Spermophilus_tridecemlineatus Locus Poly:9:SNORA71
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Poly:9:SNORA71
Spermophilus_tridecemlineatus
Poly:9:SNORA71
GeneScaffold_5082
SNORA71, SNORA71, SNORA71
1001..1134, 3096..3229, 4807..4940
5940
TCCAGAGCTGGTCACTGGAAATTAATTTAAACACAGGTCTGTCCATCCCAACACACTGC
TGCTTTCCTCCCAACATCTCACCTAGGGACTCCCAGACCCCAATCAAGTTCTGAAAGTAC
CTTCTCTGCAGCAGCTCTACAGAGGAGGAAGAAGGTCCTGCTAGACAAGGGAAAAGAGCT
CAGAGAAAAGGAAGCAATGTGACCTGGCGTTCTCATTCCCTGCTCCAGACCACCTAAACA
CTGCCAGCCTCGAAGCCTGCAGAGAACATTCATTCCAGAGAACCAGGTAGGGCACCACCT
ACCTAGAACTTCACAATCCCTGCTCTTGCAGAGGACAGATAGACACCTACCTACCTGTTT
ACCTTTCTCTCACAGCAATCACATGGCACTCCCTCAGGACACAGCCCACTTGGCACTGCT
TACAAAAGCTAAGAAACCATGATATTCACCAACAGGAAAACAGCTGGGGAAGCACAGTCT
CTGGTGGTTATGCACCAAAAGCTCTAGCACAGGCTCAAGTAATTGCCACTATCCCACTAA
GGCTATGGCTTCTGGAAGGGAAAAAAGTGGACCCTCTGCATATGAGCACACCTTGAGACT
CTTCCTATATTACCGAAGATCAATACACAGGCAGCCTGTAATCACTTTGAATGCAGGGGA
AGAAGCAAAGGGCACAGGGCTTGCTAAACTGGAGACCAGTGTCAAACACATGGAAAATGG
CCTGGGCTGGGACAGCAGCACAGCAGAGCACAGTCCTAACAGTTGTCATCTTATCCTGCA
TGCATAAATTTAACCCGTACCAGCCAACCACAAGAGTCAAACAGAAGACCCTCCAAATAA
GAAAGATAGGGATTATGTGTCTGATATCAGAGTCAGAAGCAACTTCTGGGATTACTACTG
CAAATGTGAGCATTTTCTTGTTGCTGGTCTCTTTCCAGTTGAGGTCATTTCCCAAGATGG
TGGCCACAGCCTCCTTTCTCACCTTCTCTGCCCTTTTCTGCCCCTGTATTCGAAAGTGAT
CATGGGCTGCCTGTGTCCTGGTCATTGGTAGTGCAGGGAGAGGAACCACTGAAAGCGTAT
CCCCGTGTTTGGAGGGTCCACTTCTGTCCTTGCCAAACCCTGGAGCTTTCCCACACCTCT
GTCCCCCTTTTTGATGGTGGGATGGTGGCATCATCTAATTGAATGCATTGGCTCTTTTCC
CTGGCCCAGGGCAGGTTGTTATGTACATGAGGGAAGAATGTGGGTGCTTGGACTTGACTC
CCAGGAGTAGTGGGTTAGGTGTGGAGTCTTGCCAGTGGCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNATACTAATACAGCAGGCATAACGAGTCTCTCT
CTCAGGTTGCCCAGATGCTGCTAGAGAAACACAGCACACTCAACACCTTTTTGAACAGAG
CCCTTAGTAACAGTTGGCACAAGAGATAACACTGATTTAGATTAAGATCTCCTGCCCCTT
TCCTAGAAGTAAGCTGCTTGTCTTGTTCCTATAATAAATCTTGGCTATTTAGGTGATGGT
CATAAGTGTTTAGTCAACATTTGTGTGCCAAAATGTGTACAGAGGCTTGGCCATAGGTGT
TTTCATACAAAAGAAGGTCAGACCACAGGTGCTGAGATAAGCATCTCTGGTTCATTCTCT
GGAGAGTGACTTTCTGCACCCCTTAAAGTCATGTTCCTGTTCCCTGGTGATGAAGGAGGA
GGCAAGGATGATAAAGGATTGACCTTTATTGAGGAACCTGGATCACATTTGGCCCTTTGC
ATGCCTTTGGAGGCTGTGCGCAGCAGGTGGTTCTTGAGGTTGCAGAGCTCTGGAGCCCTT
CTGTAGTGCAGCAGTGGCAAGTCATGGTGAGAAGTGGTGGAATTGGGCATCAGAGCCACT
CAAACCTTCTGGTGCTTTTTATTAAGGCACTGGCGATGAACCATTTTGTCACTCAGCTAT
ATCCCCAGCCCATTTTATTCTATCTTTAAATTTTCAGATGGGGCCTTGATAGATTGCCCA
GATTGGCCTCGGAACTTTGAGTCCTCCTGCCAGCATCTCCGAAGTCACTGGGATTACAGG
TATGTGCCACCACCCCATCCATACCTGCTTCTTAAATCCTTTTTTGCTACCATGTCTGGC
TAGTTTCTTTCTAGTTGTACTCGATGGTTAAGATTTATCATAGCAGCAGAGGATATACAG
CCAAATGTTAAAGGATAAAAGGACAAAGGTGGGGTCAGGAGGAGTCTGCAGGCTTTTTAA
GGCTGTTTCCATCCCTCATCCCTTGCAGGGAACCCATTCTTCCCCAGCAGTGGGTAGGCC
TCCCCATGTTTGCTGTGTTTCTGCTCAGAGAAGCCCAATAGAGACTTGAGCCCAGGGCTT
GAACTGAAGTCTGGTCATGTGAATACCATCTGCCTGGCATGCAGTAAAAGTCCAGGCTCC
CAGGAGGAAAGTAAGTGCTGGGTCTAAACCACACTGTTTGCAGTCTGGGCTTGGTGAGCC
ACCCTGATCAGTTCACTGCTGAGATGGGAACATGCCGAGACCCAGGTTCCCAGATGCCAG
CCAGGGGCTGGTCTGACCTATTTTGAACCTCAGTTTCCTGGTATGGAAAACAAAAGATGT
AATAAATAGGTCTTATGGACATGTCCATGTGAGCCTGATCTCTGGCCTGTAGGTTTTTCT
AGTGTTTTTTGTTGGAAGTATCTCCTCTGTTTCACCTTGGCAGTTTTATGGGGTTTTGTA
TGTTAGATTGCAGCTGCAGGATTCCTGTGCTCTTTGTCTTGGACTAGGCCCCTGGCATTA
GTTTCCTGTCCTTGGCCCTTCCTTATCTTTCTTTGGTCCTGCATTCGAAAGTGATCATGG
GCTGCTTGTGCCCTGGTCATTGATAGTGCAGGGACAGGAATGGCTGGAAGACATTTTCCC
CGTGTTTGGAGGGTCCACCCATCCCTTCCAAACCCTGTAGTTTTCCCACACTCCAGTTTT
TCTTTTGCCAACCCTTATAGTTGTTTCTGGGTGCTTCATGATATCTGGCTGGGGATGTCA
TGTGTGGATTATATGTGGAAGGGTTGCCCAGAACAGAATCCAGTGTTGTGAGGTGGCGAG
TGCAGGGTTGTATGTGCCTAAGTTAGGGCTGAGATAGGGTATTAGTACATGTTGTCCTTT
AATAGAGATTCCTAAGTGTGAACTAATAAGAGGAAGGAAAAGGTGAGTGCTCATAGTGGT
AGGGTGTCCAGCTCAGTACACCACCTCACTTCCCAGTCTACATGGCTCCTCTAGGTTTTG
CCTGCTCCGTGTCCCTATGAAGTATACATTGGCATGACTCATTGGCCACTGTTCTGTGCT
TATTATTCTTCTGCCATTTGTCCTGGCCTTTGGGGCTCATCTTAGAATGCCTGGTTCTCG
GGCTGACCCTGGAGGAATGGGTGAAATTGTAAGATAAAGAATGAGCTGGGCTCAGTGGTG
CATGCCTGTAATCCCAATGGCTGGGGAGGCTAAAACAGGAGAATCCCAAGTTCAAAGCCA
GCCTCAGCAGTGGTGAGGTGCTAAGCAACTCAATGATACCCTGTGTCTAAATAAAATACA
AAATGGGGCTAGGGATTTGGCTCAGTAGCAGTTCAGTCCCCAGTGCCCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCTATGTAGCCCTCATCCTT
CTTGGTTCTGCAGTAGCTTGTTAAAATGCTTTGGGAAATCAGAAAGTTAGCTGGTGTTTT
TTTCTGAACCTTGGTGGGATAATTTTTATGACTCAGTTCCAGACCTAATGAATTCAACAT
TATTCCCAAAATTTGACTTCCATCTCATTGTTAGGCCAAAGCTTATGAACCCCCAAGTAC
CTTTGAGAACCAGGGGCAGCTGCTGCAGTTACAACCAGTAAACTGTGTCCCTTTTCCGAG
TCACTATGTCTCTCAGCCTGGCCAGGGCCCTTTCCTCAGCTGTTGGCCCTGGCCTGTCTT
TTTTTGCCCCTGTATTCGAAAGTGATCATGGGCTACCCGTGCCCTGGTCATTGATAGTGC
AGGGAGAGGAATTGCTGAAAGCATTTCCCCGTGTTTGGAGGGTCTGCATTTGTCCCTTTC
AAACTCTGGAGCTTTTGTACATATACTGTCTCTCACTCTCTTACCTCCTGATACCTGGTG
CTGGGGCCTTACAGAAAGGGAATCAAGGTGGGGCTCTGCCCCGGGGGACTTTGTTCATAG
GCTGATTTTGCAATCACAATAGAGGTCATTTCTCCTCTATCTTTGCCTCATGCTTCTTGT
CCTCAGCCCCAGCTCTGGTCACTGGTCACTGTGGTCTTGCTCATCATACCCTTCTCATGT
ACTGGGAATTGAACCTATGTCTCTATATGTCTTGTCACAATCTACTTTGGGACAAAAAGG
AGGCAAGTTCCTATAAGGATAGAGTTCTTTCCATTGAGCAGTCACAGGAAAATGCCCTTG
GATAAGGCAGCCTGCCTGAGGTTGAGGCATTTGTCTCATTTTCTCCCATTTGAGGAATTT
CTTTGATGAAACTTACCTTATTTTAGTCTACCCATAGACCTTGCCCTAAAGAGGGCCCAA
GGTCGGTCCATCAGGTGTGGATTTTCCCACTGGTCTTCAATTAAGGGGGCAGGGACTACA
GTAGTAATCAAGGATGGCAAAACACAATATGGACAGATAGATGAACTCAACCCTTACACA
CCAGACGGTAGACACAGGCCCCCACCACCTCTCTCCTTCCCCTGATCTGTTCCAATCACT
GAGGTCTGTAACATGTTGTAAAATAATAAAGTGGTTATCCTAGTAAAGCAGATTAACATC
TGTCACACAGAACTTTTTTTTAAGGCTGAATAATATTCTGTTACCTTACTCTGTCTCAGT
ATGTGTAGACATATATATCATTTTCTTGATCTCTTTGGGTTCATGTTGTGTCTATGTCTT
GGACATGGGGAAGGGTGCTGTGGTGAACATGGGCATTCCTCTGTCTTTATGAAGTGATTG
ATCTTCGGGTGTGTGCCCAGAGGGGGAATAACTGAGTGTGTTATACATTGATAAGCAACA
AATTGACAGTTGGTGCACAAATACATGGATATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
N
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved