Spermophilus_tridecemlineatus Locus Mono:130:SNORA42
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:130:SNORA42
Spermophilus_tridecemlineatus
Mono:130:SNORA42
GeneScaffold_3254
SNORA42
1001..1112
2112
GAATCTCATTGTATATATTTTTATAAATTTTTCTGTATGTACTAGAGCATTGGTCCTAA
AACTGAGATGCAAATACTTCTGGAGCTCCATGAGGTCTTCTAAGGATATGAGAATATAAC
GAGTTAGTTTTCAGGGAATTATTTTTCAGATAGTTAATTCCACATGAAATGAACCACAGC
AGAGACATTACGCCAGCTCTCCTTTTCCAATCCCCCATCACAACTGTACTTATCTGATTT
ACCCTCTACTCATCCATCTTGATGGATATAAAAAAAAAAAAGTCTGAGGCTTGGGAAAAG
CAGTAATTAAAAATAAGAGTTTGAGGAAGTAAACAACTTTTAATGACAGATTTTTAAAAA
AAAATTTCCTAATAAATATAATTTCTAAATTTTTTTTCAGTGCTTAGGATTGAAGTCAGA
ACCTTGCTTATGCTAAACCTGGGCTCCACTAGTAAGCTACATCACCAGACCTTGGTCTCT
AATGTTTTGCTTTGACAAAATTAAAAAATGACCAAAATTTTTTTCAAATAGTATTAAATA
TTATTTTAACATGGATCACTATGTGCTTTTCTGAATATAACTTAGGAACAGTTTAAATAA
CTGAATTGCATTGAAAGAAAAAAAATTCTTTCTATTCCCACTGAATTATTTAAGTGAATC
AGGTTTCTTCATGCTTACATTTGTAAAAACAAAGACTAGAAATAGAATTGATGTTGAATC
CCATCTGATTCTAGTAGTAATATTCATCCATGAATACATAAACTAACTGAAAAAATAACC
CTAGTAAGTCTCATTAAGAGAACATTTAATAAAATTTTTATTTCTTATGTTTGAGTACTT
TCTAATAAAATTTGCAATGTAGTTATGCTTTGATCAATCATGTCTTAATATCATTATAAT
GTTAACTGAATCCAGATGAAATTGTTAGCAGTAAGAGCTTTATAGTCACAAGAATAAAAA
GAGCTGACTTCAATTTAAAAAGTTTGCTCAAGATAAATATCGCTTGTCCCCTGTTCCTCT
CGTAGTGTCCCATGCCAGAACATACTGTGGCCCTAAACCATTGCCTGACCTCTGTGCCTG
TAGGCTCCTGGCACTGAAGCAGGTTGCACAGTGGGAAAAAAAAAAAAAGATAAATATCAT
GGAATTTCTATGGAAGAAATGGACTGGAAATGCAATGGGGAAAAGGAAGGAATTAAAATT
TGTGAGTATTAGAGATGAACTTTTCATATATTTTCAAAATAGATAATAGCCATATAAATA
AAAAGAGTTGGCTGGATATAGAAGATGCTAGAAATCTAACTTCCAATACTATATCAGCAG
GGTGAAATGTTATTAGGGACTTTATATGCTTCTCCATCTCAAATAGTAACAGAAAATCTT
TATTATACATACTGCAAGCATGCAACTATCGCACATTGTCCTCATTTGTGTTTAGCCACG
CCTCACATAAGCAAGCAGGGGCTGCTGAACTTTTAACTCATGTGATCTTCTTTAGTGCTA
GTCACATAGTTAGTGCTAAAATTAATGACATTTAAAAAAAAGACCATACACCTCCACCAA
AATAAAAACAAACAAACAAAAAAACCCTTAAGTTTTCAGCCATATTGCAGGCAGGAAGTC
TCCTTTTAAGCCTAGAAGGGATTCCTTTTAGGAAAACTAGACAGGAAGCCCACTCCCGTG
GCCTTCTCTCTCACAATGGAGAGAGACAGATATTCTCTTCTTTGCATATGACAGGGTTTT
CTGGAATCAAAGTAAAGATGGCTTTAATAAACAACGATTCCTCTTATCCAATTACCATTG
GATTTAAGACTTAGATCAGCTTCCCCAGGCGAAGAAATTTTAAGTGACTGAGAGCCCCAA
ACCATTGTCACCTGAACAACTTGTTCATCCTAGAGGGGTTACTTTTGACAAAGCCATTCT
AGCAGAGAGCTAAATTAATGACTAATATCATTTAAAAAACTGCTCTCATTGAATTGTGCT
TTTGTGTATGTCATCAATCTCCTCCACAGGACACTGTAAGAAACAGTCTCATGACATTCT
TTGCTTTTATTATTGTATTTATCTTAGGACTATTGTTGAGGGTGTGGCTTACCATTTTAC
ACAGCATCAACTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved