Spermophilus_tridecemlineatus Locus Mono:185:SNORD52
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:185:SNORD52
Spermophilus_tridecemlineatus
Mono:185:SNORD52
GeneScaffold_5063
SNORD52
1001..1061
2061
TTCTTAACTTCTGAGCCTCATCTGTGCGCACTGAGCAAGCGCTTATGACTAAGCCACAT
CCCCAGCCCTCTTCCGCATTCTTGGTGGACCACTACCTGAGAGCTTAAGTGAGGATCCAG
TGTGGTAAAGTGGGGTTTTTTTTTTTTTTTTTTTGAGTGTTCAGTAGTGGAAATGGGCCT
AGGGCCTCACACATGCTAGGCAGCTGCTCTACCACTGAGCCACACCTTACCCCTGCCAAA
TGTCTAAAGCATCTAATGCTATGTCTGATACATAGTAAATGCTCAAAATTTGAGGTTTTT
GTTGGTATTGTGGTATTTATTTACTTATCTGGGTGTTCTGAATCTCTCTCTCTCTCTCAT
CTCCTCAATCCAGGCGTGACAGGGAGAATCTGGGACAGGTCTCATTATGGTGAATGAGTG
CCAGGTCGCACTCCCTTCATATGAGGAAGCTGTGTACGGCAGTTCCGGTCATTGCATGCC
CCCCCCCTCCCCCCAGAGTGCAAATTGTGCTGTCAGTAGAGTCTGGGCCTAGTGGGAGGA
ATGTGCCAAGGGATCCACAGCCGCTGGGCCAAGGGGCCTGCTCCTCTGCAGGTGGAGAGG
ATGAGACCCCAGCCCAGTCTGGACTATGTGAAGCCTGGGGCTCCCGGGGCTCAGAGACTG
TGATGGTGCATCAGGCAAACACCTCTTCTTGGGCAGCAGGCTCAGGGAGCAGCCGACTGG
CACACAAAGAAACGGCAGATTCCGAGAATAGTGACATACAAAGCCTTTTATCCCTCCCAT
CGGAGGAGTACACAGATGGTAGGTAGTGTATGCTAAATAGGAACTATTAGCTATTTAGAG
TCCTCGCTAGGAGTGAGGAAGGACTGTAGGCCTCTAATCATTGGTGTATTTTCAGCACGA
AAGAAAAATACCTAGGGCCGTAGCCTACAAAATAAGATTTCATTCTCAGAACACACGCGA
GAGCTTTGGGCTTTCTTTTTGGAGACATATCACTGTTGTCTGTGAATGCTGATAGATTAG
AGTCTCTGATGCTGTTGATGGGCTAAATAAAAAGAAGGATGTTCAGGGTGGGGGGCTATC
CTATTGTTGTAATTTTTATTTTCCCAAGAGGTCAAGAATGTTTTTTTGAAAAGGCCAGGG
CAGACAGTAGCTTAATTCTGAATATTTGGGCTGGGATGTAGCTTAGCAGCAAATGCTTGC
AAAAGAAAAGACAAAAAACAAAAGAATCCCACCAAAAAAAAAAAAAAAAAAGAGTATGCC
TGGTTCTGTGCTCCTTAGTTTCCTTGTTCTATCTCAGTTAAACCTACAGTGATTCTGAGA
AGTAAATATTTATTATTATCCCAAGTTTACAGATGGGTAAATAGGCACAAGGAGGGTAAG
TCACTTGTCCATTGGTAAATGACAGTTGGGATTTGAAACCAGATGGCTCTGGCTCCAGAA
CTTGTATTTCTAACACTACTATGCCATGCGGCCTCCCAGGTAACTCTAGCTCCTTTGTAG
CAAACCATCCAGGAAGTGAAACTACTGCCTCTTTACATTTCTGCATTTGCTAGAGCCTAG
AGAGTTTAACCTTGGGCTTGAGCCTTTCACTTTATAAAATAACTGTGAGGGAAATCCCAA
TATAGTTCAGGATGCAGACTAAGCCTAGAAGTTTCCCTTTCAATGGCAATACCCTCTGTA
CTCAGAGAGCCTGAGAGGAAACTTCATACCTCCTTGGTATCCTGGGTAGAGTGTCTAAAA
GTTAAAAGTTTTTGATATCATGTTTGCAGTTTCCCAACTATCAATAGCTTGCACTCTTTT
TTCTTGGTTGGCTAGAGAGATGGCAAGGGACCTCAAATAGTTGACCCAGGTTTGGATAGG
GGGACATTGACTCTCTAGACAGTCAACCACATGTCTTAGGGGATGTGTCTAGAGCAAATT
GCATCCCTTACTCTCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved