Spermophilus_tridecemlineatus Locus Mono:7:SNORD116
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:7:SNORD116
Spermophilus_tridecemlineatus
Mono:7:SNORD116
scaffold_125169
SNORD116
1001..1080
2080
CCTGTTGGGAAGCTCCAATAACATCTGCCCACACTATGTTCTTTTATATGGACAGCCCT
CTTGTGCCTTCACTGTTGTAGGCAGTGCATTTACACACCCTTTCAACAGAAACACATCAT
TTTGTTCTTACAGTTTCCAAACAGGAAATACTCAAAGGTTTGCAAAGTGCTCTGTAATCA
GAAACAATTCAAATTAAAGAAATAGGGATTTGCTTGTAAAATGACCCACTCTCTTTTCAT
CTTGTTCTTTAATGATTCTTATTATTTGCATGTCCAAGGTTAAATGTCCATTCAAGCTTA
ATTAGTTTGCTCATGATATTCATTTCAGCCTTATGCTATGATGATGTGTTTTTAACACTC
AGGGATCACAAATCAGTTGGCTGAAGTTACTTTTTAAAATTATTTAATATCTATTCAAAA
GCAAAAACTTTAGAAATTGTTAACACCTAGCAGAACTGCTCACTGAGGTATTTGGCTCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCCTTCTCACTTTATGCCAA
AAATAAAGTCTTTATTTTTGCTAGTGGTGTTTTAAACAAACCTCTAATTTAACTGATCTC
TTTAAATAAGTAAAGATAAGGTCTTAGGCTTGGGGTCTTTTCCAGACAATAAACATTTTG
TTGTGGTTTAATTTTGTATGTGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTCATGC
ATTTATTTTGGAAAGTACTATCTACTCCGAGTCATACCAGTGTCTATTTAAATGAGCCAT
GTGAAGTCAATTTAAAGAAAATATTGGAAAAATAATATTTAAAGTAGACATGGATTATAG
CAAGTATGAATGTAGAATGATACTGAAGAATTTGGGGAAACAGTATATGAGGAAATTATG
CACATCAGGTCTGTTTATCATATCTGTGATTATTGTTATCAGGAGTAACACACAGAAAAC
TTGGGAAACTGAACAAAATGAGTGAACACTCTACATTGTCATATTCATCAAACTGAGGTC
CACTAAGTTAAAATAGAGAAAGGAAATACCATCAGAGATCTTTTTTTGTATTAAAGATAT
CATATTTCTATATTATATTATTCTTCTCAGGGGACCTTCTATGCTAAAGAAAAGTTATTT
ACATGTTTAAAGCCAGATATAATTAGTTATGATATAAATTCAGCTGCTATTCCTTGTAAT
AAAATTGAAAAATGGCTCAGATATCAGTGTTAGTTTTCTATTATAGCAAGTACGTAAGAT
AAAGAATAAAAAATAAATAATAATACCAATAATAAAAACCCTGAGATAAACCAAATTACA
AAGAGAAAATGTTTATGTGAGCTCACAGTTTGGGGGATATAAGTCCATGGTCAATTGGCC
CCATTGCCCTTGGGCCTGTGGTGAAGCAGCCTATGGTGAGGCATCCCATCATGGTGAGGA
GAGTGTGACAGAACAAAACCCTTGCTCTATGGCCAAGAAGCAAAAAAAAAAAAAAAAAAA
AAAACAACAAAACAAAGCAAAACAAAACAAAAAAAACAGAGAGAGAGTCAGAGAGAGAAA
CAGGAGGTTCTGGAGTTCTACCATCCTCTCAAAGAGAGTGTCCCCAGTGACCTGAAGATG
ACCCACAAGGCTTCAACCTCAGAGTTTTCACCACATTTCAATAGCAACAACCTGTGGACT
AAGCCTTTAATACACAGGCCTTTGGAAGATCATTCAGATCCAAACTATAACTGTATGATA
GTAGTGGTCATGTTACAAGTGGTCCAAGAAGTTCCAATTTTTCTCGTTGCTCTTCTTGCA
TTTCTGGAGCAGTTACAGGTTCAAAGATACCTCAGCACCCTGTCTGCATCCTAGGCAACA
GAATAAAGGAAGAGGCCAAAGGACATACATCTCTTTTCTTTTAAGTGATATATCTTCATA
ATGATTAATTTATATGGCCACATTTAAGCATAATAGAAACTCGTCGTCATGTGGTTCATT
GAAAATTCCAGTGCTATACAAGAAAAGAATGGATGTTGATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved