Spermophilus_tridecemlineatus Locus Mono:22:SNORA72
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:22:SNORA72
Spermophilus_tridecemlineatus
Mono:22:SNORA72
scaffold_122358
SNORA72
1001..1122
1876
GAGCTTTCCGTGAATAGTTGGGCCCCATAGCAGGATTGAAACAGAGAAATCTCAGATTT
ATATTAATAAGACAATTCATCTAGCCAATAAAATCAGAGAAGGAGAAGTTGGAGAAAGAA
GGCAAAGAAATTATAACTAAAGTATAGCACAAAATGGAAAGACACAAAATCAAGACAGTG
GCAAAAAAAGAGATATGCTTAAGAGATAATATGAGAGACAAGTAAGATTTGATGTTTAAC
TCAATATGGCCAGGGAGGGAAAAAATAAACACTGAAAAATAAACACTTCGTGTTTCCATC
TTGACAGAGTAAATGAATGTTGAATCACCAATGGGACTAAATAAAATTGGGTGAAGGATT
GGAGGTGTAGATAATGAATTGTTAGGACATGTTGCATTTGACAAGTCCTGGAAATTGTTA
GGAGGCAATTATATTTTCAGGCAAAGTCTATATTATGAAGCACAGTTTGGGGAGTTATGG
CACAGGTAAAAATCAAGGGTGACAATAAGGACAAGATTGTCTAGGATGAGATATAAATTG
GAAAGAGAAAAATATTAAAAATAAATCCTGATGAATATTTACATTTAAATAATGGGTAAA
GAAAGAAGAATCAGTGAATAAGACTAAAATGAAGCAGAAGTATGAGAAAAGCAAAAAAAG
GAGTGGTACATTCCTAGGGAAGATAGAATTTCAAGGATGAAGGAATGATGAAACTAACTT
TGAAAGGTAGAGAAATCAAGAACTGGATATGACCTAATGTGTGAATCAATTAGAAGAAAC
TAGTAAGTGGAATAGGATTCAAGAGAGATTTCAATGTTAAGGACCATTTTGAAAATATTG
ATATGCATAAACTTATATTAATCTGCATAGTTCACTTTTCTTTGAAAAAGCTAGACTGAA
GAAGAAAATAGAGAAATAGGATATAATCAAAGGAGGATAAAGCTTCATAGAAAACTTTTG
GTTTAAAAAAACAAATAATCAGATCAATAAACAGGCAAATGAACTAAACATACACTTCTC
AAAAGAAGAAATATAAATGGACATTCAATATATAATGACTATGCATGTGTCCCCAGACAT
AGTTCTTTCCCTGGGTCGGATTTTATAAATGCTAGTGATAAAACAAAAACAAACAAACAA
ACAACAACAACAACAAACATAACAAAGAAGAAGAAATATAAATGGCCAACAAATATATGA
AAATATGTTCAATGTGTCCAGCAATTAGGGAATTGCAAATCAAAACTACACTGAGATTTC
ATCTCATTCCAGTCAGAATGTCAATCATCAAAATACAAATAATAATAAATGGTGGAGAGG
ATGTGGAGGGGAAAAAAAACTCTTTTACACTCTTTGTGGGTTGTAAATTAGTACAATCAC
TATAGAATTCTGTGTTAAGGTTCTTCAAAATATTAGGAATGGAACCACCATATGATAACT
AACCATTCCTCAGAATTTATCCTAAAGAATTAAAGTCTGCATACTATAGCAATACATGCA
TACCCTTATTTATAGCAGTGTAATTCACAAAAGCCAAACTTTAGAACCAGCCTAGGCACA
TTCATCAATGAATGAATGGATAAAGAATATATGGAAGATAAATGGAATTTTATTTATCCA
TAAAGAAGAATGAAATTATTTGCAGAAAAGTGGATGGAACTTGAAAACAGTACATTAAGT
GAAATGAGTCAAACTCAGGAAGTCAAGGGCCATATGGTCTCTCTCACATCTGGAAGCTAG
ACAGACAAAAAGGGGGGAAAGATGAGTGTGTGGGGGTATTATGTAAATTAAAGAATAAAA
AATAGAAAAACTTTGGTTTCTTTTTGTGTGGAAGAGACCTCAACCTGTTTGAAAAGTGAA
AACAAGAATATATAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved