTTCTCCAGCTATGTACTATGTATACAAACTGAGTCTAGCTACTCAGTAAAATATTTGA
TGAATTGTTTTACTGAAATAAATTGTACAGCCAGATTTGATACAAGGAGTATTGAAATAG
AAAATTTGTCTTGCTTTGAGCACTTGTTTTCTTAGGTAGCCTCAAAGTTAGTTTCCATAA
CAGCTGTTATCTTGAAATCTACCTTTTGTGTTCACTGCAAATAGGAAAATACATTCTTGA
TTCTGTACCAAGTAGCTGCCTTTCAAGAGACGTATAAAAAAGTGCTTTCGTAATTCTTTT
GGTAGCTAATGAAATTGTCTCAGAACACTGGGACAGACCAAGGTTAATTATTTTTGGTTA
ATTATAGAAGTGTAACTTCTTAATCAGCAGACATCAAAATAGCTTCCCTCAACTCTTAAC
CCAGAATCTTTATGGAAACTTTTAAATTTAATAAAATGCTGGGGATTTGGGGACTCTAGA
TGAAGATTACACTAAATGAGATTTAGTTATTTTCCTCCTAAAAATTGTCATAAAAGCCAT
TTGTTCACATCATGTGGAACAGTGTTTTTTTAACTTTGAAAATCATAGGAATGGTGTGAA
GGAAACTGAATCCGTGACACTGAAGTACATGGTGGTTCCCTGCCTGCCTGGCCTCTTCAC
TCCCTGGGGTGTGATTGGCATTCTGACTTTCCCAGCAGAAAACCTCAGAGGGCCAGAGAG
GTGTGAGGAATGGTCATTTGGCAGGTAATGGTTTCTTCTATGCTGTCTTTTTTGGGATCT
TGGACATAACAGCCTTTCTAGAAAGATTGCTTCCCATGGATACTGAGGAATGATGACAAG
AAAAGGCCGAATTGCAGTGTCTCCCTTAGCAGTTTGCTCTCTGGGTGCACAATGACAAAA
TCACCTGAAGCGACCTACTGGTCTGACCTCAGTAATGCAGGATGAAGCTGCATGCCTAGG
GGAAGCTTTCTGAGTGGGAGGGCTAAGAAGGGCATTCCCAGAGATTGGGCAGATTGGAAT
CACTGATTCCCAGATGACACTGGGACTTGACAAAGTAGTTAATACCTCTCTTTGTACCCT
TGTACACATACTTAACCACATCAAAGATGACTAGAATTGTAAAAATAATAACAGAACTTC
AAAAGTCTTAAAAACATTTTTTCAGCATTTCAAATGCTAGTAATTGGATTACTAGTTATA
AAAGTGAGATATCTTCCATGTCATAATCTACCATGTCATAATCGGCCACATAGCCAGAGA
CTTGCCCTCATTCAACAGGAATATATTAAAGAAATTGTGACCTGTAAAGTATATGTGCTG
CATTCATTCAAAATGTTAGAAAAAAGCTGTGTGTGATGGCACTTGCCTATAATCCCAGTG
AATGGGGGTAGTGGGGGAGCTGAGGCAGAAGGATTACCCAGTTTAAGGCCAAGCTATTGA
TTCCCTGTCTCAAAACAAAAACAGGACTGAGGATGTAGCTCAGTGGGATAATGTCACTGG
GCTCAATTTCCAGTAGAGGGCCAGGGGTGGGGGGATTGAGATGCTAGGAAAAAGTCAGGC
CATCTTTTTGATGAGCTGTGGGCCTATGTCATGGGCTCGTGAGAGAAGCCTGAGATTACC
AATACCTCCTGTGGGCTCATATCAGTTACAGAATTCCAGAATTATACATGTGCCTTTTGA
ATGTTTCTTATGGCTTTTCTTGAATTGAACAGCAGTGATTGCATAACAAAACAGAATGGA
TAGAAAAGGAAATCACAGCAATGTGTCTTAGTAAGTGTGCTAGAATTACAATAAACATGT
AACAAGTTCTTCTTAATTTTCTAGATACGTTACATTGTCTTAAAGGGACATTACTCCAGA
AGTATTGCTTAAAATAGAATGAGTTAGTCTTCATTCTCCGTGGGAATGGGAATGTATAGA
AGAGTATGCTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved