Spermophilus_tridecemlineatus Locus Mono:36:SNORD74
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:36:SNORD74
Spermophilus_tridecemlineatus
Mono:36:SNORD74
scaffold_8941
SNORD74
1001..1075
2075
CCCTCAATGTTAACTCACCAACCCCTGGTCCCTGGAGCACCTGTGGAATTCAACTGAAT
CAGCTCCAGCCCCTGAAATCTCTCTGCCTTGCTAATGCACACTGTGAAAGGGGGCAAAAG
TTCTGTGAGTGAGCAATGCCAACTTACCAAGGCTGTTAGGGAGCATGCTGGCAGAGCTAA
CTGCCAGAACATGTCCATCTTGGTAGAGGGACCAACATCAGTTCTAGAGGCCACACCTGC
TGCCTTGCTCAAAAGAACTTCTAACCGCTCCACCAAAGACCCTGCTAAGGTTTCCTGCTC
TATCAGGAGCACTTTATGATCCTTCATCTGGTCTAATTCCCTAATCTTTACAAACCCTGG
TAAGGCTGAGAAATAAATATACAGCATCCCAAGCAAGTGAGGATAGTCCTGCCCCACAGC
AATATATAAAAGGGGAAAAGAGAAAGGGGAATGGAGAGTGGAAGCCAACATTATTTTCCC
CACCTCCAACAGGTACAAGGACCCTTCAGATGTTACATGGCTTGCCTATGACTTGCCACT
CAAGTGTTTTCCTGAAACAAAACCACCTTCAGTTTGTACACAATTTGGCAAAGTACCTTT
TGGAGTCCCTGGACAAAAACAGCAATGTGTGTGGTTTGGGTTCACACGGGGTTCACAGCA
GTGTCCATCTTTATGGAGTTTACAAACTAATGGGGGAAGATAGACATTGAAAAGTCTTAT
GAGCCTTTCAAACAGTAGAAATGTTATACGAGAGAATTATAGGTACAAAGGAAGCTTCTA
GAAGGTGGAGAAGCGTGTATAGGACCCAAAGTAGGATTCTTGGAGAAAATGGTGCTTCAG
ATGATGCAGAAGTAGGAGAAAGAGAGTTTAAGGCAGATGGGAAGGGAGGAGAAGTATTTC
AACTCAGTGGAACAGCATGAGTGAAGGGCTTGAGATAGAATAGGGTACATTCAATAAAAC
TGGAGAGAAAGATGTAGGGTGGAATATAGAGATAGAGAAAGATGCCTGGGATGAAGCCTG
TGTTGGTAGGGACATCTGAAAGTGCTGATGAATGCCAGTGGCTCTGATGGTGGTGTGTGC
AGAGTCACCAGAGTAGTCCTTTGTTAATGTCAGTGCCCCAAGCCTCCAGCCGCTGGATCT
AGGGAAGGACAGTGGTTGGAGTTCACATGGTTCTCAAATGGCTGCATTCTGAGGAGTACC
ATTTTTCCATCAGTGGTCCCTTTTTTGGTGCATAATAATTGTACATAATAGTGGGGTTTC
ACTGTAGCATATTCATACATGCATATGATTTTCATCAGCGGTCCTTTGGGTGCAGTGGTC
TTTTGCAACAAAAAGTACATCCTTTATTGTAAATCAAATTGTGGGTGGTGTGAATATTGA
CCTAAATAGTTAAAAGTATGGTACAACATTAGCTTATAATGTGGAACAAATGAACTAAAG
GTGTAACTTGTATTAGGAATGGTACTGGGCAGGGATGAAATGTGGAGTATTTTGGAGGGG
GGAGGAGAATGGGGGATTGAACCCAGGGGCATTCTACTACTGAGCTATATCTCCAGATCT
TTCTTGTTTTTTTTGAAAAATAAAATAAAATAATAGGGTAAAATAAGTGAGAGATAAGGC
TGAAGCTCTAGGCAGGAGCTAAATCACATCAGCATCTTTCAGGCCACTGAAGAGTTTTTA
TTTTTATTTTAACTTAAGAAAAACAGGAAGTTGTTATAGGGTTTTGACCAGAAAAATGGC
ATGGACAGGAAAAAATTGTTCTAGATAGAGTATGGTGATAGAACTAGGTGTGATAGAGAA
GATAGGCATACCCAATGGACACATGGTATGTGAAATTTGCTGTTAATTTAGTACCAGTTC
CACTGTCTTCACATCTATCCTCATCATAGGATAGTTGCTTGGAACCTCATTTTCCAGAAA
TTCTTCCTCACAGGGCTCCAGTGAAGATACTTCCAATGACAGGCTCTGTACAAGATGTGG
CAAGAAGAAGGAACACACCGTTTCTGTAGTGTGGATGTGCACAGATGCAACGTTCACAGT
GGCCCCCAGGCAAGCCTCTGCAAGTCAGCTCCTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved