Spermophilus_tridecemlineatus Locus Mono:68:SNORA26
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:68:SNORA26
Spermophilus_tridecemlineatus
Mono:68:SNORA26
scaffold_150989
SNORA26
1001..1128
2128
TGTAGAACAGCTATTTAAATTTTGCCCTGGAGCCACCCTTTCTTTAGTAAAGTTAGAAT
TTGAAGACAAATTAAGGAGGATGGAATAGTGAGAGCACACATAAGTAAAATTGAATTATC
TTTAAGCACAGCATCCTGTACTCTCTGAAGGAACCCTTACAATTCACTGGAGCTCAGTTC
AGGTAACAGCTAGAGTAGTTCCCTGCTCTTGTCTTTCTTTCCCACACTAAAAAACAAGTA
ACTTACATTACCCTTCATTCCAAATACAAATTAAAATTCATAATCTTCCCAGATGTGATT
AAGATGATCCTTGAAGTTGCTCACATACTTAATAAGCCCAATTATATTTTTTATTAACCC
TGACATAGCTCCTTTTGTTGCTGAATCATAAGTTTAACATTTTTAACTTGAAGCATCAAT
TTCCCCCCTCTCTGGTCATGTCAGATCTCGGGCAGTTGTGAAAAAATACAGTTGAATGAT
GCCTGTTCAGTTTGGCACCTCATTTTTTTACTCTCCATTAGACTTTGTTACATGGTTTTG
TTTTGTGACCTTGTGGTATCTCTGCTGTCCCTGAAGAGGCAGGCTGGGAATGAATTGAGC
CTCAGGGCTCACAGACATGGAGCTACCAAAGACCTAATTAAATCATCTCTTCATCCACCT
GCCAGGACAGGATTATTAAGGTTCTTTCTTAGGAGAAGCCTTATTTATTTGGTTAGTTTG
GTGGTGCTGGGGATTAAGCCCCAGGCCTGGAGCATATTAGACAAGTATGTACCACTGAGC
TACATCTTTAGCCCCAAGAAGGCTTTTTTAGATGTTTGTTTGTATTTTGTGTCCAACTTT
TGTTTTCCCTTATTGATAACTTGACTGTAGATAGGAATGAAAAAATAAATCTATCACTCT
TTCCCAATTGATTCAAATGTATGAATTGCCAAGATCATTGTAATGTCATGTGTAGCTAAT
AAAAAAAAAAAAGTAAAGAAAGAAATCTATTACCCTTTCCTGTGTCCTTTTAAGGCTGAT
GTGATACTTCAAAAGGCTTATTTTACCACAGAAGGGTAAAATAAGTCTCCATAAAACCCA
GAGAAGAGATTTTAAGACTCCTCTTTAGATCCTCTCTGGTGTTATTATAGAACCACGGTT
GGAGAAATCATGAAATACTATTTTTTTTTGCCATTTTCCCCTAATAGTTAAAAAAAATCT
ATTCATTCACTTACAGAAATTTACTGAGTATTATTTTGAGAACACTATTATAGGTACACA
GCTGGAAAAAACAGTCATGCCTTGCCCCAAGGAGCTTAAAGTTGGAGGAGGGCAAATATT
AATCAAATGATCACATATCTACTTGTGTGATTATTTTATAGGTGCTCTGAAGAAAAGGCA
CACAGTACTGCAGAGACTGTTTTAGAGACATTCTACCTGACAGGCAGGGAGGAATTGATC
CATCAGCTGAGAGCTGGGGGATGATTAGGAATTAACCTGGTAGAGGGAGGGAAGAGTGGC
CTGCACTACAGGTATAGCAAAGCAGCAGGTCTGTGGCAGACAGTAAGAACTGGGAGAACA
CCTGCCTGTGTTCCAGATCCCTCAGGATCAGGGAAGAAGGGAGGGCTGAGTAGGCTCAGC
ACACTGTGCAGCCCCATCTAACCAGATGGCTCTGCTTCTCTTTCATTGAGCCCTCTCTGA
AAATTTTATGTAAAAACAACATTCTGCTGCTTAAAAAAAAAAAAAAAAAGGATTTGAAAA
TGTCTATCTTAGGACATCTATCTGCCCTAGTGAGGATGTTTTGTACCATATCATCTCTTA
TCACATACACCCTATATAACCTTCTCACCACTGACACAGAATGCTGTTGTCTTTAAGCCT
ATTTTCTTGAAAAGCAATGAAATGTCCAAACATATCTGTACAGATCTCTGAACTCAATTG
TCCAAAACACAGCCCTTAATTATAAAAAGTATTGTAATTACAGATGAAAACAACATATGG
AGTTATTTTAGGACACTAGTATTCAAATAATTTTTTTCTTAGTAATGGAATCCATTTTAA
AATGAGATCTAACTGAAGGCATCAAAAACTCAGGTGATTTGTATTCTTCTTTGTGCCTTT
TCACTAATGGTTTTTTACATTTTCTAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved