Spermophilus_tridecemlineatus Locus Mono:159:SNORD19
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:159:SNORD19
Spermophilus_tridecemlineatus
Mono:159:SNORD19
GeneScaffold_92
SNORD19
1001..1078
2078
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTTTTTTTTTTTTTTCTCGACCTGCACGAGTGAGGTATGAGGAAAACATC
TGAACAGTCTTGATTGTCACTGAAGACTGATAAGATCCAACTCTGACCTCAACAAAGCCA
GAGCACGTGCACTGTAGTTGCCAAAGATAGCGCTGGGTGGTGGGAAATAGGTTGTTTCCA
CAAGTGATAGGACTGTTTTTTCCTATTCTTTTGCTATTTGGTACTTTCATGTAAAGAACT
GTTGAGATTTGGGTGCAGTGGTGCATGCCTGTAATCCCAGTGACTTGGGAGGCTATAGTA
GGAGGATCATGAGTTCAAAGCCAGACTTAGCAACTCAGTGAGACCTTGTCTTTAAATAAA
ATACAAAAAAGGGCTGGGATTGTGGCCCATTGGTTAAGCGCCCCTTAATCCCTGGTTTTC
CCCTTCAAAATGTGATGACAGTGTTCAAAATTCCTGCCACCTGCACAATGTTGAGTATTA
GATCAAAGCAAGTGAAATTTATGTGACAAATATTTAAATGAAAGATTGTCTAAGTTTGAG
CAGTGGAAGGGTGAAACCAGAAAGTAGAAACCAGAACAGAGACTCTTTGAAACATAATGT
AAGAATAATCACTGTTAAGGTTAGAATCCCAGGTTGTTAAATTAATTGAGGGTAAATCCT
GGAAATAACTGTAGGGTATAATGTAGAGGTTGACTTCAGTTCTGGAAGGTTGAGCTATAC
AGGAGGAACTGAAATACAGAAGTGTAGATATTAGGATGAGGGCAGCTTGCCCTTCCCTCA
TTTTCCATTTAAATCCTTTTGAAAAAAGGCAAACAATAGTGAAATTTAAATTGAAGAATA
TGTCATATTTGTAATTCCTATCAGATCTAATACCAAGGGAGAATTTGGAGAGCTGGCTAA
ATTATTTGAAGAAAGAATTGCCAACAGTGGTGTTTAAAGCCTCAACATACCTGAAGGACA
AAGGGAAGATAACCAAGGTACACTTTACTATTAGTGGTGAGAAGTGTGGTTCTTTCAGAT
TTTCAATGGTTGAAATATGATGAGTATGCAAAATGTTGATTTTTAAAAAATGAAAGACAA
TAAGATCCAACTCTGATTTCATCCAGAGATATCTGAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved