Spermophilus_tridecemlineatus Locus Mono:100:SNORA3
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:100:SNORA3
Spermophilus_tridecemlineatus
Mono:100:SNORA3
scaffold_125690
SNORA3
1001..1113
2113
AAATAATAAGCATCTATGTACAGATGTAGTTATGTTATAGTTTTTCTATATAGTTTTCT
ATATATTGAAAAACAACGTATAAACAGATATTATTTAGCTGTATTTGTTGATGGTACACT
TGGAATAGAAGATAACAAGATCCACTTTGGTCCCCTATAATTTCAACCTTCTTGTATCTA
TGCTGATGTTTAATACTTTCTCAAGTGTGGGTCAGATTTGTGACTTTCTTCTAATGAAGG
GAATATGACAAAAATGATAAGGTATACGTCTCTTTTTCTTTGTAGTAGTGCGTGCTAAGT
CCTGTCTAATTAGTTCAGTTGTAGCACCTGAACATACTACATGGGAGTGTACATAGTAAG
TTCTTGATATAAATAAATAATTTTTGACTTAATAAAATCTGTAATAGTATTGAACTTTAG
CCCTAAGAGGAAACCCTTTCCCTGGTTGGCTTTGATGAAGCAATCTGCCCTATTATAAAC
TGCCATTTGCAGGGGTTCACATGTCAAAACACTGATGTTACCATCCAGCAAAAGCCAGGC
AAGGCAGGCATCTTGTGTTGTAGAAGAAACTCAAGANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNGGAGTGGATCAAAAAATGGAAAAAGAGTGAATGAGTCTAAAAAT
GTATGCTATTGCATTCATCAGTTGACACTACATATAATTGAAAGGCTCCCAATTGAGATT
TTCTTTAATATTCCTAATATTCTTTAGGAATATTAATGGTGAAAGAATGATAATGTTGAA
TGTACCAAGAAAGGGGAAACACCACTATCTCCTGAAAAATAACAATAAAGTAAGTCACTA
AATATTTGAATTGGAAGATTGAGTAAGAAAGAAAAACCAAGGATGATGCAAAATGAGACT
TGGTATTATATATCTGAGTCAATTTCCAAAACGAATTTACAGCTAAGACTAGAATCAAAT
CCTGACATAGCACTTGTCCTGTTGTACTAGAGTCCTAAGACAAAATCAGCTGGCCTTGAT
TCACTGGTAGGGGCAATCCAGGTAAAAAACATGAAAGATGTGGGTTGTCAGGTAACTTTC
CTCACACACTTCAGGAAGTTGATAACTATTATTATGTATTATAAACTCTCTTTTCTTCTA
GAGCTCATACAAATATCAAAGGAATAGTAAGTTGCGAAGGTTCTCTGTCATAAAAAGTCA
ATTATTCACCTGAGGGCTGAAAATATTAAGGGTGTATGTGTAAGCAAAGGACCTGTGTCC
TAGCTGCTTGATTCTGCATAGAGGGAGTTTCATGAAATATTAACAAAGACTTAAACAAAG
CAAAACAAACAAAACCCAACCTTCTAAAAGCTCCCAGTGAAGCTCTTCTACATTAAACGT
GCTGATTTTGTAAAACAAAAATAAAGAGTTTATTCAAAGACAGAGAATGAGATATAATTA
AATGGGAAAACAACCATGTACATGTATATGAGGCTTATAATCACGAACATGACAATTTTC
CTAAATTAATTAGGAAATAAATTCCTATTTTATTTAAAATTTTGAAATTTTAAATAAAAA
ATTTAAATAAAATTCCTAAATTAGAATGATTTCATAGTTACTCTAATTCTCAGAATATTA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATGAAAACAACAACAAA
AAAAAATCCATAAGTAGGTTAGTCGCCTCTTACAGACCCTTAACATTGTCCCACCATTCT
CCCCCCATCTTAGTGCTTCACAAATGGGAATTAATTCCAATATAAATTTTGGTTGGGACA
TTCAAACCATAGCAGTACCCTTTGGGGATCTGAAAGAAAGATGGAGAATTGTGCCCACTG
AGTCACACATTTCAAAACGGAGGATTTGCAGAAAAGGTGATTCCAAACTTTCTCTGCCTC
TCATGATCACCTTCCATTTCTGGCTCTCTAGTCAAAGACTGAATGGAGAGAATATTCGTA
AAGAAAGAACAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved