Spermophilus_tridecemlineatus Locus Mono:148:SNORA51
snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus Mono:148:SNORA51
Spermophilus_tridecemlineatus
Mono:148:SNORA51
GeneScaffold_1055
SNORA51
1001..1132
2132
AAAAAATAAATATTAAAAAAAATAACCACATCCAAACAAGAATCCCTCACTGAGGCTTA
CACCAAAGACTGACCACAGGACTCATGTCAAAGCAAAATTCCCTTCCCTCTAATGTCATT
CACCCTAGAATGAGGTCCTGGACCAGCCAGAAGGAAGTGCCAGTCCTAGCTCTGATGTGA
ACTTCACACCTGACTCCAGAAGGCAGCCCATCTTGCAAGCTCCCATCACTCCCTCCCTGT
AGATCTAGCTCTTGCCACCCAACAATGCATCACAGGGCAAAAGAGATGGTGAGTATAGCA
CATAACGGAATCAGACAGGGACCCCACCTCAGGGCCTTATGACTGTAGCTGCTAGGAGGG
TGGGAGTATAAGAAGGTAGACAAAAACCCAGAGGAATGTCATGGCCAGATAAAGAGACAG
AAGAAAAGCCTTGTACAGACTCATGTGGGTATAGCTGGGTCCCTCTTGCTTTAGGCATTA
GACCCAGTAGCCAGCCTCATCCCAATCATACCATCAACAGAAGACAAGAATGAACTATGT
TCAAATGACTTGCTTAGTATCCCAAGGATATAGATGGATGGAGATATACAGATGGGTAGA
TATAGATATTGCATATATCTATATTTCACCTGCCAGTGACTATAACACACAGGATTTGGC
CAACAATCTCCTAAAACCATGACATATATGCCAGTCGCTTGATATCCCTAACACCCCTTT
TGTTAATTTTCTATTGATATAGATAAATAGATAATTTCTATAGCTATAGTACAATATAGA
ACCAGACACGAGGGACCCCCCCCCCACTTCAGGACTGAATACATGGCTGCTCTACCCTCT
GCTTCAGGTAGGGAGCTGGGATGGCTTAGAGGAATGATGGGAACGTGGGGTTGGGGGCAA
GATAGAAGAAAACTCTTGTGCCAGGCTAGGACTCCTACTGTGGCCTTGATGCCCAAGAAA
ATGTGAAGTTATCACCCACCCCCTTAAAGATCAGCCACAGAGGCTTTCTGGAACTTACCA
CAGGCTGTATTCTTATACCGACTGTATACAAAGTGGAAGAAGAGTAAACCTGTCCTCTAT
ATACCTCAGCCCAGGCCTTGTACCTGGCCTATATTATAAATGGGGGGATGTTGGGGGACA
GGGATCACAAAAAGCTGACAAGATCCCCAGCACTGACCCAAATAATAGGTCCTAGGGGCC
CATTCTCCTCATTCTATAGATTATCCCAAAGCCATCCAACAAAGTGCAGAAAATTGTTCT
AGAAAATCAAAGCAGGGGCTGGGGTTGTAGCTCAGTGGTAAAGCATTTGCCTAGCATGTG
TGAGGCACTGGGTTTGATTCTCAGCATATATATAATAATAATAAAATAAAGTCATCAACA
CTAAAAAAAAATTAAAGAAACAAGAAATCAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCAAGTGCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved