Spermophilus_tridecemlineatus Locus Mono:200:SNORA20
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:200:SNORA20
Spermophilus_tridecemlineatus
Mono:200:SNORA20
GeneScaffold_4878
SNORA20
1001..1116
2116
TAGTCCTTAAATTTTATAATCATTGTTTTTCTCTCTAAATGACTGCTGCTTTTTTGTCC
ATTCATTACCTGGGATGTCTGAAAGATCAAGAGGACTTGATTAAATTGTGGGAGGACATC
AGGCCACAGCGAGTAACCAAAACCTTCCCCTTAAGTGCTTCCCTTGTTCCTTCCATTTCT
TAGAAGGAAAATATTTTGGGCAAGGACTCAGGTCCCTGGGAACACTTCTATGGGTAATGG
GGGAAAAATATTTTTTAAAGGAGACTGAGACACAGCCCTATTTTGTATTTATTTAGAGAC
AGGGTCTCACTGAGTTGCTTAGTGCCTTGGTTTTGAACTTGTGATCCTCCTGCCTCAGTC
TCCTGAGCTGCTGGAATTACAGGCATGTGCCATCACGCCTGATAAGAACTTTATTTCTGA
AGGTAAATTTCTTTAAAGCTGGGACTACAGCTGGATTCTGGAGAGCAAATTTCCTGAGCT
TGGGCTAAGAGATCAAGTTTTCCTAACAAGGCATCTAGCTGATTGGACCTCCCAACTCTT
CCATCTGATCTTGAGTCACTGTCTCAGGGTTCTGTGTATTGCAAAGTTTCTGATCCGGGG
TCCTGCTGTGTTACAGGGAACAGAAGGGCCCTTCTTGCCATGTGGGTCCACACATGATTT
AAGCATTAACCAGTGCTTGATTCTGACCATTGCATGAGGAAAATGAAGAGCTTCTCCCTA
CTTTAAGGTGTAGCTTCTGTGCTGCATGTCCTGGGAGAGTCTTCATTTCATAGATTGCTC
ACTTTTCATTTGGCTCACTTACTAAATGTGTAATTGGTATTCATTTTCATATTTAATTTT
TTTTTTACCTTTGCACTTTTGCTCATTGAAGTGACTTCACAAGTCAGAATCAAATCACTT
GAATTGATTTCTCATCTGAAAAATGGCATCACTGAACTACAGAATAATCCCAGGCAAAAG
GTAGAAAGCAAGATATCAGTCTAAGAACTTAATGAAACTAAATTCAAACAAATCTGTTAG
AACTTCTCTCATTCAATACATATGGGATAAAACAATATTGGGCCATTGTAAATTGAGGTG
AAGTCACTTTCATCTCTTCTTCATGGTCTAGATAGTGTTTTAGGTATATACATATAAAGA
ACTTCTCTCATTCAATATTTAATGCTGTGATTATTAATCAAGAAGCTAATTAGTAATTAA
TGGGCATCAGAAATTACCTAATGTTATATTAGGGCATCATTAAAAGAGGTTTAAAATCAA
ATGTGTGAATTTTCAGGGTCTTCATGAACTAAGGGTAGGTAAAGGATGGGCACTTACTTT
CCAACTAGTGATAAAATTCAAACTTGGTCTGCCTGACTACACTGCATGTATTCCTAACAT
GTATGTTACACTGATTCTTTTCTAAAGAAAAACCAATCGTGCTCAAAATACACCCGGCTA
TAGACATAATGATGATGATCATCATAATACTAGGCTCTGCTCTGAATGTCGGAAAATAAA
AAAAGCACCAGGGAAACAGAGACTAGCATTCCAGCTGCATGGCCATCTGCCTCTCTAACC
TCCCATATTGTTCCTGCTTCAGAAGTTTTGTGACCCTTCACGCATCAGCAGTTTGCCTAA
GTGTTTCCCTGTCAAACTACACTTGCCATGCCCAATCTCACAATCCAGGCANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved