Spermophilus_tridecemlineatus Locus Mono:186:SNORD42
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:186:SNORD42
Spermophilus_tridecemlineatus
Mono:186:SNORD42
GeneScaffold_4999
SNORD42
1001..1068
2068
ACATTATAAAACAATTATTAAAACTGTGTTAAGGGGCTGGGATTGTGGCTCAGTGATTC
AGTGCTTGCCTAGCATGTGTGAGGCACTGGGTTTGATCCTCAGCACTGAATATAAATAAA
TGAATAGAATAAAGGTCCATCAACATCTAAAATCTTTAAAAAAAAAACCCATGTGTTAAA
AATTTGTTTTAAATGATTACAACAGCAAAACTTTTTTTCCACAACTTCTCTTAACCATAG
TATACTAATAACTAGAAAGTAAACCTAACCACCTAGAAATTATAACATCAAATGTTTTTA
GGTTGAAAACAAAACTCAATTTAAGAATCACAAATCAGTCATGGTATATATACCTGTAAT
CCCACCTACTCAGGAAGATAAAATTGAAGGATCCAAATTTCAAGGCCAACCTGGGTAACT
TGGCAAGTCTCTATCTCAGTGGGGCAGAGCAACCCTGGTTTCAATCCCAGTGATGCCAAA
AGAAAAAGAAAGAAAAGAGTGGAGAACTGATATATTTAAGGATAAAAGAAAATATGGGAG
TCTTATCAGGATAGTTCATTCAACAGAGGGCTACATAATACAATATTTTGTAATAAAATC
TGAAGCACTAGCATGGTACTTGAAGTACCAGCTACTTGGGAGGTGAGGAATGACCAGTGC
TTAAGCCCAGAGTTTGAGATCCAATCTGGGCAAGAGTAAGACTCTGTTTTAAAACGAAAC
AAAAACTGTACCATCCCATTTTGCCATTGTTGAAAAAAATGCTGTCTCTATTTTTTTTTT
TTTTAACCTTTTATGATTGTCTACAACAAGTGTACTTGCTAGGCTTGGGGATGTAGCTCA
GTAGTAGAGTGCTTGCCTATACATGTGTACACTCCATCCTCGGCACTACAGAAAGAAAGA
AAGGAAGAAAGAAAAAAAGATACTGTGACAATCTACAACTAAAAAAAAAAAAAAAAAAGT
ATACTTGCTAAAGTCTATAGAAGTATATATAAAGTAATTGGGAGCATAAGAAGAAAAATT
CTTAATCTCCTGAGACTTGTGATCTCTTTTAAGGAATCGACTGATGAACATATGTGGACA
AAGTAATTGGAAGGTAAAAATATAGAAATAAAAACAATATTTGGACTGATCATTCTACTG
CTACTTATGAATGTAAAAATGTTTTGCTGCTATGGAACAAAGATAGTTTTTAAAATTTTT
TCAGTGCTGGGGATTGAACCCCAGAGCCTTATGCAATATTAGACAAGTGCTCTACCACTG
AGCCACATCCCCAGGTCTGGCCTCATTTTCATCATCCATCAATACACATAATCTTGTTTT
GTGTATATTTTTTTGTTGTTGTTTTTATGAGTGAAAACAGTATTTTTTTTTTCAAGTGTG
AAGAACAGAAATGGAACTCCAGCAGGGGAAAGAGGGAACCCTATTTAGCAGGTTGCCCGT
TATGTGTATTTTGTTTAAAAAGACACAGTATTTAACAAATATTATGATTCATTAACATTG
AACTCACTCCTCACAGCAATATAACTCATGCCCAAATGAAGTTCTAAACAAAGTTATTTA
ATGCATGTATTTCCTCTGTAAAACACATCACAGAGGGGTGTGTTTTGCACCTAGGAGTAG
AAGACAACACTTCAGCACAATGCATGCAGGCCATTTTAAACAGAAAAATCACAAAGAGAA
GCCACAAAAATGAGAAACATGTGGTACTAAATAAACTGTTTTTGAAAGGGACACTTGATA
TAGGAGTTTATAGGAACTAAAATAAGAAAACAGGGGGCTGGGGATGTGGCTCAAGTGGTA
GTGCGCTGGCCTGGCATGCTTGCGGCCCGGGTTCGATCCTCAGCACCACATACAAAGATG
TTGTGTCCGCTTAAAACTGAAAAATAAATATTGAAATTTTCCTCTCTCTCTCTCTCTCAA
AAAAAAAAGAAAAAAGAAAAGAAAAGAAAACAGAGCATGTTCAACCCCAATCAGGAATCT
CTGTTGGGTACTCAAAACATTTCCTCTTCTGAGCATGTCTACAATGTCATCGAGTATTGA
CTTTGGGGTTAAAAATAAATTTGAGCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved