Spermophilus_tridecemlineatus Locus Mono:58:SNORA9
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:58:SNORA9
Spermophilus_tridecemlineatus
Mono:58:SNORA9
scaffold_139762
SNORA9
1001..1136
2136
TTGAACCCATGGCCCAGCACATGCTAGGCAAGTGCTCTACCACCAAGCTACTCCCCCTG
CCGCTCTAACTAGTAATATTCTTGGTGCTGCTTTTCAGAATTAAAATTATAGAATGTTGG
CATTAAAAGAACTCTAAATCCAGAATTGACTCAATCTTCTAACTTGACTTTCTGTAGACA
ACCTATTTTGGGGGGTCAATATTATTAGAAAAAGTGTATTAAGTATTTAGGATGCATGGA
GAACTGTGAGAAGCCAGGCATGGAGGCACATGCCTGTAATACCAGGAAAATGGGAGGCTG
GGGCAGGAGGATTGAAGTTCAAGGCCAGCCTGAGCAATTTAGTGAGACCCGGTCTCAAAA
TAACATTAAAAGGCCTGGGGCTGTAGCTCAGTGGTCAAGCACTTGCCTAGTGTATGTGGG
GCCCTGGGTTCCATCCCCTGTACCACAGAAAAATATTTAAAAAGAAAACTAAAATAAAAG
AAGTGTGGGGGGCTGCTGGGGCACAGAATTTGACAAAAATTTAATCCCATTCTATTGGTA
GAAAACCTCATCTTTCTTGTGTTGATAAACATGACTTGTTCACCCATGGCCTCGATGTTC
TATTATTAGATTGTGATCATGAGGGAAATCTATGAGTATATCATGAGTGTATTTTTGACT
TGTATAATTTCACTTTCCTTTTGCTTTCGCAATACTTTCACTATTGGGTAATACTGTACA
GAAATTTCCCCTTTTTCTTCACTCTAGATATTCTCATTGCATACAGGTAAATAATAAAGG
GTGCCACATTTCATAAGCGTGTATGAACTGGTCTGCCACCTACTCAGAAAACTGACTCCT
CGAGATTTATGCACCCCAATAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGGAGGGAGCCAAGCCAAACCAGGTCAAAAGAGAAAAATGACAGCAAGCTGCAGCG
TGCTGGGTCTGCAGTGACCCTGCTGCATCCTACGCTGCTGGCCAGGACACTTTGAAATGG
TTTGAGGCCCTTGCCCTGCCCTCTCCAGAGCAAGGTGATAGAAATTCCCAGACAATTAAC
TGTGCCTTTCCCAGGTGTGGCAGTTGCTGAATACCCTGGGCCTGCTGTTGGGAAAGTCTT
CCCAGGTCTCATGTTTCTGGAGTTGGGGAGTCTTTATGTTTTCTGCTGGCGTCATAAAAC
TGCCAGGCTACCTTGCTAGCTGCAAGAGAGGAACACCTCAGACTTTCCAGTTCCTGACAA
CTACCACTCCCTGGGTCCCTGGCCCAGCATGGAGCAGAAGGCTTACTGCTGTTCCGTGGC
TGTGATCCCAGGATGCCAGAGCTGAAGTCCCTTCTGTGGCCCCTAGGCTGGTCTGTGACA
CCTGTGTAGTATGACATGGATACTCAGAAGTAAGGCCTGACCTGACCAGGTTGACACCTA
TGAGAAGTGAAGCAGAATTTGAACCTTAATTGAGCAGATTTGAAGCCTCACTTACTTCTA
AAAGGAATCAGCAGTAAATTGTTCTTGGCCTGGGCTGTGTGTCGGAGAGAACTTTCAGGC
TCCAGGTTTGGGCTCCACTTTTTTCTGCCTCCAGAATAAGCGAGGCTGAAGGGCCTCAGG
CTCTTCTGGCATCTCCCAAACGAAAAACGAGATATTCAATAAACACAGTTTTAAATGTGT
GATGAGAGAGAGAGAGGGGGGGGGAGGGAGAGGGAGAGAGAATATGAAAGATTACATGTT
TATCTTAGCGTTGAAAAAATAAATCATATAAAATTTCATTTTTAAGGCAGAAGAGACAGA
AGAAATCTGGTTATTTTGTTTTTCTCTTGCATGAAGATGAAATCTTCAGGCCGTAGGACT
TGCCTCTCGAGGGTTTGCAGATCCTAAAGGAAACAAAGGGAGCTGCTGTCTGCTGTGACG
TTGGGTGATCAGTTTGCTAAAGCTAGCACATAGTTGTGATTGAGGGAATAAAATGGTTTT
TGAGGGGAAGCTGGAAAAACAAGGCTGTTGAGGGAAAAGACGGCATCTGGGGTAGCGTGG
GACCGAGTTCAGTTTGGTTGTTTATTTCCAGATGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved