Spermophilus_tridecemlineatus Locus Mono:91:SNORA62
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:91:SNORA62
Spermophilus_tridecemlineatus
Mono:91:SNORA62
scaffold_157283
SNORA62
1001..1126
2126
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTACTTAAAAACGTGG
AGGACTTACCAATTGTATAGATTCTCTTTCGGCTCTGCCCCTCTGCCCCGTTTGATGGAT
CAATTAACTTCTCAACATGTGTCCCCAGTTCAAGAGAATTACCATGGAATTCTTACCTCT
AGAATTACCATAATTTTCTGATGTTTTTTCAGTACCCGATATTTTCTTTCCACATCATCT
ATAGACATGAGTCAAATAAACAATACTGAAGCCTTACAAGTCAATATCAACACCACAATC
CTTCTGCCTAAATTGACCCATTATCTGCTTAAATCCTAAATATTAGGGGGACTAAAATCT
GTAGTTGCAAATTTAACAGTTAAAGGCTGACTCGTTCTTTATACTGATCCCTCCCTGCAG
TATTCCTATCCTTTAGATAAGAAGTAGAAATGGATGTGAGTAATTCTGTGCACAAGATTT
AATGGCTACAAATTGTATAATGTGTACATTTCCCTGTGGTCTGCAGCCCAAATATTATGC
TGGCTTCTCTACCTTTAAATTAAACATAGTAGTATATCTCTGCTTGGCCTTCTTTAGTGT
TCTTTTATCTTGGCTCCCTTTGTCTTTTTGCTTTCATGTAGAATAAACAACAATGGACTT
GTATTATTACGTGCTTCAAGTCTTCACTGAAGTCCATTTGTATTTCTCTCAGGTTCAAAA
ACGATTTACATGAAAAAGGAAGAACATTGGGAAAGGAATAAGTATAGGCAAAATAACTTA
TTGTTTTTAATTGATTTCATAGAAGATTTTCAAAATAGTAATAGAAACAAGGTATTCAAT
CGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCGATTATATTTGAGTGGTATGAATG
ACAGCAGTTATACATGGGACTAGAGAGAATAATGAAGCAGTATGGCATTATTTGAAAAGT
GAACTTGTTCACAAGTGTAGGTAACATGCTACATGAGGGGCAAGTTTTTTGCTAACACTC
CATTCTGGCACAATGAGTAAAGTTTGATAGTACTCCTTGCTACAAGTAAAAAAAAAAAGA
AAGTTAACTTGTGTTAGTTGTGAATGTATATTGCAAACTCTCTGGCATCCACCAAAAATG
TTTTTTTTTAAAAAAATATATAACTGATAGGCTGAGAAGGAAGAGAAAATGGAATCATAT
AAAATGTTCAATTAAAAACACGTATGTCAGAAAGTGAATGGAAGGCAAAAATAGAGACAC
AGAATAAGTGCAATAAATAGAAAACAATAACAAATATGACAGATGTTAATCCAACAATAT
AATAATCATTTGAACATCAGTGATCTAAATATACCAATTAAAAGACAGAGATTGACAAAG
TGGGTCAAAAAAAGTTACCTAAATATGTCTTGACTCAAGAAGCTCATGTTGCAGGGATGG
GGTTGTAGTTCAGTGGTGGAGCACTTGCCTCACATGTGTAAGGTACTGGGTTCAATCCTT
GGCACCACATAAAGAAAAATAAATTAAATAAAGTAATTGTTTCCACTACATCTAAAAATA
TTTTCAAAAAGAGAACCCATAATGAATATAGGGACACTACAGATTAAATGAATGATAACC
ATGCTACACTAATCAAAAGGAAGAGTAGCTGTATTAATTTCAGAAAGCAGACTTCAGAGC
AAGAAAAGTGATCAAGGGCTAAAGAGGGGTATTACTTAATGATAAAGGGGTCAGGTCTCT
AAGAAGACATAACAATCCTTAACGTTTATGTGCCTAAAAACAGAGAATGAAAATATGTGA
AACAAAAACTGATGGAATTGCAAGGAAAAATAGATTAATCCACTATCATAGTTGGAAATA
TCAGTAATTAACACATTCTGTAGGATGAAAGCAAGTAAGGACACAGCTTAATACCACCAT
GAATCAAATATAATGGATATCTATAGACTACTCAATCCAATCTTAGTGGAATACATATTC
TTCACAAGCTTGTATGTAACATTCACCAAGATAGACCACATTATGGACCAGAAAATAATA
CCTCAACAAATAAAAAAATAGAAATCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved